Pichia pastoris and application thereof in fermentation production of single-cell protein

Abstract

A Pichia pastoris strain and its application in the fermentation production of single-cell protein belong to the field of microbial fermentation technology. The Pichia pastoris strain... Komagataella phaffii GG7 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39081, on December 2, 2025. This Pichia pastoris strain GG7 was isolated from soil in a methanol production plant area. It maintains good growth even in high concentrations of methanol (up to 8% (w / v)) and mixed carbon sources such as methanol, acetic acid, and ethanol, achieving a single-cell protein content of approximately 62 wt%. This strain is suitable for aerobic fermentation using methanol, ethanol, and / or acetic acid as carbon sources, exhibiting strong carbon source tolerance and high protein yield, making it suitable for industrial production of single-cell protein.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microbial fermentation, and particularly relates to a Pichia pastoris strain and application thereof in fermentation production of single-cell protein. BACKGROUND

[0002] Single-cell protein (SCP) is a novel protein resource synthesized by algal, fungal and bacterial cells, which can be used as a substitute for animal feed protein. SCP provides not only protein, but also lipids, carbohydrates, vitamins and minerals, which enhances its nutritional value. Microorganisms grow rapidly, have high protein content and do not depend on soil and climate, and the raw material sources are extensive, which can be cultured by using many low-value or waste raw materials, so that the production process of SCP is more efficient and sustainable than traditional agriculture.

[0003] Pichia pastoris is a typical methylotrophic microorganism, which can grow and ferment single-cell protein with methanol as the sole carbon source. In addition to methanol, glucose, ethanol, glycerol, fatty acids and other carbon sources are commonly used by Pichia pastoris. Unconventional carbon sources such as acetic acid and ethanol have also been gradually noticed by people. However, the tolerance of existing Pichia pastoris strains to acetic acid and ethanol is limited, especially the growth ability under high-concentration mixed carbon source conditions, which limits its application in industrial production. This is because acetic acid enters the intracellular in the form of undissociation, and is dissociated into protons and acetate ions due to the neutral environment in the cell. The accumulation of intracellular protons causes the acidification of the intracellular environment, which seriously inhibits the growth and metabolism of cells, and even leads to programmed death of yeast cells. High-concentration ethanol will produce toxicity to yeast cells, damage the membrane structure and directly inhibit the function of membrane proteins, and ethanol stress will lead to the decrease of yeast cell viability and fermentation stagnation.

[0004] Current research on Pichia pastoris mainly focuses on methanol as a carbon source. For example, Chinese patent application CN 101307294 A discloses a Pichia pastoris strain that rapidly utilizes industrial methanol and its applications. Specifically, it discloses a Pichia pastoris strain capable of using industrial methanol as both its sole carbon and energy source, classified as Pichia pastoris ME-SCP01, with the strain accession number CGMCC NO.2477. This strain belongs to the rapidly methanol-utilizing type of Pichia pastoris and can achieve high-density cell culture. Single-cell protein production can be carried out using this strain. A 1000-liter fermentation test showed that with an inoculum of 5%, after approximately 85 hours of fermentation, the cell dry weight reached 120-130 g / L, and the crude protein content reached approximately 50%. However, the methanol concentration in the culture medium can only be maintained at a maximum of 1%; excessively high methanol concentrations will inhibit the growth of ME-SCP01 cells or even kill them. Chinese patent application CN 116478838 A discloses a Pichia pastoris strain with multi-carbon source utilization and high protein synthesis, and its applications. Specifically, it discloses that the Pichia pastoris is *Pichia kudravzevii*. This strain can utilize diverse carbon sources such as sugars and low-alcohols, and can grow rapidly using methanol, glycerol, lactose, sucrose, fructose, and arabinose as sole carbon sources. The optimal growth temperature for this strain is 37°C, with tolerance up to 45°C. Its methanol tolerance is 3.5%, and the cell protein content is >56%. However, its ability to utilize acetic acid and ethanol has not been extensively investigated.

