Application of TaGRF2-A gene in enhancing heat resistance of wheat

Abstract

The invention relates to application of a TaGRF2-A gene in enhancing heat resistance of wheat, and belongs to the field of plant genetic engineering. Specifically, the wheat TaGRF2-A gene participating in positive regulation and control of high-temperature stress resistance is cloned in wheat, so that the wheat TaGRF2-A gene is overexpressed, and compared with a wild plant, a wheat plant with the overexpressed TaGRF2-A gene shows higher high-temperature resistance; the TaGRF2-A gene enhances the tolerance of wheat under a high-temperature condition in manners of regulating the stomatal conductance of plants, optimizing the photosynthesis efficiency, improving the water utilization efficiency and the like, and a new genetic engineering modification means is provided for cultivating a new wheat variety with high yield, stable yield and high temperature resistance.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and more particularly to... TaGRF2-A Application of genes in enhancing wheat heat resistance. Background Technology

[0002] High temperatures, as one of the major environmental factors affecting global crop production, pose a serious threat to food crops such as wheat. Wheat, as a vital global food crop, has its yield and quality directly impacting global food security. However, with global warming, high temperatures are becoming more frequent and prolonged, exacerbating the heat stress experienced by wheat during its growth process. High temperatures hinder photosynthesis and increase respiration, leading to reduced dry matter accumulation, which in turn affects grain filling, resulting in a decrease in thousand-grain weight and ultimately a significant reduction in wheat yield. Simultaneously, high temperatures damage wheat cell membrane structures, triggering oxidative stress reactions, producing large amounts of reactive oxygen species, damaging intracellular macromolecules, affecting normal physiological functions, and reducing wheat quality. Therefore, developing wheat varieties with strong heat resistance is of great significance for improving crop yields and ensuring food security.

[0003] Faced with the severe challenges posed by high-temperature stress to wheat production, traditional heat-resistant breeding methods have become the primary means of coping. These methods mainly rely on variety selection and conventional genetic improvement techniques. This involves screening for varieties with good heat resistance from existing wheat germplasm resources and then gradually integrating heat-resistant traits into the target variety through conventional breeding techniques such as hybridization and backcrossing. These methods can improve crop heat resistance to some extent; for example, through long-term selection, some wheat varieties that perform relatively stably in high-temperature regions have been obtained. However, traditional methods have significant limitations. Their breeding cycles are long, often requiring several years or even decades to develop stable new varieties, resulting in low efficiency. Furthermore, traditional methods struggle to deeply understand the function of heat-resistant genes at the molecular level and cannot precisely regulate the expression of related genes, limiting the depth and breadth of improvements in wheat heat resistance.

[0004] With the rapid development of molecular biology and genetic engineering technologies, improving crop heat resistance through gene regulation has become a new research hotspot and feasible approach. In plants, the 14-3-3 protein family is a highly conserved protein family that plays a crucial role in various physiological processes, including growth and development, environmental adaptation, and stress response. 14-3-3 proteins regulate important physiological activities such as stomatal movement, ion channels, and ABA signaling by interacting with various target proteins. As early as 1967, researchers Moore and Perez isolated some acidic soluble proteins from bovine brain tissue. These proteins were separated using a diethylaminoethyl cellulose (DEAE-cellulose) column and, based on migration rates after starch gel electrophoresis, were ultimately named 14-3-3 proteins (Zhao et al., 2021). These proteins are also known as GRF (GENERAL REGULATORY FACTOR) and GF14 (G-BOX FACTOR 14-3-3).

[0005] Plant 14-3-3 proteins possess unique structural and functional properties. They are highly conserved and regulate the structure, transcription, subcellular localization, and stability of target proteins by binding to them and forming homodimers or heterodimers, thereby precisely modulating the function of the target proteins (Jiang et al., 2024). In plant 14-3-3 proteins, phosphorylation occurs at different sites in an isoform-specific manner; this specific phosphorylation participates in the dimerization and interaction between 14-3-3 and target proteins (Johnson et al., 2010). Furthermore, 14-3-3 proteins can autophosphorylate or phosphorylate after interaction with target proteins (Schoonheim et al., 2007), thereby regulating their own or their target proteins' catalytic activity, stability, substrate specificity, and the disassembly or assembly of macromolecular complexes (Ormancey et al., 2017). Therefore, the plant 14-3-3 protein mainly functions by interacting with target proteins, playing an extremely important role in plant growth, development and stress response (Jianget al., 2022b).

