Rice metal ion transport regulation gene OsZIP14 and application of protein coded by rice metal ion transport regulation gene OsZIP14

Abstract

The invention discloses a rice metal ion transport regulation gene OsZIP14 and application of a protein coded by the rice metal ion transport regulation gene OsZIP14. The gene (the nucleotide sequence is shown as Seq ID No: 1) is used for regulating and controlling the content of metal cadmium and / or zinc in rice grains; the content of metal cadmium in rice grains or the content of cadmium and zinc in the rice grains can be reduced through gene overexpression; or the content of metal zinc in the rice grains or the content of metal zinc and cadmium in the rice grains is increased through gene function inactivation; the protein (the amino acid sequence is shown as Seq ID No: 2) is used for regulating and controlling the content of cadmium and / or zinc in rice grains. Through functional analysis of the OsZIP14 gene, a genetic mechanism for regulating and controlling the cadmium and zinc contents of rice grains is further clarified, and a foundation is laid for improving the nutrition, safety and quality of rice and cultivating low-cadmium or high-zinc rice varieties.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and in particular to the application of a rice metal ion transport regulatory gene OsZIP14 and its encoded protein. Background Technology

[0002] Rice, one of my country's three major grain crops, is the staple food of half the world's population. In recent years, due to mining, overuse of chemical fertilizers, and industrial activities, pollution of agricultural soils, including cadmium (Cd), has become increasingly prominent. Because rice has a strong ability to absorb and transport heavy metals from the soil, rice has become a major source of cadmium and other heavy metals for humans. Therefore, controlling cadmium accumulation in rice is of great significance for ensuring rice quality and safety and protecting consumer health. On the other hand, zinc (Zn) is an essential trace element for the human body, and increasing the Zn content in rice can help address the problem of "hidden hunger."

[0003] One of the most effective strategies to address these issues is to breed rice varieties with low cadmium or high zinc levels. Therefore, cloning genes that regulate metal ion transport will contribute to further improvements in the nutritional safety and quality of rice. Summary of the Invention

[0004] The purpose of this invention is to provide an application of genes and proteins that can affect the changes in the content of heavy metals cadmium and zinc in rice grains.

[0005] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides an application of the rice metal ion transport regulatory gene OsZIP14, which is used to regulate the content of cadmium and / or zinc in rice grains, and the nucleotide sequence of the gene is shown in Seq ID No: 1.

[0007] Furthermore, gene overexpression can be used to reduce the cadmium content or the cadmium and zinc content in rice grains.

[0008] Furthermore, the zinc content or the zinc and cadmium content in rice grains was increased by gene inactivation, and the cadmium content in the rice grains after the increase was less than 0.2 mg / kg.

[0009] Furthermore, the OsZIP14 gene is overexpressed via transgenic methods to reduce the cadmium content or the cadmium and zinc content in rice grains; the transgenic method includes: transforming rice cells with the gene, or a plasmid containing the gene, or a plant expression vector containing the gene, or a host cell containing the gene, and then cultivating the transformed rice cells into plants;

[0010] Furthermore, by using CRISPR / Cas9 gene editing technology to inactivate the OsZIP14 gene, the content of zinc or cadmium in rice grains was increased, and the cadmium content in the rice grains after the increase was less than 0.2 mg / kg.

[0011] Secondly, the present invention also provides a transgenic rice whose genome contains an exogenous rice metal ion transport regulatory gene OsZIP14, and the cadmium content in the grains of the transgenic rice is reduced or the cadmium and zinc content in the rice grains is reduced.

[0012] The nucleotide sequence of the rice metal ion transport regulatory gene OsZIP14 is shown in Seq ID No: 1.

[0013] Thirdly, the present invention also provides a gene-edited rice in which the endogenous rice metal ion transport regulatory gene OsZIP14 is inactivated, and the content of zinc in the grains of the gene-edited rice is increased or the content of zinc and cadmium in the rice grains is increased, and the content of cadmium in the rice grains after the increase is less than 0.2 mg / kg.

[0014] The nucleotide sequence of the rice metal ion transport regulatory gene OsZIP14 is shown in Seq ID No: 1.

[0015] Fourthly, the present invention also provides a biomaterial, wherein the biomaterial is a plasmid containing the rice metal ion transport regulation gene OsZIP14, a plant expression vector, a host cell, or a rice cell.

[0016] The nucleotide sequence of the rice metal ion transport regulatory gene OsZIP14 is shown in Seq ID No: 1.