[0005] Therefore, the discovery and development of high-concentration-tolerant Pichia pastoris strains lays a solid foundation for the commercial production of single-cell proteins from ethanol and acetic acid, and provides more options for producing proteins using inexpensive chemical raw materials and industrial fermentation wastewater, which is of great significance for promoting the industrial production of single-cell proteins. Summary of the Invention

[0006] Technical problem to be solved: In view of the limited tolerance of existing Pichia pastoris strains to acetic acid and ethanol, this invention proposes a Pichia pastoris strain and its application in the fermentation production of single-cell protein. This strain can grow normally under high concentration (8% (w / v)) methanol conditions, and at the same time maintain good growth and high protein yield in mixed carbon sources such as methanol, ethanol and acetic acid.

[0007] Technical solution: The first objective of this invention is to provide a Pichia pastoris strain (Komagataella phaffii) GG7, deposited at the China General Microbiological Culture Collection Center (CGMCC); address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; accession number: CGMCC No. 39081; deposit date: December 2, 2025.

[0008] The second objective of this invention is to provide a culture containing the above-mentioned Pichia pastoris GG7.

[0009] The third objective of this invention is to provide an application of Pichia pastoris GG7 in the fermentation production of single-cell protein, wherein the carbon source used in the fermentation includes methanol and / or unconventional carbon sources, wherein the unconventional carbon sources include ethanol and / or acetic acid.

[0010] Preferably, when methanol is used as a single carbon source, its concentration is 0.5-8% w / v; when methanol is mixed with unconventional carbon sources as a carbon source, the amount of ethanol added is 5-25% v / v of the total carbon source; and the amount of acetic acid added is 5-15% v / v of the total carbon source.

[0011] Preferably, the amount of ethanol added is 20-25% of the total carbon source, v / v.

[0012] Preferably, the fermentation is carried out aerobically in a fermentation medium comprising: 85 wt% phosphate, 27 g / L; magnesium sulfate heptahydrate, 5.5 g / L; calcium sulfate dihydrate, 0.18 g / L; potassium sulfate, 6.6 g / L; 48 wt% potassium hydroxide, 3.33 g / L; glycerol, 24 g / L; PTM1, 3.6 mL / L. During fermentation, when the glycerol concentration in the fermentation broth reaches 0, carbon source is added 1 hour later.

[0013] Preferably, the PTM1 comprises: zinc sulfate heptahydrate, 42 g / L; copper sulfate pentahydrate, 6 g / L; ferrous sulfate heptahydrate, 65 g / L; manganese sulfate monohydrate, 3 g / L; cobalt chloride hexahydrate, 0.5 g / L; sodium iodide, 0.08 g / L; 95 wt% sulfuric acid, 5 mL; and biotin, 0.2 g / L.

[0014] The fourth objective of this invention is to provide a method for producing single-cell protein by fermentation, the method comprising aerobic fermentation culture using the above-mentioned Pichia pastoris GG7, with continuous addition of a carbon source during the fermentation process, the carbon source including methanol and / or unconventional carbon sources, the unconventional carbon source being ethanol and / or acetic acid.

[0015] As a preferred method, the inoculum size of Pichia pastoris GG7 is 2-10%, v / v; the dissolved oxygen content of aerobic fermentation culture is controlled at 20%, v / v; and the fermentation temperature is 28-30℃.

[0016] Beneficial effects:

[0017] (1) The present invention isolates a strain of Pichia pastoris GG7 from the soil of a methanol production plant, providing a new microbial resource for the production of single-cell protein using methanol as the sole carbon source, laying the foundation for promoting the industrial production of single-cell protein. It grows normally under high concentration of methanol (up to 8% (w / v)), with an OD600 of over 300, and the final crude protein content is determined to be over 60 wt%.