[0006] Plant 14-3-3 proteins are involved in a wide range of physiological processes, including the regulation of ion channel activity (Cotelle & Leonhardt, 2015), hormone signal transduction (Camoni et al., 2018), metabolic regulation (Fulgosi et al., 2002), and stomatal movement. 14-3-3 proteins can interact with receptors, ion pumps, channels, and protein kinases in guard cells, thereby participating in stomatal signal transduction and further responding to biotic and abiotic stresses (Cotelle & Leonhardt, 2015). Environmental stress can affect the function of 14-3-3 protein in a variety of ways (Denison et al., 2011), such as activating signaling pathways and phosphorylation of corresponding proteins (Paul et al., 2012), affecting the transcriptional activity of 14-3-3 and signaling molecules (e.g., Ca²⁺ and AMP) (Jaspert et al., 2011), and altering post-translational modifications (PTMs) of 14-3-3 isoforms (de Boer et al., 2013; Wilson et al., 2016).

[0007] Previous studies have shown that the 14-3-3 protein plays an important role in plant responses to heat stress. Heterologous expression of Haloxylon ammodendron... 14-3-3 (FT-1) Transfusing the gene into Arabidopsis thaliana increases the expression of genes related to energy production, protein metabolism, proline metabolism, and chlorophyll metabolism, thereby significantly improving the heat tolerance of Arabidopsis thaliana (Pan et al., 2023). Overexpression in tomato SlTFT6 It can increase its enzyme activity content, reduce reactive oxygen species, and increase SlHSP The expression level of this protein was increased, thereby improving the tolerance of tomatoes to high temperature stress (Liang et al., 2023). Under high temperature conditions, Arabidopsis thaliana 14-3-3 protein also participates in stomatal opening, and the stomatal aperture of 14-3-3 mutant plants was significantly reduced (Kostaki et al., 2020).

[0008] It is worth noting that GRF types in the 14-3-3 protein (such as TaGRF) may also have similar important functions in wheat, but whether the wheat 14-3-3 protein is involved in heat stress and the specific mechanism of TaGRF's role in it remains unclear. Further investigation into the role of the wheat 14-3-3 protein, especially TaGRF, in heat stress response is expected to provide new theoretical basis and genetic resources for breeding heat-resistant wheat varieties through genetic engineering. Summary of the Invention

[0009] To address the technical problems in the background art, the present invention provides, in one aspect, […]. TaGRF2-A The application of genes in improving wheat heat resistance. On the other hand, this invention also provides a method for improving wheat heat resistance, comprising: overexpression... TaGRF2-A Genes. Furthermore, the present invention also provides... TaGRF2-A Application of genes in genetic breeding to improve wheat yield traits under high temperature stress during the grain-filling stage.

[0010] In one aspect, the present invention provides TaGRF2-A The application of the gene in improving wheat heat resistance and / or wheat variety improvement is characterized by overexpression of the gene. TaGRF2-A Genes, the ones mentioned TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO:1.

[0011] In yet another aspect, the present invention provides a product containing TaGRF2-A The application of recombinant vectors of genes in enhancing wheat heat resistance and / or improving wheat varieties is characterized by overexpression of the aforementioned gene. TaGRF2-A Genes, the ones mentioned TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO:1.

[0012] In another aspect, the present invention provides the application of genetically engineered bacteria in enhancing wheat heat resistance and / or improving wheat varieties, characterized in that the genetically engineered bacteria comprises... TaGRF2-A Recombinant vectors of genes, overexpressing the aforementioned TaGRF2-A Genes, the ones mentioned TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO:1.

[0013] In another aspect, the present invention provides a method for improving wheat heat resistance and / or wheat variety improvement through genetic breeding, characterized in that the method comprises: overexpressing wheat... TaGRF2-A Genes, the wheat TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO: 1.

[0014] In another aspect, the present invention provides a method for obtaining wheat plants with improved traits, characterized by comprising the following processing steps: (1) Infecting wheat embryos with genetically engineered bacteria; and (2) The infected wheat embryos were cultured into wheat plants; The genetically engineered bacteria contain TaGRF2-A Recombinant vectors of genes, overexpressing the aforementioned TaGRF2-A Genes, the ones mentioned TaGRF2-AThe nucleotide sequence of the gene coding region is shown in SEQ ID NO: 1.

[0015] Preferably, the carrier described in this invention is a pLGY carrier.