[0017] Fifthly, the present invention also provides an application of a protein encoded by the rice metal ion transport regulatory gene OsZIP14, the protein being used to regulate the content of cadmium and / or zinc in rice grains, the amino acid sequence of the protein being shown in Seq ID No: 2.

[0018] Furthermore, by increasing the protein content, the cadmium content in rice grains can be reduced, or the cadmium and zinc content in rice grains can be reduced.

[0019] Furthermore, the zinc content or the zinc and cadmium content in rice grains is increased by inactivating the protein, and the cadmium content in the increased rice grains is less than 0.2 mg / kg.

[0020] This invention utilizes CRISPR / Cas9 gene editing technology to perform site-directed mutations in the OsZIP14 gene in the rice genome, generating an oszip14 mutant with increased cadmium and zinc content in rice grains. The OsZIP14 gene was cloned in rice, and its function was identified using transgenic experiments. Through functional interpretation of the OsZIP14 gene, the genetic mechanism regulating cadmium and zinc content in rice grains was further elucidated, laying the foundation for improving the nutritional safety and quality of rice and breeding low-cadmium or high-zinc rice varieties. Attached Figure Description

[0021] The above is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0022] Figure 1 The cadmium and zinc content (A) and other metal element content (B) of oszip14, a rice grain mutant material with high cadmium and zinc accumulation, and WYJ7, a wild-type material.

[0023] Figure 2 The plant phenotypes of oszip14, a rice grain mutant with high cadmium and zinc accumulation, and WYJ7, are compared; where bar = 20cm.

[0024] Figure 3 This is the spectrum of the BGK032-OsZIP14 vector;

[0025] Figure 4 This study identified the OsZIP14 genotype in the rice grain mutant oszip14, which has high cadmium and zinc accumulation. Detailed Implementation

[0026] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the biochemical reagents, carriers, consumables, etc. used in the embodiments are commercially available products.

[0027] This invention utilizes CRISPR / Cas9 gene editing technology to induce site-directed mutations in the OsZIP14 gene in rice, generating an abnormal cadmium-zinc transport mutant, oszip14. Subsequently, the OsZIP14 (ZRT and IRT-like protein 14) gene was cloned in rice, with its nucleotide sequence shown in Seq ID No. 1. This gene is a member of the rice OsZIP (ZRT, IRT-like Protein) family, and the amino acid sequence of its encoded protein is shown in Seq ID No. 2. It regulates the changes in the content of heavy metals cadmium and zinc in rice grains. Functional analysis of the OsZIP14 gene further clarifies the regulatory mechanisms of cadmium and zinc content in plant grains, particularly in grasses, laying the foundation for breeding low-cadmium or high-zinc rice varieties and improving the nutritional safety and quality of rice.

[0028] (1) Segregation and genetic analysis of the mutant oszip14:

[0029] The oszip14 rice cadmium-zinc transporter mutant of this invention was generated from the japonica rice variety Wuyunjing 7 through site-directed mutagenesis of the OsZIP14 gene in rice using CRISPR / Cas9 gene editing technology. Comparisons were made with wild-type cadmium and zinc content in grains and plant phenotypes, such as... Figure 1 and Figure 2 As shown.

[0030] (2) Cloning and functional identification of the OsZIP14 gene:

[0031] 1) Construction of the OsZIP14 gene CRISPR / Cas9 vector:

[0032] Based on the principles of CRISPR / Cas9 gene editing technology and the OsZIP14 gene cDNA sequence, the specific gRNA target sequence of the OsZIP14 gene was obtained through database and tool website analysis. This target sequence was then subcloned into the CRISPR / Cas9 gene editing vector BGK032, resulting in the BGK032-OsZIP14 gene editing vector. Figure 3 Then, the BGK032-OsZIP14 plasmid was transferred into the callus tissue of rice variety WYJ7 using transgenic technology to obtain transgenic progeny plants.

[0033] 2) Genotyping of OsZIP14:

[0034] Phenotypic observation was performed on the obtained transgenic T1 generation plants throughout their entire growth period. Specific primer amplification and sequencing were performed on the genomic regions near the gRNA target sequence in all T1 generation plants to identify mutations in the target sequence and its vicinity. Genotypic comparison and phenotypic analysis yielded the genotype of OsZIP14 in the oszip14 mutant. Figure 4 ).