[0018] (2) The present invention provides a Pichia pastoris GG7 strain that can grow in high concentrations of methanol and acetic acid, effectively solving the problem of adapting and utilizing multiple carbon sources for Pichia pastoris. When methanol and acetic acid are carbon sources, especially when the amount of acetic acid added is 5-15% (v / v) of the total carbon source, the OD600 can reach more than 240, and the crude protein content is finally determined to be between 59-62 wt%.

[0019] (3) The present invention provides a Pichia pastoris GG7 that can grow in high concentrations of methanol and ethanol, effectively solving the problem of adapting and utilizing multiple carbon sources for Pichia pastoris. When methanol and ethanol are carbon sources, especially when the amount of ethanol added is 5-25% (v / v) of the total carbon source, the OD600 can reach more than 280, and the crude protein content is finally determined to be between 60-64 wt%.

[0020] Instructions for the preservation of biological materials:

[0021] The Pichia pastoris strain (Komagataella phaffii) GG7 provided by this invention is deposited at the China General Microbiological Culture Collection Center (CGMCC); address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; accession number: CGMCC No. 39081; deposit date: December 2, 2025. Attached Figure Description

[0022] Figure 1 This is a colony morphology diagram of Pichia pastoris GG7 screened in Example 1 of the present invention;

[0023] Figure 2 This is a magnified microscopic image of Pichia pastoris GG7, which was screened in Example 1 of this invention.

[0024] Figure 3The growth curves of Pichia pastoris GG7 fermented with methanol as the sole carbon source at different time points in Example 3 of this invention;

[0025] Figure 4 This is an image of a bacterial protein sample from Example 3 of the present invention;

[0026] Figure 5 This is a comparison diagram of the growth of strain x-33 and Pichia pastoris G77 in a mixed carbon source in Example 4;

[0027] Figure 6 This is the growth of Pichia pastoris GG7 in Example 7, fermented in a mixed carbon source of methanol, acetic acid, and ethanol. Detailed Implementation

[0028] The present invention will be further described below with reference to specific embodiments.

[0029] The reagents or instruments mentioned in the following examples do not specify the manufacturers, but can all be purchased through legitimate channels.

[0030] The culture medium formulation of this invention is as follows:

[0031] Delft medium consists of: dipotassium hydrogen phosphate 14.4 g / L, ammonium sulfate 7.5 g / L, magnesium sulfate heptahydrate 0.5 g / L, vitamin solution 1 ml / L, trace element solution 2 ml / L, and 0.5% (w / v) methanol (as the sole carbon source). The vitamin solution includes: biotin 0.05 g / L, para-aminobenzoic acid 0.2 g / L, nicotinic acid 1 g / L, calcium pantothenate 1 g / L, pyridoxine hydrochloride 1 g / L, thiamine hydrochloride 1 g / L, and inositol 25 g / L. The trace element solution includes: calcium chloride dihydrate 4.5 g / L, zinc sulfate heptahydrate 4.5 g / L, ferrous sulfate heptahydrate 3.0 g / L, boric acid 1 g / L, manganese chloride tetrahydrate 1 g / L, sodium molybdate dihydrate 1 g / L, cobalt chloride hexahydrate 0.3 g / L, copper sulfate pentahydrate 0.1 g / L, potassium iodide 0.1 g / L, and EDTA 15 g / L. The solid culture medium is supplemented with 2% (w / v) agar powder.

[0032] YPD medium consists of: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and 2 wt% agar powder added to the solid medium.

[0033] The fermentation medium consisted of: 85 wt% phosphate 27 g / L, magnesium sulfate heptahydrate 5.5 g / L, calcium sulfate dihydrate 0.18 g / L, potassium sulfate 6.6 g / L, 48 wt% potassium hydroxide 3.33 g / L, glycerol 24 g / L, and PTM1 3.6 mL / L. PTM1 consisted of: zinc sulfate heptahydrate 42 g / L, copper sulfate pentahydrate 6 g / L, ferrous sulfate heptahydrate 65 g / L, manganese sulfate monohydrate 3 g / L, cobalt chloride hexahydrate 0.5 g / L, sodium iodide 0.08 g / L, 95 wt% sulfuric acid 5 mL, and biotin 0.2 g / L.

