SNP molecular marker, KASP primer, kit and method for detecting content character of panax notoginseng ginsenoside Rc
By developing SNP molecular markers and KASP primers related to the Rc content of ginsenosides in Panax notoginseng, the problems of low efficiency and accuracy in the breeding of Panax notoginseng varieties were solved, and early genotyping-assisted breeding was realized, which improved breeding efficiency and variety improvement effect.
Patent Information
- Application Number
- CN202511857415.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-02-17
AI Technical Summary
The genetic background of Panax notoginseng is a mixed population with rich genetic diversity and high heterozygosity of single genes, which leads to limited efficiency and accuracy in quality breeding. Traditional methods are difficult to achieve efficient breeding of Panax notoginseng varieties, especially the accurate identification and improvement of ginsenoside Rc content.
A SNP molecular marker, SNP-218351403, significantly associated with the content of ginsenoside Rc in Panax notoginseng was developed, and corresponding KASP primers were designed. Through PCR amplification and fluorescence signal detection, early genotyping and assisted breeding of ginsenoside Rc content in Panax notoginseng plants were achieved.
This technology enables accurate identification of plants with high ginsenoside Rc content in the early stages of breeding, improving breeding selection efficiency, saving time and resources, and supporting the improvement of Panax notoginseng varieties.
Smart Images
Figure CN121538341A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular genetics and breeding, and particularly relates to a SNP molecular marker for detecting the content of ginsenoside Rc in Panax notoginseng, a KASP primer, a kit and a method thereof. BACKGROUND
[0002] Panax notoginseng Panax notoginseng (Burk.) F.H.Chen belongs to the genus Panax of the family Araliaceae Panax Panax notoginseng (Burk.) F.H.Chen is a perennial herb, mainly produced in Wenshan, Yunnan Province, also known as Tianqi powder and Jinbuhuan, and is a kind of precious Chinese medicinal material. The root is used as medicine. Panax notoginseng is rich in saponins, polysaccharides, flavonoids and the like. Ginsenosides are the main active ingredients in Panax notoginseng, and the content and types of ginsenosides are one of the important indicators for evaluating the quality of Panax notoginseng. It has been found that the degradation of ginsenoside sugar chain or the change of C-17 side chain generates rare ginsenosides, which have high bioavailability and significant pharmacological activities, such as anti-tumor, liver protection and protection of nervous system. Rare ginsenoside Rc, as a secondary saponin in Panax notoginseng, has received extensive attention in recent years, and ginsenoside Rc has shown potential value in neuroprotection and metabolic regulation.
[0003] Although Panax notoginseng has been artificially cultivated for many years, its genetic background still shows a mixed population with rich genetic diversity. Panax notoginseng is a common xenogamy plant, with high degree of single gene heterozygosity, complex genetic basis, long growth period, and it is very difficult to breed pure line. Panax notoginseng variety breeding mainly relies on group mixed selection method, which is the main breeding technology to meet the demand. Quality breeding is the core of good seed selection, but the traditional method has limited efficiency and accuracy. With the emergence and application of high-throughput sequencing and genome-wide association study (GWAS), a new way has been opened up for the genetic improvement and variety breeding of Panax notoginseng. High-throughput sequencing technology can comprehensively analyze the genetic information of Panax notoginseng and reveal its genetic diversity, providing strong support for precision breeding.
[0004] With the continuous progress of omics technology, the use of molecular markers in the molecular genetic breeding of medicinal plants can significantly improve the breeding efficiency and make it possible to carry out molecular breeding for improving the effective components of medicinal plants. Single nucleotide polymorphism (SNP) refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level, including insertion and deletion of bases, transversion, and conversion, which is the most common type of heritable variation. As the third generation of molecular markers, SNP is widely used in molecular genetics, genome research, genetic breeding and many other fields. Compared with other molecular markers, SNP is widely distributed, genetically stable and easy to genotype, and is very suitable for rapid identification between species. The content and type of saponins in Panax notoginseng are the core target of Panax notoginseng variety breeding. Therefore, by using known saponin biosynthesis genes and rich Panax notoginseng germplasm resources, SNP associated with the content of ginsenosides in Panax notoginseng is mined, KASP molecular markers for assisted breeding are developed, and early molecular assisted selection of target traits is realized to improve the breeding efficiency and accelerate the breeding process of excellent varieties. SUMMARY
[0005] In view of the above problems, the purpose of the present application is to provide a SNP molecular marker, KASP primer, kit and method for detecting the content of Panax notoginseng ginsenoside Rc.