[0016] Preferably, the genetically engineered bacterium described in this invention is Agrobacterium GV3101.

[0017] Preferably, the trait improvement described in this invention is manifested in the following way: compared to ordinary control wheat plants, TaGRF2-A Overexpression of the gene enhances heat resistance and improves yield traits in wheat.

[0018] Preferably, the improvement in yield trait is manifested as follows: compared to ordinary control wheat plants, TaGRF2-A The number of grains per spike, grain size (length and width), and thousand-grain weight of wheat plants with overexpressed genes were maintained or increased.

[0019] Compared with the prior art, the present invention has the following beneficial effects: This invention clarifies wheat TaGRF2-A Genes play a crucial role in regulating physiological processes such as stomatal conductance, photosynthetic efficiency, and water use efficiency in plants, thereby enhancing their tolerance to heat conditions. This discovery fills a gap in research on the role of wheat 14-3-3 protein in heat stress response and provides a new perspective for understanding wheat's heat resistance mechanisms.

[0020] Traditional heat-resistance breeding methods mainly rely on variety selection and conventional genetic improvement, which are time-consuming and have limited effectiveness. This application proposes a genetic engineering method for enhancing wheat heat resistance, which uses genetic engineering technology to... TaGRF2-A By introducing the gene into the target plant wheat and screening for transgenic wheat expressing the gene, key genetic resources and technical solutions are provided for breeding new wheat varieties that are high-yielding, stable-yielding, and heat-resistant. Attached Figure Description

[0021] Figure 1 In Example 1 TaGRF2 A diagram illustrating the expression patterns of family members in different tissues under heat stress.

[0022] Figure 2 In Example 4 TaGRF2-A Subcellular localization fluorescence analysis diagram.

[0023] Figure 3 For example, the wild-type wheat Fielder and TaGRF2-A Phenotypic diagram of the thermal response of wheat with gene overexpression.

[0024] Figure 4 For example, the wild-type wheat Fielder and TaGRF2-AReactive oxygen species staining diagram of wheat with gene overexpression.

[0025] Figure 5 For example, the wild-type wheat Fielder and TaGRF2-A The plot shows the CO2 assimilation rate of wheat with gene overexpression. The blue bars represent the control (Fielder), and the gray bars represent the overexpression level in wheat. TaGRF2-A-OE .

[0026] Figure 6 For example, the wild-type wheat Fielder and TaGRF2-A A transpiration rate graph of wheat with gene overexpression; the blue bars represent the control (Fielder), and the gray bars represent the overexpression level in wheat. TaGRF2-A-OE .

[0027] Figure 7 For example, the wild-type wheat Fielder and TaGRF2-A Intercellular carbon dioxide concentration in wheat with gene overexpression: blue bars represent the control (Fielder), and gray bars represent wheat with overexpression levels. TaGRF2-A-OE .

[0028] Figure 8 For example, the wild-type wheat Fielder and TaGRF2-A Stomatal conductance diagram of wheat with gene overexpression; blue bars represent control (Fielder), gray bars represent wheat with overexpression level. TaGRF2-A-OE .

[0029] Figure 9 For example, the wild-type wheat Fielder and TaGRF2-A Vapor pressure gradient plot of wheat with gene overexpression; blue bars represent the control (Fielder), and gray bars represent wheat with overexpression levels. TaGRF2-A-OE .

[0030] Figure 10 For example, the wild-type wheat Fielder and TaGRF2-A Water use efficiency graph of wheat with gene overexpression. Blue bars represent the control (Fielder), and gray bars represent wheat with overexpression levels. TaGRF2-A-OE .

[0031] Figure 11 In Example 6 TaGRF2-A Differential gene map of wheat with gene overexpression.

[0032] Figure 12 In Example 6 TaGRF2-A Predicted protein-protein interaction diagram of wheat with overexpressed genes.

[0033] Figure 13 In Example 6 TaGRF2-A GO annotation analysis diagram of wheat with gene overexpression.

[0034] Figure 14 In Example 6 TaGRF2-A A diagram of the KEGG pathway in wheat with gene overexpression.

[0035] Figure 15 For example, the wild-type wheat Fielder in Example 7 and TaGRF2-A A diagram showing the number of tillers in wheat with overexpressed genes.

[0036] Figure 16 For example, the wild-type wheat Fielder in Example 7 and TaGRF2-A Plant height diagram of wheat with overexpressed genes.