[0034] Example 1: Screening and identification of Pichia pastoris

[0035] The methanol production plant of Xinxiang Zhongxin Chemical Co., Ltd. in Xinxiang City, Henan Province, was selected as the sampling environment for the isolation, screening, and identification of Pichia pastoris (methanol yeast) strains. The specific procedures are as follows:

[0036] 1. Screening of methanolyzygium strains;

[0037] Take 1 g of soil sample (selected from the methanol production plant of Xinxiang Zhongxin Chemical Co., Ltd., Xinxiang City, Henan Province), dilute and mix with 10 mL of distilled water to obtain a soil dilution. Take 200 μL of the soil dilution and add it to 200 mL of Delft medium. Incubate at 30℃ and 250 rpm for 12 h. Take 200 μL of the culture liquid and add it to 200 mL of Delft medium with an additional 0.1% (w / v) ethanol. Incubate at 30℃ and 250 rpm for 12 h. Then take 200 μL of the culture and add it to 200 mL of Delft medium with an additional 0.1% (w / v) ethanol and 0.1% (w / v) acetic acid. Incubate at 30℃ and 250 rpm for 12 h. Then take 100 μL of the final culture liquid, dilute it 1000 times, spread it on a Delft medium plate, pick out well-grown single colonies, and streak them onto new Delft solid medium. After five streaking processes, a pure strain was finally obtained and named Pichia pastoris GG7.

[0038] 2. Identification of Pichia pastoris GG7;

[0039] (1) Morphological observation

[0040] The isolated Pichia pastoris GG7 was streaked on Delft solid medium and the colony morphology was observed.

[0041] See results Figure 1 and Figure 2As shown in the figure, the selected colonies are 1-2 mm in diameter, round, with neat edges, opaque, milky white on the front, raised in the middle, smooth, bright, moist, and easily picked up. These characteristics are consistent with the colony morphology of Pichia pastoris.

[0042] (2) Identification of 26S rRNA

[0043] Genomic extraction of Pichia pastoris GG7: Single colonies of Pichia pastoris GG7 were inoculated into 3 mL of YPD medium and cultured at 30℃ and 250 rpm for 12 h in a shaker. The cells were collected by centrifugation at 12000 rpm for 1 min, and the genome of Pichia pastoris GG7 was extracted using the Takara Yeast Genome Extraction Kit (purchased from the Takara website). Using the Pichia pastoris GG7 genomic DNA as a template, universal primers for fungal 26S rRNA were used. The forward primer sequence was F:5-GCATATCAATAAGCGGAGGAAAAG-3' (SEQ ID NO.1), and the reverse primer sequence was R:5-GGTCCGTGTTTCAAGACGG-3' (SEQ ID NO.2). The primers were synthesized by Shanghai Sangon Biotech. PCR amplification was used to screen for the 26S rRNA region of Pichia pastoris GG7. PCR amplification was performed using KOD FX enzyme (Toyobo). The amplification system and conditions were as shown in the instruction manual. The PCR amplification program was as follows: pre-denaturation: 94℃, 2 min; denaturation: 98℃, 10 sec; annealing: 53℃, 30 sec; extension: 68℃, 45 sec; 30 cycles; final extension: 68℃, 10 min. The PCR reaction system consisted of: 2× KOD FX buffer: 25 μL; 2 mM dNTPs: 5 μL; primer F (10 pmol / μL): 1 μL; primer R (10 pmol / μL): 1 μL; Pichia pastoris GG7 genome: 1 μL; sterile water: 16 μL; KOD enzyme: 1 μL. Sequencing and Blast analysis revealed that Pichia pastoris GG7 showed the highest homology with Pichia pastoris (Komagataella phaffii). Based on the strain's methanol utilization ability, it was identified as Pichia pastoris.