[0006] To achieve the above purpose, the technical scheme adopted by the present application is: A SNP molecular marker related to the content of Panax notoginseng ginsenoside Rc, the SNP molecular marker is SNP-218351403, located at position 218351403 of chromosome Chr1 of Panax notoginseng, and the allele thereof is G or A.
[0007] Further preferably, the Panax notoginseng plant with genotype GG at the SNP-218351403 site has a significantly higher content of ginsenoside Rc than the plants with genotype GA or AA.
[0008] The present application also provides a set of KASP primer pairs for detecting the SNP molecular marker, comprising: Upstream primer SNP-F: 5'-GAAGGTGACCAAGTTCATGCTCAAAGGCTAAAGACATTCAAATGTAATG-3'; Upstream primer SNP-H: 5'-GAAGGTCGGAGTCAACGGATTCAAAGGCTAAAGACATTCAAATGTAATAA-3'; Downstream primer SNP-R: 5'-GACCCATAGTACAAAGATAGACAATTACT-3'.
[0009] The present invention also provides a kit for assisted breeding of ginsenoside Rc content in Panax notoginseng, comprising the aforementioned KASP primer pair.
[0010] This invention also provides a method for KASP gene typing to detect the content of ginsenoside Rc in Panax notoginseng, characterized by comprising the following steps: S1. Obtain the genomic DNA of the Panax notoginseng plant to be tested; S2. Using the DNA as a template, perform PCR amplification using the KASP primer pair described in claim 3; S3. Detect the fluorescence signal of the amplification product to determine the genotype of the SNP-218351403 locus; S4. Based on the genotype, plants are screened, wherein plants with the genotype GG are screened as having the potential to have high levels of human parameter saponin Rc.
[0011] Further preferably, the PCR amplification program in step S2 includes: pre-denaturation at 95°C for 10 minutes; followed by 10 cycles of landing PCR: 95°C for 20 seconds per cycle, then 61°C to 55°C (decreasing by 0.6°C per cycle) for 45 seconds; then 40 cycles of conventional PCR: 95°C for 20 seconds per cycle, then 55°C for 40 seconds per cycle.
[0012] More preferably, the PCR reaction system in step S2 is 2 μL, comprising: 1 μL of 2× KASP Master Mix, 1 μL of template DNA, and the upstream primers F and H and the downstream primer R as described in claim 3.
[0013] More preferably, genomic DNA is extracted using the CTAB method in step S1.
[0014] More preferably, in step S3, fluorescence signals are read using a fluorescence scanner, and genotyping is performed based on signal clustering.
[0015] The present invention has the following beneficial effects: Firstly, the SNPs significantly associated with the ginsenoside Rc content in Panax notoginseng provided in this invention were obtained through association analysis of 209 natural Panax notoginseng populations. SNP loci were used as genotype data, and ginsenoside Rc content was used as phenotypic data. Genome-wide association analysis (GWAS) was performed using EMMAX software with a mixed linear model (MLM). The SNP molecular marker SNP-218351403, located at base 218351403 on chromosome 1, provides technical support for marker-assisted breeding of the ginsenoside Rc content trait in Panax notoginseng.
[0016] Secondly, the KASP primer combination developed in this invention can directly and specifically distinguish and detect the G or A bases at the mutation site of SNP-218351403. When using this KASP primer combination to identify the levels of ginsenoside Rc content, the two genotypes can be clearly separated. In the molecular marker SNP-218351403, the dot near the Y-axis indicates the AA allelic variant site, with the genotype being AA, and the ginsenoside Rc content of Panax notoginseng with this genotype being relatively low. The dot near the X-axis indicates the GG allelic variant site, with the genotype being GG, and the ginsenoside Rc content of Panax notoginseng with this genotype being relatively high. The KASP primer combination developed in this invention has good application value, enabling pre-selection and molecular-assisted breeding of the ginsenoside Rc content trait in Panax notoginseng. It can accurately identify Panax notoginseng plants with high ginsenoside Rc content in the early stages of breeding, thereby avoiding elimination when undesirable traits are discovered later, greatly saving time and resources. It has important theoretical and practical guiding significance for the genetic improvement process of breeding for ginsenoside Rc content in Panax notoginseng and improving the efficiency of breeding selection. Attached Figure Description
[0017] Figure 1 Manhattan and QQ-plots of GWAS results for ginsenoside Rc in Panax notoginseng; Figure 2 A statistical graph showing the allelic variation and phenotypic significance of ginsenoside Rc content in Panax notoginseng; Figure 3 Genotyping results of different Panax notoginseng samples using KASP-specific primers. Detailed Implementation
[0018] The following description, in conjunction with specific embodiments of the present invention, provides further details. It should be noted that these descriptions are intended to aid in understanding the invention but do not constitute a limitation thereof. Furthermore, the technical features described in the various embodiments of the invention below can be combined with each other as long as they do not conflict with each other.