[0037] Figure 17 For example, the wild-type wheat Fielder in Example 7 and TaGRF2-A A graph showing the number of grains per ear in wheat with overexpressed genes.

[0038] Figure 18 For example, the wild-type wheat Fielder in Example 7 and TaGRF2-A Grain length diagram of wheat with overexpressed genes.

[0039] Figure 19 For example, the wild-type wheat Fielder in Example 7 and TaGRF2-A Grain width diagram of wheat with overexpressed genes.

[0040] Figure 20 For example, the wild-type wheat Fielder in Example 7 and TaGRF2-A Thousand-grain weight diagram of wheat with overexpressed genes. Detailed Implementation

[0041] This invention provides TaGRF2-A Application of genes in improving wheat heat tolerance or cultivating heat-resistant transgenic wheat plants. In this invention, the... TaGRF2-A The nucleotide sequence of the gene coding region is shown in SED ID No. 1, and the specific sequence information is as follows: SEQ ID NO: 1 .

[0042] The present invention will be further described below with reference to specific embodiments and accompanying drawings. The following are only specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto.

[0043] In this invention, unless otherwise specified, the equipment and raw materials used are commercially available or commonly used in the field. The methods in the following embodiments, unless otherwise specified, are conventional methods in the field.

[0044] Example 1TaGRF2 Family expression patterns in different tissues under heat stress Wheat fielders treated at 36℃ / 25℃ for 16 / 8 h for 0 and 5 days were sampled, and total RNA was extracted from different tissues of the wheat fielders. The obtained total RNA was reverse transcribed into cDNA; qRT-PCR experiments were performed, and samples were selected... TaActin Genes were used as internal controls, and several biological replicates were performed in each treatment group, and the results were obtained through 2... −ΔΔCt Method Calculation TaGRF2- A Gene expression level.

[0045] Table 1 Primer list for quantitative real-time polymerase chain reaction (qRT-PCR)

[0046] General regulatory factor GRF Hormones play a crucial regulatory role in plant growth and development, stress response, and hormone signal transduction. This is particularly true for common wheat. GRF The members conducted an evaluation, and the results showed that... TaGRF Different organizational patterns of expression among family members after experiencing heat stress, such as Figure 1 As shown, from Figure 1 It can be seen that, TaGRF2-A The gene family was highly expressed in different tissues. This suggests that the gene family may be related to wheat's response to high-temperature stress and may play an important role in improving wheat's heat tolerance.

[0047] Example 2 TaGRF2-A Construction of gene overexpression vectors RNA was extracted from wheat fielder using the Aidlab RN38-EASYspin Plus kit, and then reverse transcribed into cDNA using the Takara qScript cDNA Synthesis Kit. Amplification was performed using primers with adapters. TaGRF2-A cDNA fragments of genes, obtained TaGRF2-A The gene fragment was cloned into the overexpression vector pLGY-OE, and the sequencing primer sequences are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0048] ubi-f-OE-Wheat: gccctgccttcatacgcta (SEQ ID NO: 2) E9-R-OE-Wheat:cccaatgccataatactcaaactc (SEQ ID NO: 3) By restriction endonuclease BamHI The linearized vector pLGY-OE was digested with enzymes. Results were detected using agarose gel electrophoresis. TaGRF2-A Gene fragments, and their recovery and purification. TaGRF2-A Gene fragments. For recovery and purification. TaGRF2-A The gene fragment and the recovered, purified, linearized vector fragment were ligated to form a recombinant vector. Positive identification was performed using vector primers, followed by sequencing.

[0049] Example 3 TaGRF2-A Obtaining wheat plants with overexpressed genes Using the PFAM database (PF00244) and NCBI GeneBank to... TaGRF2-A The gene (TraesCS3A02G055600.1) was screened and compared to obtain... TaGRF2-A The complete sequence of the gene coding region is shown in SEQ ID NO: 1.

[0050] The wheat Fielder overexpression vector pLGY-OE was digested with enzymes to obtain... TaGRF2-A A gene fragment is ligated into an overexpression vector to obtain... TaGRF2-A-OE Carrier. TaGRF2-A-OE The vector was transferred into Agrobacterium and positive identification was performed. Positive plants were obtained by transforming wheat immature embryos mediated by Agrobacterium GV3101.

[0051] Example 4 TaGRF2-A Subcellular localization of genes Using the Nimble Cloning kit from NC Biotech, TaGRF2-A The gene was cloned into the GFP pNC-Green-SubN vector. After ensuring the accuracy of the cloning results, plasmid extraction was performed, and the correctly sequenced bacterial culture was stored in 15% glycerol.