[0044] The 26S rRNA sequence of Pichia pastoris GG7 (SEQ ID NO.3):

[0045] cggaggaaaagaaaccaacagggattgcctcagtaacggcgagtgaagcggcaaaagtccacctttgaagtattgacgtggttgggagaggcaatgtgcacaagtcgcctggaacggccgccaaagagggtgatagccccgtagcacggtcaaccttcccagccgacagagtcgagt tgtttgggaatgcagctctaaaggtggtagggtccatcaaagactaaatatcagcgagagaccgatagcaaacaagtacagtgatggaaagatgaaaagaactttgaaaagagagtgaaacagtgcgtgaaattggggggagggaaggcaaggccacgacaagtggtcctgcgcccg.

[0046] Example 2: Test culture of Pichia pastoris GG7 in methanol

[0047] Delft media supplemented with 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, and 10% methanol were prepared. Pichia pastoris GG7 was cultured overnight in YPD medium until an OD600 of 2-6 was reached. 200 μL of the culture was then transferred to Delft medium supplemented with 0.5% methanol and cultured for 48 h. 200 μL was then transferred to Delft medium supplemented with 1% methanol and cultured for another 48 h. After that, 200 μL was transferred to Delft medium supplemented with 2% methanol. This process was repeated sequentially with 3%, 4%, 5%, 6%, 7%, 8%, 9%, and 10% methanol, and cultured for 48 h each time. All cultures were performed at 30°C and 220 rpm in a shaker. The OD600 was measured after 48 h of culture before transfer.

[0048] The growth of Pichia pastoris GG7 in methanol of different concentrations is shown in Table 1 below.

[0049] Table 1. Growth of Pichia pastoris GG7 in methanol at different concentrations

[0050]

[0051] As can be seen from Table 1 above, Pichia pastoris GG7 maintains good growth at both low methanol concentration (0.5%) and high methanol concentration (8%), with an OD600 value of over 2.4 after 48 h of culture. When the methanol concentration reaches 10%, the growth of Pichia pastoris is inhibited, and the OD600 remains very low after 48 h of culture. Therefore, the preferred methanol concentration is 0.5-8%.

[0052] Unless otherwise specified, the percentage of methanol added above is in the form of percentage (w / v).

[0053] Example 3: Application of Pichia pastoris GG7 in methanol fermentation

[0054] Experimental methods:

[0055] (1) Primary seed culture: The isolated and purified Pichia pastoris GG7 glycerol tube stock was streaked on a YPD plate and placed in a 30℃ incubator for 2 days. Single colonies that grew on the plate were picked and inoculated into 4 mL test tubes and cultured overnight at 30℃ and 220 rpm until the OD600 was 2-6, thus obtaining the primary seed culture.

[0056] (2) Secondary seed culture: Take 1 mL of the primary seed culture from the test tube culture and inoculate it into a 50 mL YPD medium shake flask. Simultaneously transfer it to 6 flasks and culture overnight at 30℃ and 220 rpm on a shaker until the OD600 is 3-10 to obtain the secondary seed culture.

[0057] (3) Tertiary seed culture: Inoculate 300 mL of the secondary seed culture into 3 L of fermentation medium at 30℃, stir at 500 rpm, introduce air at a gas rate of 0.5 L / min and culture overnight until the OD600 is 20-30 to obtain the tertiary seed culture.