[0019] Example 1 Nucleotide mutation sites (SNPs) related to the Rc content of ginsenosides in Panax notoginseng were obtained. (1) DNA extraction and high-throughput sequencing: We collected 209 Panax notoginseng natural population materials, extracted genomic DNA using the CTAB method, and performed 10X whole-genome resequencing.
[0020] (2) Determination of ginsenoside Rc content: After drying at 50℃, the sample was pulverized using a pulverizer and passed through a No. 4 sieve. 0.6 g of the sample was accurately weighed using an analytical balance and placed in a 50 ml Erlenmeyer flask. 50 ml of methanol was added, and the flask was weighed. The flask was sealed with sealing film, sonicated for 30 min, and then allowed to stand for 20 h. The sealing film was then removed, and the sample was weighed again. The weight lost due to evaporation was replenished with methanol, and the mixture was shaken well. The solution was filtered through a 0.22 μm microporous membrane to obtain 1 ml of the sample solution. The ginsenoside Rc was quantitatively analyzed using high-performance liquid chromatography (HPLC) with the external standard method. The chromatographic column was an Agilent ZORBAX SB-AQ (3.5µm, 4.6×150mm). The mobile phase consisted of ultrapure water (A) and acetonitrile (B), with the following gradient elution program: 0–20 min, 20%B; 20–55 min, 36%B; 55–60 min, 40%B; 60–70 min, 36–45%B; 70–79 min, 45–60%B; 79–80 min, 80%B; 80–81 min, 80%B; 81.5–83 min, 20%B. The flow rate was 0.5 mL / min, the column temperature was 30℃, and the injection volume was 10 µL. The detection wavelength was 203 nm. The compounds were identified based on their retention time, and quantification was performed using the external standard method, with peak area as the quantification basis.
[0021] (3) Genome-wide association analysis (GWAS) Using SNP loci as genotypic data and ginsenoside Rc content as phenotypic data, genome-wide association studies (GWAS) were performed using EMMAX software with a mixed linear model (MLM). The Manhattan diagram is shown below. Figure 1 Using -log10(P)>6 as the threshold, the X-axis of the Manhattan plot represents each SNP on all chromosomes, and the Y-axis represents the P-value of each SNP. Different colors represent the 12 chromosomes of Panax notoginseng. SNPs above the horizontal line were selected as candidate significant SNP sites. Among them, the molecular marker SNP-218351403, which is significantly associated with ginsenoside Rc, is located at base 218351403 on chromosome 1. By comparing with the Panax notoginseng reference genome, the sequence allelic variation of SNPs was extracted, and combined with the ginsenoside Rc content of the population material for joint analysis, SNP-218351403 has three genotypes: GG, AA, and GA. After t-test, it was found that the ginsenoside Rc content was higher in the GG genotype, which is the dominant genotype. Figure 2 ).
[0022] The gene sequence containing 100 bp before and after the SNP-218351403 site is shown in SEQ ID NO.1: ttataataatataaatcaacaatttgtccttgccacaaagttttaatagaactttcactcaatatctttggcccaaaggctaaagacattcaaatgtaat[g / a]acaatgatcatactaagtaattgtctatctttgtactatgggtcaaagatattcaactataacatcaatggt(SEQ ID NO: 1) Example 2 Development of SNP-labeled KASP-specific primers Using NCBI Primer The BLAST function was used to design three primers based on the sequence SEQ ID NO.1: upstream primer SNP-F, upstream primer SNP-H, and downstream primer SNP-R. SNP-F and SNP-H contain FAM and HEX fluorescent linker sequences (underlined), respectively, as shown below: SNP-F: 5'- GAAGGTGACCAAGTTCATGCT CAAAGGCTAAAGACATTCAAATGTAATG-3'; SNP-H: 5'- GAAGGTCGGAGTCAACGGATT CAAAGGCTAAAGACATTCAAATGTAATAA-3'; SNP-R: 5'-GACCCATAGTACAAAGATAGACAATTACT-3'.
[0023] Example 3 Genotyping of SNP loci in different Panax notoginseng samples and its application The authenticity of SNP-1218351403 in the natural population of Panax notoginseng was verified using the high-throughput genotyping system GeneMatrix (GM). Genomic DNA was extracted from 94 randomly selected Panax notoginseng single plants. Using the genomic DNA as a template, PCR amplification was performed using the SNP marker KASP-specific primers developed in Example 2.