[0035] 3) OsZIP14 gene functional analysis:

[0036] Through transgenic technology and further observation of its field phenotype, the results showed that the present invention obtained a mutant oszip14 with significantly higher cadmium and zinc content in the grain than the wild type. Figure 1 ).

[0037] The following is a detailed description through specific embodiments:

[0038] Example 1. Isolation of the rice oszip14 mutant

[0039] (1) Construction of the rice BGK032-OsZIP14 plant expression vector:

[0040] Based on the principles of CRISPR / Cas9 gene editing technology and the specific cDNA sequence of the OsZIP14 gene, the specific gRNA target sequence of the OsZIP14 gene was obtained through database and tool website analysis. Primers were then designed to subclone this target sequence into the CRISPR / Cas9 gene editing vector BGK032, resulting in the BGK032-OsZIP14 gene editing vector. Figure 3 The primers for the gRNA target sequence are as follows:

[0041] OsZIP14-CRISPR-1 Sense:5'- TGTGTG CCAGGCCGAGTTATCACCCT-3'

[0042] OsZIP14-CRISPR-1 Anti: 5'- AAAC AGGGTGATAACTCGGCCTGG CA -3'

[0043] (2) Transform rice with the BGK032-OsZIP14 plant expression vector.

[0044] A method for transforming mature rice embryo callus using Agrobacterium-mediated inoculation was employed. The plant expression vector BGK032-OsZIP14 was transferred into mature rice embryos. The transformation method is as follows: ① Induction of mature rice embryo callus: Mature wild-type Wuyunjing 7 seeds were dehulled, then surface-sterilized with 70-75% alcohol for 1 min, followed by soaking in 30% NaClO solution for 15 min, repeated twice. The seeds were then washed 4-5 times with sterile water. The seeds were then cultured on induction medium at 26-28℃ in the dark to induce callus formation for transformation. ② Co-culture of rice callus with Agrobacterium: The EHA105 strain containing the BGK032-OsZIP14 expression vector identified in step 3 was activated, enriched, and resuspended, with OD600 adjusted to 0.4-0.6. The callus was collected in 50 ml sterile centrifuge tubes, and the resuspended Agrobacterium suspension was added to inoculate the callus. After soaking for 15-30 minutes, discard the suspension and place the infected callus on sterile filter paper to absorb excess Agrobacterium tumefaciens solution. Then place the callus in a petri dish lined with sterile filter paper and incubate at 26°C in the dark for 2-3 days. ③ Screening of resistant callus: After co-culture, transfer the callus to a selection medium containing 50 mg / ml hygromycin and screen for resistance at 26-28°C. ④ Differentiation of resistant callus: Place the callus with good growth in the selection medium into a differentiation medium and culture it under 16 hours of light / 8 hours of darkness at an ambient temperature between 26-28°C until seedlings emerge. ⑤ Rooting of differentiated seedlings: When the differentiated seedlings are about 2-5 cm long, transfer them to a rooting medium for rooting culture. Transplant the rooted seedlings to a greenhouse or transgenic nursery for growth. Observe the phenotype of the obtained transgenic progeny T1 plants throughout their entire growth period. Figure 1 Individual plants with the mutant phenotype were harvested and propagated individually. After multiple generations of planting, phenotype-stable lines were used for genotyping of offspring.

[0045] Example 2. Genotyping of rice oszip14 mutant

[0046] (1) Identification of the OsZIP14 genotype in the rice oszip14 mutant:

[0047] Phenotypic observation and recording were performed on phenotypic stable transgenic mutant lines throughout their entire growth period. Simultaneously, specific primers were used to amplify and sequence the genomic regions near the gRNA target sequence to identify mutations in the target sequence and its surrounding regions. PCR was used to amplify and sequence the genomic regions near the gRNA target sequence from both mutant lines and the wild-type cultivar Nipponbare. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 minutes; 98℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 68℃ extension for 45 seconds, 38 cycles; and a final extension at 68℃ for 5 minutes. PCR products were separated by 5% agarose gel electrophoresis and stained with ethidium bromide. The target band fragments were then sent to Qingke for sequencing. Primer sequences are as follows:

[0048] OsZIP14-T1F: 5'-ACAAGCCCCACGATGATCAC-3'

[0049] OsZIP14-T1R: 5'- GGGGGACACTCACAGAAGAT -3'

[0050] Through sequencing analysis, we obtained the genotype of OsZIP14 in the OsZIP14 mutant, as follows: Figure 4 As shown, there are two genotypes. The first genotype has an insertion of an A base in the first exon region of the OsZIP14 gene, and the second genotype has an 8-base deletion in the first exon region. Both result in premature termination of the amino acid encoded by OsZIP14. The sequencing process was repeated twice, and the same results were obtained.