[0058] (4) Fermentation culture: 3L of the tertiary seed culture was inoculated into 110L of fermentation medium, and the culture was carried out at 30℃ with a stirring speed of 300rpm and air was introduced at a gas velocity of 3 m / s. 3 Aerobic fermentation was carried out under conditions of / h. As dissolved oxygen (DO) decreased, the gas flow rate and agitation were increased to maintain DO at no less than 20% (v / v). Biomass, wet weight, and products were measured at different time points. When the glycerol concentration in the fermentation broth was detected to be 0, pure methanol was added as a carbon source for induction 1 h later. The initial addition was 250 mL, and after waiting for DO to rise back to 100% (v / v), methanol was added at a flow rate of 25 mL / h, increasing the methanol gradient by 10 mL per hour until the final flow rate reached 150 mL / h. Mass transfer was increased (agitation, tank pressure, and gas flow rate) to control dissolved oxygen at 20% (v / v), and fermentation was carried out for 120 h. OD600 and wet weight were measured after fermentation, and the results showed the following... Figure 3Pichia pastoris GG7 exhibited excellent growth capacity when using methanol as the sole carbon source. Its OD600 reached over 300, and its wet weight exceeded 500 g / L. After 120 h of fermentation, all fermentation broth was collected, centrifuged, and dried to obtain the final product of the cell protein, such as... Figure 4 As shown, the final measured crude protein content reached 62.13 wt%.

[0059] Example 4: Shake-flask test of Pichia pastoris GG7 with three carbon sources

[0060] Pichia pastoris x-33 (purchased from Kanglang Biotechnology Co., Ltd.) and Pichia pastoris GG7 were streaked onto YPD plates and incubated at 30℃ for 2 days. Single colonies grown on the plates were picked and inoculated into 4 mL test tubes and cultured at 30℃ and 220 rpm for 16-18 h to obtain seed culture. 2 mL of the seed culture was transferred to a shake flask containing 50 mL of Delft medium, which was additionally supplemented with 3% (w / v) methanol, 2% (w / v) ethanol and 0.5% (w / v) acetic acid. The culture was incubated at 30℃ and 220 rpm for 5 days, and the biomass of the fermentation broth was measured daily.

[0061] The results showed that, Figure 5 Strain X-33 grew slowly in the three mixed carbon sources. The initial OD600 was 1.64. After one day of culture, the OD600 decreased to 0.57. On the second day, the OD600 increased to 0.9 and gradually began to grow. By the fifth day, the OD600 had increased to 14, which may be related to the volatilization of ethanol, acetic acid and methanol over time. In contrast, Pichia pastoris GG7 maintained relatively good growth ability in the three mixed carbon sources, indicating that its tolerance was better than that of X-33.

[0062] Example 5: Application of Pichia pastoris GG7 in methanol + ethanol fermentation

[0063] This embodiment uses the same method as Embodiment 3, except that during induction, 95% (v / v) methanol + 5% (v / v) ethanol, 90% (v / v) methanol + 10% (v / v) ethanol, 80% (v / v) methanol + 20% (v / v) ethanol, 75% (v / v) methanol + 25% (v / v) ethanol, and 70% (v / v) methanol + 30% (v / v) ethanol are selected as carbon sources, respectively.

[0064] The growth results of Pichia pastoris GG7 in a mixed carbon source of methanol and ethanol are shown in Table 2 below.

[0065] Table 2. Growth of Pichia pastoris GG7 in a mixed carbon source of methanol and ethanol.

[0066]

[0067] Table 2 shows the growth of Pichia pastoris GG7 under different ethanol conditions. Pichia pastoris GG7 exhibits good growth ability under methanol and different concentrations of ethanol as carbon sources. Furthermore, as the ethanol concentration increases, the OD600 can reach over 280. However, the OD600 decreases significantly after the concentration exceeds 25%. Therefore, an ethanol addition of 5-25% is the optimal condition. After fermentation, the fermentation broth was discharged and centrifuged to obtain cell protein, with a crude protein content between 60-64 wt%.

[0068] Example 6: Application of Pichia pastoris GG7 in methanol + acetic acid fermentation

[0069] This embodiment uses the same method as Embodiment 3, except that during methanol induction, 95% (v / v) methanol + 5% (v / v) acetic acid, 90% (v / v) methanol + 10% (v / v) acetic acid, 85% (v / v) methanol + 15% (v / v) acetic acid, and 80% (v / v) methanol + 20% (v / v) acetic acid are added respectively to induce culture.

