Application of KASP molecular marker in preparation of preparation for identifying soybean cyst nematode disease

Abstract

The invention discloses application of a KASP molecular marker in preparation of a preparation for identifying soybean cyst nematode disease, and belongs to the technical field of molecular assisted breeding. According to the application of the KASP molecular marker in preparing the preparation for identifying the soybean cyst nematode disease, the KASP molecular marker is located at the 32969916bp position of the 11th chromosome of a soybean reference genome, and the basic group is C / A. The molecular marker is closely linked with soybean cyst nematode disease, and can be used for preliminary screening of soybean cyst nematode disease resistance, so that molecular marker-assisted breeding is achieved, and the breeding process is accelerated. In production, the molecular marker can be used for detecting and screening soybean cyst nematode resistant plants in the seedling stage, the screened germplasm carrying excellent disease-resistant alleles provides a basis for further phenotype identification and rapid screening and utilization of resistant sources, and the yield per unit area of soybeans is increased.

Description

Technical Field

[0001] This invention relates to the field of molecular-assisted breeding technology, and more specifically to the application of KASP molecular markers in the preparation of agents for identifying soybean cyst nematode disease. Background Technology

[0002] Soybean growth is frequently affected by pests and diseases, which are significant factors influencing high and stable soybean yields. Soybean cyst nematode is a soil-borne, sedentary endoparasitic nematode that is both epidemic and devastating. Soybean cyst nematode disease is one of the most damaging diseases currently existing in the world affecting soybean breeding and production.

[0003] Traditional soybean breeding is time-consuming, inefficient, and costly. Molecular markers, on the other hand, reflect the differences in genomic DNA fragments of individual organisms, directly reflecting the essence of germplasm resources. They have advantages such as high efficiency, accuracy, and economy, and can significantly shorten the breeding cycle, making them a powerful supplement to traditional breeding techniques.

[0004] Therefore, developing molecular markers related to resistance to soybean cyst nematode disease to assist in high-yield soybean breeding is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides the application of KASP molecular markers in the preparation of agents for identifying soybean cyst nematode disease.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: Application of KASP molecular markers in the preparation of agents for identifying soybean cyst nematode disease The KASP molecule is labeled GmSNAP11-b; The GmSNAP11-b is located at 32969916 bp on chromosome 11 of the soybean reference genome, and its bases are C / A. The soybean reference genome is Wm82.a2.v1.

[0007] Furthermore, the primer set for detecting the KASP molecular marker was described in SEQ ID NO.3-SEQ ID NO.5. The KASP molecule is labeled GmSNAP11-b; The GmSNAP11-b is located at 32969916 bp on chromosome 11 of the soybean reference genome, and its bases are C / A. The soybean reference genome is Wm82.a2.v1.

[0008] Furthermore, a detection kit includes the aforementioned primer set.

[0009] Furthermore, the application of the primer set or the detection kit in the preparation of agents for identifying soybean cyst nematode disease.

[0010] Furthermore, a method for identifying soybean cyst nematode disease involves amplifying and genotyping the genomic DNA of the soybean to be tested using the primer set or the detection kit described above. When the genotype is homozygous AA, the soybean is a resistant material; when the genotype is homozygous CC, the soybean is a susceptible material.

[0011] Furthermore, the application of the primer set or the detection kit in soybean molecular-assisted breeding.

[0012] Furthermore, a soybean molecular-assisted breeding method utilizes the primer set or the detection kit to amplify and genotype the genomic DNA of the soybean to be tested, retaining materials with homozygous AA genotype.

[0013] As can be seen from the above technical solutions, compared with the prior art, this invention discloses the application of KASP molecular markers in the preparation and identification of soybean cyst nematode disease agents, based on disease resistance genes. GmSNAP11 A set of KASP molecular markers and their detection primers were developed for the SNP site. These molecular markers are closely linked to soybean cyst nematode disease and can be used for preliminary screening of soybean cyst nematode-resistant varieties, thus achieving marker-assisted breeding and accelerating the breeding process. In production, these molecular markers can also be used to detect them at the seedling stage to screen for plants resistant to soybean cyst nematode disease. The germplasm carrying superior resistance alleles provides a basis for further phenotypic identification, rapid screening of resistance sources, and utilization. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0015] Figure 1 The results of KASP molecular marker genotyping of soybean germplasm resources in Example 2 are shown; NoAmplification is the negative control (template is ddH2O); red dots: allele 1 is CC; blue dots: allele 2 is AA. Detailed Implementation

[0016] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] Example 1: Development of KASP molecular markers for soybean cyst nematode disease Based on the gene against cyst nematode disease GmSNAP11 SNP sites were extracted and analyzed within the chromosome 11 region, and molecular markers were developed using KASP technology for fine localization.