[0052] A single clone of the target Agrobacterium was inoculated into liquid LB medium containing kanamycin and rifampin, cultured overnight, centrifuged, and resuspended at OD. 600 =0.8. Mix two types of Agrobacterium at a 1:1 volume ratio for injection. Select fully expanded tobacco leaves that have grown for 4 weeks, and inject the mixture of the two Agrobacterium species from the underside of the leaves, injecting 3–5 tobacco leaves with each bacterial solution. Incubate in a humidified environment in the dark for 2–3 days, then sample and observe.

[0053] In order to study TaGRF2-A To determine the specific subcellular location of genes, this study investigated transient transformation in tobacco leaves, specifically targeting genes carrying... TaGRF2-A Fusion GFP ( TaGRF2-ATobacco leaves were transformed with Agrobacterium tumefaciens (GFP), and fluorescence signals were observed using a laser confocal microscope. Leaves transformed with the empty GFP vector showed strong fluorescence in the cell nucleus, cytoplasm, and cell membrane, while those transformed with the empty GFP vector showed strong fluorescence in the cell nucleus, cytoplasm, and cell membrane. TaGRF2-A The leaves of the plant exhibit strong fluorescence signals primarily in the cell nucleus and cytoplasmic membrane. These results indicate that... TaGRF2-A Primarily located on the cell nucleus and cell membrane ( Figure 2 ).

[0054] Example 5 TaGRF2-A Heat resistance test of wheat with overexpressed gene 1. TaGRF2-A Thermoresponsive phenotype of wheat with overexpressed genes To assess the heat resistance of wheat plants, the wheat obtained in Example 3 was used. TaGRF2-A Overexpressing plants were subjected to a 36°C heat treatment for 7 days when the seedlings reached the tillering stage, compared with plants that were normally watered (25°C) as a control.

[0055] Photos of the growth status of the plant experimental group and the control group are shown below. Figure 3 As shown. Inoculation with overexpression TaGRF2-A Wheat plants with the gene showed less heat damage than control plants, indicating that TaGRF2-A It is related to the heat resistance of wheat.

[0056] 2. TaGRF2-A NBT and DAB staining of wheat with overexpressed genes Two sets of leaf samples, each approximately 3 cm in length, were cut and taken in triplicate. The leaves were then immersed in prepared NBT (Nitroblue tetrazolium chloride) and DAB (3,3'-diaminobezidin) staining solutions. The samples were incubated at room temperature in the dark for 24 h and 48 h, respectively. After complete staining, the leaves were soaked in 95% ethanol, with the ethanol solution replaced every 12 h, until the leaves were completely destained. The samples were then photographed using a stereomicroscope.

[0057] NBT turns blue upon reaction with O2⁻, which is used to distinguish between normal and heat-treated wild-type NBT. TaGRF2-A Distribution of O2⁻ in the leaves of wheat with overexpressing the gene. DAB reacts with H₂O₂ to produce a brownish-yellow color, which is used to detect the distribution in wild-type and wild-type wheat under normal growth conditions and after heat treatment. TaGRF2-A Distribution of H2O2 in the leaves of wheat with overexpressed genes. Figure 4 It was observed that after high-temperature treatment, wheat Fielder plants exhibited significantly deeper color intensity after NBT and DAB staining; in contrast, overexpression... TaGRF2-AThe staining results of wheat plants with the gene were weaker compared to plants treated with high temperatures. This suggests that... TaGRF Plants that overexpress the gene have less accumulation of hydrogen peroxide and superoxide anions.

[0058] 3. ​ Evaluation of physiological parameters in wheat with gene overexpression Photosynthetic characteristics were measured using a LI-6800 portable photosynthesis measurement system (LI-COR, USA). After 2 days of high-temperature stress, photosynthetic parameters of the leaves with the highest functional capacity were measured and analyzed. These included: net CO2 assimilation rate (A), leaf transpiration rate (E), stomatal conductance (gs), intercellular CO2 concentration (Ci), vapor pressure deficit (VPD), and intrinsic water-use efficiency (iWUE). The ratio between A and gs was used to calculate iWUE. Measurements were performed in an artificial climate chamber with the following conditions: 1500 µmol·m⁻²·s⁻¹ light, 45% relative humidity, and 400 ppm CO2 concentration.