[0070] The growth results of Pichia pastoris GG7 in a mixed carbon source of methanol and acetic acid are shown in Table 3 below.

[0071] Table 3. Growth of Pichia pastoris GG7 in a mixed carbon source of methanol and acetic acid.

[0072]

[0073] The data in Table 3 above show the growth of Pichia pastoris GG7 under different acetic acid concentrations. Pichia pastoris GG7 exhibits good growth ability under methanol and different concentrations of acetic acid as carbon sources. Furthermore, as the acetic acid concentration increases, the OD600 can reach over 240. However, the OD600 decreases significantly after the concentration exceeds 15%. Therefore, an acetic acid addition of 5%-15% is the preferred condition. After fermentation, the fermentation broth was discharged and centrifuged to obtain cell protein, with a crude protein content between 59-62 wt%.

[0074] Example 7: Application of Pichia pastoris GG7 in methanol + acetic acid + ethanol fermentation

[0075] This embodiment uses the same method as Embodiment 3, except that during methanol induction, 75% (v / v) methanol + 20% (v / v) ethanol + 5% (v / v) acetic acid of the original methanol addition amount are added for induction culture.

[0076] See results Figure 6Pichia pastoris GG7 exhibited good growth ability under the conditions of mixed carbon source of 75% methanol + 20% ethanol + 5% acetic acid. With the increase of culture time, the cell biomass gradually increased, and the wet weight could reach more than 260. After fermentation for 120 h, the fermentation broth was discharged and centrifuged to dry, and the cell protein was obtained, with a crude protein content of 62.3 wt%.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A type of Pichia pastoris ( Komagataella phaffii GG7, characterized in that, The accession number is: CGMCC No.39081.

2. A culture comprising the Pichia pastoris GG7 of claim 1.

3. The application of Pichia pastoris GG7 as described in claim 1 in the fermentation production of single-cell protein, characterized in that, The carbon source used in fermentation is methanol and an unconventional carbon source, wherein the unconventional carbon source is ethanol and / or acetic acid.

4. The application according to claim 3, characterized in that, The amount of ethanol added is 5-25% of the total carbon source, v / v; the amount of acetic acid added is 5-15% of the total carbon source, v / v.

5. The application according to claim 4, characterized in that, The amount of ethanol added is 20-25% of the total carbon source, v / v.

6. The application according to claim 3, characterized in that, The fermentation was carried out aerobically in a fermentation medium, which consisted of: 85 wt% phosphate, 27 g / L; magnesium sulfate heptahydrate, 5.5 g / L; calcium sulfate dihydrate, 0.18 g / L; potassium sulfate, 6.6 g / L; 48 wt% potassium hydroxide, 3.33 g / L; glycerol, 24 g / L; and PTM1, 3.6 mL / L. During fermentation, carbon source was added 1 hour after the glycerol concentration in the fermentation broth reached 0.

7. The application according to claim 6, characterized in that, The PTM1 comprises: zinc sulfate heptahydrate, 42 g / L; copper sulfate pentahydrate, 6 g / L; ferrous sulfate heptahydrate, 65 g / L; manganese sulfate monohydrate, 3 g / L; cobalt chloride hexahydrate, 0.5 g / L; sodium iodide, 0.08 g / L; 95 wt% sulfuric acid, 5 mL; and biotin, 0.2 g / L.

8. A method for producing single-cell protein by fermentation, characterized in that, The method includes aerobic fermentation culture using Pichia pastoris GG7 as described in claim 1, with continuous addition of a carbon source during the fermentation process. The carbon source is methanol and unconventional carbon sources, with unconventional carbon sources being ethanol and / or acetic acid.

9. A method for producing single-cell protein by fermentation according to claim 8, characterized in that, The inoculum size of Pichia pastoris GG7 is 2-10%, v / v; the dissolved oxygen level in aerobic fermentation culture is controlled at 20%, v / v; and the fermentation temperature is 28-30℃.

Images