[0051] Example 3. Phenotypic identification of the rice grain oszip14 mutant with high cadmium and zinc accumulation.

[0052] After the rice grains in the field were fully mature, three seed samples were taken from the wild type and each homozygous transgenic line, and the sample numbers were marked. After thorough drying, the rice husks were removed, and the brown rice was ground into rice flour. The brown rice flour was then digested with HNO3 (60%) at 120°C. Finally, the digestion solution was diluted, and the concentration of metal ions in the digestion solution was determined by atomic absorption spectrometry and inductively coupled plasma mass spectrometry (ICP-MS7900, Agilent Technologies).

[0053] The measurement results are as follows Figure 1 As shown, Figure 1 The cadmium and zinc contents (A) and other metal element contents (B) of oszip14, a rice mutant material with high cadmium and zinc accumulation in rice grains, and the wild-type material WYJ7 were determined by... Figure 1It was found that, compared to the wild type (WT), the homozygous transgenic lines (oszip14 mutants: oszip14-1, oszip14-2) showed significantly higher cadmium and zinc content in rice grains. It is important to note that even though the cadmium content in the mutant materials was higher than that in the wild type, the overall content was still less than 0.1 mg / kg, which meets the Chinese national food safety standard of cadmium content being less than or equal to 0.2 mg / kg. In practical applications, the zinc content or the combined zinc and cadmium content in rice grains can be increased through gene inactivation. Furthermore, in conventional paddy fields or farmland where cadmium levels are within acceptable limits, the increased cadmium content in the rice grains is less than 0.2 mg / kg.

[0054] Example 4. Construction of pCambia1390-OsZIP14 plant expression vector

[0055] Based on the complete genome sequence of the rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided in NCBI, specific primers for amplifying the full-length OsZIP14 gene sequence were designed. Specific restriction enzyme sites were added to both ends of the primers according to the selected pCambia1390 expression vector and the characteristics of the full-length OsZIP14 gene sequence. Specifically, the primers were designed as follows: the forward primer (P1F) with a KpnI restriction site (GGTACC) added to the 5' end, and the reverse primer (P1R) with a SpeI restriction site (ACTAGT) added to the 5' end. The primer sequences are as follows:

[0056] OsZIP14-C1F forward primer: 5'-TTACTTCTGCACTAGGTACC ATGCGCGGGGGCCTCCTCGT-3'

[0057] OsZIP14-C1R reverse primer: 5'-TAGCGTTAACACTAGT TCATTCTACTAGAGATATGC-3'

[0058] Then, using Nipponbare genomic DNA as a template, the OsZIP14 candidate gene cds sequence, totaling 1497 bp, was amplified using the primers (C1F and C1R) designed above. The amplification program was as follows: 94℃ pre-denaturation for 4 minutes; 98℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 68℃ extension for 12 minutes, for 40 cycles; and a final extension at 68℃ for 10 minutes. The target fragment amplified by PCR was recovered, ligated into the ZERO BLUNT TOPO vector (Invitrogen), transformed into E. coli DH5α competent cells, and positive clones were screened by colony PCR and sent to Tsingke for sequencing. The OsZIP14 overexpression vector pCambia1390-OsZIP14 was obtained and transformed into Agrobacterium tumefaciens EHA105 using electroporation.

[0059] Example 4. Transforming rice with the pCambia1390-OsZIP14 plant expression vector.