[0059] After heat treatment, wheat Fielder and ​ The photosynthetic parameters of gene overexpression are as follows: ​ As shown. In overexpression materials, overexpression ​ The gene significantly reduced the CO2 assimilation rate after heat treatment. ​ ), transpiration rate ( ​ ) and porosity ( ​ ), intercellular carbon dioxide concentration ( ​ The decrease indicates that ​ Genes may be involved in regulating stomatal opening and closing or water transport processes in plants, and are related to photosynthesis or energy metabolism, thereby improving the heat tolerance of plants; overexpression ​ The gene significantly increased the vapor pressure difference after heat treatment. ​ ) and water use efficiency ( ​ ),show ​ Genes are involved in regulating the process of water absorption or retention in wheat, thereby improving the plant's heat resistance.

[0060] Example 6 Transcriptome Analysis ​ Tolerance mechanism of wheat under high temperature stress during the grain-filling stage by gene overexpression Heat treatment (36℃ / 25℃, 16h / 8h) for 0 days and 5 days respectively ​ Wheat leaves with overexpressing genes were sampled, and samples of leaves with the highest functional content were collected and immediately flash-frozen in liquid nitrogen. They were then stored at -80°C, and total RNA was extracted from the plants and sent to a sequencing company for transcriptome sequencing analysis.

[0061] ​ Demonstrating the effects of high-temperature treatment on wheat Fielder and ​ Transcriptional characteristics of gene overexpression. After high-temperature stress during the wheat grain-filling stage, compared to the control group (Fielder), overexpressing plants exhibited a significantly more tolerant phenotype, which may be related to transcriptional levels. Compared to F_CK_vs_F_H, GRF-2A_CK_vs_GRF-2A_H had 8800 differentially expressed genes (…). ​ The predicted protein interaction map also includes... ​ homologous genes ​ ( ​ This suggests that they may form homodimers, responding together to high temperatures ( ​ ). F_H_vs_GRF-2A_H's GO ( ​ ) and KEGG ( ​ Analysis showed that the differentially expressed genes were mainly concentrated in photosynthesis, oxidoreductase activity, plant hormone signal transduction, phenylalanine metabolism, and the MAPK signaling pathway. Therefore, it can be inferred that... ​ Under high temperature stress, specific physiological and transcriptional changes may occur in response to stomatal movement.

[0062] Example 7 ​ Effects of gene overexpression on key agronomic traits of wheat The aforementioned favorable molecular regulatory network ultimately manifests in the superior agronomic traits of transgenic plants. Compared to the control group (Fielder), the overexpressing plants exhibited a significantly higher number of tillers before and after high temperatures. ​ ) and plant height ( ​ There was no significant difference. However, after high temperature, compared with the control, the number of grains per ear in overexpressing plants ( ​ ), grain length ( ​ ),width( ​ ) and thousand-grain weight ( ​ The higher value indicates that under normal circumstances, this gene does not affect the yield trait, but it can significantly increase yield under high temperature conditions.

Claims

1. TaGRF2-A The application of genes in enhancing wheat heat resistance and / or improving wheat varieties is characterized by, Overexpression TaGRF2-A Genes, the ones mentioned TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO:

1.

2. Contains TaGRF2-A The application of recombinant gene vectors in enhancing wheat heat resistance and / or wheat variety improvement is characterized by, Overexpression TaGRF2-A Genes, the ones mentioned TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO:

1.

3. The application according to claim 2, characterized in that, The original vector for the recombinant vector includes the pLGY vector.

4. The application of genetically engineered bacteria in enhancing wheat heat resistance and / or improving wheat varieties, characterized in that, The genetically engineered bacteria contain TaGRF2-A Recombinant vectors of genes, overexpressing the aforementioned TaGRF2-A Genes, the ones mentioned TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO:

1.

5. A method for improving wheat heat resistance and / or for genetic breeding to improve wheat varieties, characterized in that, The method includes: overexpressing wheat TaGRF2-A Genes, the wheat TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO:

1.

6. A method for obtaining wheat plants with improved varietal traits, characterized in that, It includes the following processing steps: (1) Infecting wheat embryos with genetically engineered bacteria; and (2) The infected wheat embryos were cultured into wheat plants; The genetically engineered bacteria contain TaGRF2-A Recombinant vectors of genes, overexpressing the aforementioned TaGRF2-A Genes, the ones mentioned TaGRF2-A The nucleotide sequence of the gene coding region is shown in SEQ ID NO: 1.

Images