[0018] Specifically as follows: Based on the selected SNP loci and their flanking gene sequences, PCR amplification primers were designed using Primer Premier 6 software, with a Tm value between 55 and 65°C. Two SNP-specific primers and one universal primer were designed for each SNP locus. The forward primers F-HEX and F-FAM each had their own fluorescent adapters (displayed as different colors on the genotyping map, e.g., red for CC genotype, blue for AA genotype, and green for CA genotype). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference results can distinguish whether the tested material is homozygous AA or CC genotype. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus enabling the differentiation of heterozygous genotypes.

[0019] This invention, through screening molecular markers, ultimately obtained the KASP molecular marker GmSNAP11-b, which is closely linked to soybean cyst nematode disease. The KASP molecular marker is located at 32969916 bp on chromosome 11 of the soybean reference genome Wm82.a2.v1. This molecular marker is an SNP mutation marker, with genotypes C and A. The first 50 bp sequence of this molecular marker site is shown in SEQ ID NO.1, and the last 50 bp sequence is shown in SEQ ID NO.2, as follows: TTTACTTGGAAATAAAAAAAATAATAACGAAATACCAAAACTAGTGACCTA; SEQ ID NO.1.

[0020] CGCCAAAAATCTATATTCACGTGTTCCCGAAAATGTTGGATCCAGTTCCT; SEQ ID NO. 2.

[0021] The sequence of the molecular marker primer combination is as follows: Forward primer (F-HEX): GAAGGTCGGAGTCAACGGATT AACGAAATACCAAAACTAGTGACCTAA; SEQ ID NO. 3.

[0022] Forward primer (F-FAM): GAAGGTGACCAAGTTCATGCT ACGAAATACCAAAACTAGTGACCTAC; SEQ ID NO.4.

[0023] Reverse primer (R): CAACATTTTCRGGAACACGTGA; SEQ ID NO.5.

[0024] Example 2: Validation of KASP molecular markers for soybean resistance to cyst nematode disease The materials used in this verification experiment are the natural population materials shown in Table 1.

[0025] Specifically as follows: DNA extraction: Genomic DNA was extracted from soybean materials using the CTAB method.

[0026] PCR amplification: The PCR reaction system consisted of 5.0 μl of 30-50 ng / μl soybean genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (primer concentrations were all 10 ng / μl and met the molar ratio of F-HEX:F-FAM:R = 2:2:5), for a total volume of 10.14 μl.

[0027] The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 31-35 cycles. 30℃, 1 minute (read fluorescence signal).

[0028] PCR amplification was performed on an ABI Step One PCR instrument. After amplification, fluorescence signals were detected and genotyping results were analyzed. If genotyping was incomplete, amplification could be continued, with fluorescence signals read every three cycles to check genotyping progress, until complete genotyping was achieved. Results are shown below. Figure 1 See Table 1.

[0029] Blue represents soybeans with genotype AA, which should be disease-resistant materials; red represents soybeans with genotype CC, which should be disease-susceptible materials. The theoretical results are consistent with the phenotypic verification results. The GmSNAP11-b molecular marker can detect different genotypes in different materials in natural populations, further clarifying that this molecular marker can be used for molecular-assisted selection breeding to screen soybean cyst nematode disease materials.

[0030] Table 1

[0031] In summary, the molecular markers developed in this invention can be used to screen soybean varieties resistant to cyst nematode disease in the early stages, thereby achieving the purpose of molecular marker-assisted breeding.

[0032] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0033] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of KASP molecular marker in preparation of cyst nematode disease identification agent for soybean, characterized in that, the KASP molecular marker is GmSNAP11-b; the GmSNAP11-b is located at 32969916 bp of chromosome 11 of soybean reference genome, and the base is C / A; the soybean reference genome is Wm82.a2.v1.

2. A primer set for detecting a KASP molecular marker, characterized in that, the nucleotide sequence of the primer set is shown as SEQ ID NO. 3-SEQ ID NO. 5; the KASP molecular marker is GmSNAP11-b; the GmSNAP11-b is located at 32969916 bp of chromosome 11 of soybean reference genome, and the base is C / A; the soybean reference genome is Wm82.a2.v1.

3. A test kit, characterized by the primer set of claim 2.

4. Application of the primer set of claim 2 or the detection kit of claim 3 in preparation of cyst nematode disease identification agent for soybean.

5. A method of identifying soybean cyst nematode disease, comprising, The genomic DNA of the soybean to be tested is amplified and genotyped by using the primer set of claim 2 or the detection kit of claim 3, and when the genotype is homozygous AA, it is resistant material; when the genotype is homozygous CC, it is susceptible material.

6. Application of the primer set of claim 2 or the detection kit of claim 3 in molecular assisted breeding of soybean.

7. A soybean molecular assisted breeding method, characterized by, The genomic DNA of the soybean to be tested is amplified and genotyped by using the primer set of claim 2 or the detection kit of claim 3, and the material with genotype homozygous AA is reserved.

Images