[0060] The Agrobacterium-mediated transformation of mature rice embryo callus was adopted. The recombinant expression vector pCambia1390-OsZIP14 was transferred into mature rice embryos. The transformation method is as follows: (1) Induction of mature rice embryo callus: Mature wild-type Wuyunjing 7 seeds were dehulled, then surface-sterilized with 70-75% alcohol for 1-2 min, then soaked in 30% NaClO solution for 15 min, and repeated twice. Then, the seeds were washed 4-5 times with sterile water. The seeds were then placed on induction medium and cultured at 26-28 degrees Celsius in the dark to induce callus for transformation. (2) Co-culture of rice callus and Agrobacterium: The EHA105 strain containing the pCambia1390-OsZIP14 expression vector identified in step 3 was activated, enriched, and resuspended, and the OD600 was adjusted to 0.5-0.6. The callus was collected in 50 ml sterile centrifuge tubes, and the resuspended Agrobacterium suspension was poured in to infect the callus. After soaking for 15-30 minutes, discard the suspension and place the infected callus on sterile filter paper to absorb excess Agrobacterium tumefaciens solution. Then place the callus in a petri dish lined with sterile filter paper and incubate at 26 degrees Celsius in the dark for 2-3 days. (3) Screening of resistant callus: After co-culture, transfer the callus to a screening medium containing 50-100 mg / ml of hygromycin antibiotic and screen for resistance at 26-28 degrees Celsius. (4) Differentiation of resistant callus: Place the callus with good growth in the screening medium into a differentiation medium and culture it under 16 hours of light / 8 hours of darkness at an ambient temperature between 26-28 degrees Celsius until seedlings emerge. (5) Rooting of differentiated seedlings: When the differentiated seedlings are about 2-5 cm long, transfer them to a rooting medium for rooting culture. Transplant the rooted seedlings to a greenhouse or transgenic nursery for growth, then to an artificial climate chamber, and after homozygosity, transplant them to Hainan.

[0061] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, equivalent changes, or alterations made by those skilled in the art using the disclosed technical content shall fall within the protection scope of the present invention.

Claims

1. Application of a rice metal ion transport regulatory gene OsZIP14, characterized in that, The gene is used for regulating the content of metal cadmium and / or zinc in rice grains, and the nucleotide sequence of the gene is shown in Seq ID No:

1. 2.The application of rice metal ion transport regulation gene OsZIP14 according to claim 1, characterized in that, The content of metal cadmium in rice grains is reduced or the contents of cadmium and zinc in rice grains are reduced by gene overexpression. Or the content of metal zinc in rice grains is increased or the contents of metal zinc and cadmium in rice grains are increased by gene inactivation, and the content of metal cadmium in the increased rice grains is less than 0.2 mg / kg. 3.The application of rice metal ion transport regulation gene OsZIP14 according to claim 1, characterized in that, The content of metal cadmium in rice grains is reduced or the contents of cadmium and zinc in rice grains are reduced by overexpression of the OsZIP14 gene through transgenic methods, which include transforming rice cells with the gene, a plasmid containing the gene, a plant expression vector containing the gene, or a host cell containing the gene, and then cultivating the transformed rice cells into plants. Or the content of metal zinc in rice grains is increased or the contents of metal zinc and cadmium in rice grains are increased by inactivation of the OsZIP14 gene through CRISPR / Cas9 gene editing technology, and the content of metal cadmium in the increased rice grains is less than 0.2 mg / kg.

4. A transgenic rice plant, characterized by, The genome of the transgenic rice contains the exogenous rice metal ion transport regulation gene OsZIP14, and the content of metal cadmium in the grains of the transgenic rice is reduced or the contents of cadmium and zinc in the grains of the transgenic rice are reduced. The nucleotide sequence of the rice metal ion transport regulation gene OsZIP14 is shown in Seq ID No:

1.

5. A genetically edited rice plant, characterized in that, The endogenous rice metal ion transport regulation gene OsZIP14 of the gene-edited rice is inactivated, the content of metal zinc in the grains of the gene-edited rice is increased or the contents of metal zinc and cadmium in the grains of the gene-edited rice are increased, and the content of metal cadmium in the increased rice grains is less than 0.2 mg / kg. The nucleotide sequence of the rice metal ion transport regulation gene OsZIP14 is shown in Seq ID No:

1.

6. A biomaterial, characterized by, The biomaterials are plasmids, plant expression vectors, host cells, or rice cells containing the rice metal ion transport regulation gene OsZIP14. The nucleotide sequence of the rice metal ion transport regulation gene OsZIP14 is shown in Seq ID No:

1.

7. Use of a protein encoded by a rice metal ion transport regulatory gene OsZIP14, characterized in that, The protein is used for regulating the content of metal cadmium and / or zinc in rice grains, and the amino acid sequence of the protein is shown in Seq ID No:

2. 8.The protein encoded by the rice metal ion transport regulation gene OsZIP14 according to claim 7, characterized in that, The content of metal cadmium in rice grains is reduced or the contents of cadmium and zinc in rice grains are reduced by increasing the content of the protein. Or the content of metal zinc in rice grains is increased or the contents of metal zinc and cadmium in rice grains are increased by inactivating the protein, and the content of metal cadmium in the increased rice grains is less than 0.2 mg / kg.

Images