[0024] After diluting the sample DNA 5 times, transfer it to a 100 μL PCR plate, and add 2 positive controls and 2 NTCs to each plate.
[0025] The KASP reaction system consisted of 2 μL, including 1 μL of 2×Master Mix, 1 μL of 20 ng / μL sample DNA, and 0.01 μL of KASP primer mixture, comprising 0.002 μL of upstream primer 1 (100 μM), 0.002 μL of upstream primer 2 (100 μM), and 0.006 μL of universal primer (100 μM). An equal volume of double-distilled water was used instead of sample DNA in the negative control reaction. The DNA sample plate, primer mixture, and KASPmaster Mix were placed in the corresponding positions on the Arrayer. The 384*1 pipetting protocol was selected, and the DNA and primer mixture were added to the 384-well microplate via the MatrixArrayer. The device automatically constructed the reaction system and heat-sealed the reaction plate.
[0026] The PCR amplification program requires four stages: Stage 1 denaturation at 95°C for 10 min; Stage 2 denaturation at 95°C for 20 s followed by annealing at 61°C for 45 s, for a total of 10 cycles (each cycle decreasing by 0.6°C); Stage 3 denaturation at 95°C for 20 s followed by annealing at 55°C for 40 s, for a total of 40 cycles.
[0027] After PCR amplification, remove the reaction plate and allow it to cool to room temperature. If there is water on the surface, wipe it clean. Place the plate in a scanner for fluorescence scanning. Use a Matrix Scanner to read the fluorescence signal values and perform genotyping and clustering of the samples. In the molecular marker SNP-218351403, samples showing blue near the Y-axis are alleles linked to the HEX fluorescent tag sequence, i.e., carrying the AA allelic variant site, with genotype AA. The ginsenoside Rc content of this genotype of Panax notoginseng is relatively low. Samples showing red near the X-axis are alleles linked to the FAM fluorescent tag sequence, i.e., carrying the GG allelic variant site, with genotype GG. The ginsenoside Rc content of this genotype of Panax notoginseng is relatively high. Figure 3 ).
[0028] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.
Claims
1. A SNP molecular marker related to the content of ginsenoside Rc in Panax notoginseng, characterized in that, The SNP molecular marker is SNP-218351403, located at position 218351403 on chromosome 37 (Chr1), and its allele is G or A.
2. The SNP molecular marker according to claim 1, characterized in that, The content of ginsenoside Rc in Panax notoginseng plants with genotype GG at the SNP-218351403 locus was significantly higher than that in plants with genotype GA or AA.
3. A set of KASP primer pairs for detecting the SNP molecular marker of claim 1, characterized in that, include: Upstream primer SNP-F: 5'-GAAGGTGACCAAGTTCATGCTCAAAGGCTAAAGACATTCAAATGTAATG-3'; Upstream primer SNP-H: 5'-GAAGGTCGGAGTCAACGGATTCAAAGGCTAAAGACATTCAAATGTAATAA-3'; Downstream primer SNP-R: 5'-GACCCATAGTACAAAGATAGACAATTACT-3'.
4. A kit for assisted breeding of Panax notoginseng ginsenoside Rc content, characterized in that, It includes the KASP primer pair as described in claim 3.
5. A method for KASP gene typing to detect the content of ginsenoside Rc in Panax notoginseng, characterized in that, Includes the following steps: S1. Obtain the genomic DNA of the Panax notoginseng plant to be tested; S2. Using the DNA as a template, perform PCR amplification using the KASP primer pair described in claim 3; S3. Detect the fluorescence signal of the amplification product to determine the genotype of the SNP-218351403 locus; S4. Based on the genotype, plants are screened, wherein plants with the genotype GG are screened as having the potential to have high levels of human parameter saponin Rc.
6. The method according to claim 5, characterized in that, The PCR amplification program in step S2 includes: pre-denaturation at 95°C for 10 minutes; followed by 10 cycles of landing PCR: 95°C for 20 seconds per cycle, then 61°C to 55°C (decreasing by 0.6°C per cycle) for 45 seconds; then 40 cycles of conventional PCR: 95°C for 20 seconds per cycle, then 55°C for 40 seconds per cycle.
7. The method according to claim 5, characterized in that, The PCR reaction system in step S2 is 2 μL, containing: 1 μL of 2× KASP Master Mix, 1 μL of template DNA, and the upstream primers F and H and the downstream primer R as described in claim 3.
8. The method according to claim 5, characterized in that, In step S1, genomic DNA is extracted using the CTAB method.
9. The method according to claim 5, characterized in that, In step S3, fluorescence signals are read using a fluorescence scanner, and genotyping is performed based on signal clustering.