High-throughput and high-sensitivity screening method for endogenous itching-causing substances and application of high-throughput and high-sensitivity screening method

By combining metabolomics and the NanoBiT detection system, the endogenous pruritus LPC (18:1) was screened out, solving the treatment problem of pruritus in systemic diseases and realizing high-throughput and high-sensitivity screening of endogenous pruritus and drugs.

CN121540893APending Publication Date: 2026-02-17JINAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511697138.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-19
Publication Date
2026-02-17

AI Technical Summary

Technical Problem

Current technologies have failed to effectively screen for endogenous pruritus-causing substances in systemic diseases, making it difficult to develop therapeutic drugs, and existing drugs have significant side effects or are ineffective.

Method used

Metabolomics technology was used to screen for changes in endogenous metabolites after systemic diseases such as cholestasis. The G protein dissociation of MRGPR and β-arrestin2 recruitment were detected by the NanoBiT detection system. The pruritogenic effect was verified by the Calflux VTN calcium ion sensor. Finally, the pruritogenic effect of the endogenous pruritus LPC (18:1) was verified in a mouse model.

Benefits of technology

We achieved high-throughput and high-sensitivity screening of endogenous pruritus-inducing substance LPC (18:1), which can be used as a Mrgpra1 pruritus receptor agonist for the preparation of pruritus preparations or screening of anti-pruritus drugs, thus solving the treatment problem of pruritus in systemic diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121540893A_ABST
    Figure CN121540893A_ABST
Patent Text Reader

Abstract

The invention discloses a high-throughput and high-sensitivity screening method for endogenous itching-causing substances and application of the high-throughput and high-sensitivity screening method. According to the invention, firstly, endogenous itching-causing substances are screened out through a metabonomics technology, and then are verified through combination of a NanoBiT-based MRGPR detection system and an in-vivo experiment, so that integrated screening of the endogenous itching-causing substances in systemic disease itching is realized, and the defects of single discovery and screening mode of pruritus in systemic disease itching at present, low screening efficiency and the like are overcome. And breakthrough progress is not made yet. A cholestatic pruritus mouse is taken as an object, and the endogenous substance LPC (18: 1) screened from the cholestatic pruritus disease has strong activation and selectivity of the Mrgpra1 pruritus receptor, and can be used as an Mrgpra1 pruritus receptor agonist tool molecule for screening a tool medicine taking the Mrgpra1 pruritus receptor as a target spot.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of drug development, and specifically relates to a high-throughput, high-sensitivity screening method for endogenous pruritogenic substances and its application. Background Technology

[0002] Itching is a common and unpleasant somatic sensation that evokes the urge to scratch. Chronic pruritus, lasting longer than six weeks, is a common symptom of various chronic systemic diseases, including cholestasis, renal failure, and diabetes. Itching is most prevalent in patients with cholestasis, particularly in primary cholangitis and sclerosing cholangitis, where over 80% of cholestasis patients experience severe itching. Compared to itching caused by skin diseases, itching in systemic diseases is influenced by more factors, has a longer duration, and is less easily relieved, significantly impacting patients' quality of life. Current research has failed to clarify the underlying pruritus and pathogenesis of systemic disease pruritus (such as cholestatic pruritus), hindering the development of therapeutic drugs. Currently, clinical treatments mainly rely on opioid receptor modulators and symptomatic medications (e.g., ursodeoxycholic acid for cholestatic pruritus). However, these drugs not only have significant side effects but are also ineffective in some patients. Systematic screening and identification of pruritus pathogens are crucial for elucidating the pathological mechanisms of systemic disease pruritus and developing effective treatments. Metabolomics is used to comprehensively and rapidly monitor the dynamic changes of endogenous small molecule metabolites in the body, which helps in the discovery of disease biomarkers. Using metabolomics technology, changes in serum metabolites after cholestasis can be systematically analyzed, which is beneficial for screening the exact pruritus caused by cholestasis. Summary of the Invention

[0003] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide a high-throughput, high-sensitivity method for screening endogenous pruritogenic substances.

[0004] Another object of the present invention is to provide the application of the above-mentioned high-throughput, high-sensitivity screening method for endogenous pruritogenic substances.

[0005] Another object of the present invention is to provide the use of LPC (18:1) in the preparation of pruritus preparations.

[0006] Another object of the present invention is to provide the use of LPC (18:1) in screening antipruritic drugs.

[0007] The objective of this invention is achieved through the following technical solution: a high-throughput, high-sensitivity method for screening endogenous pruritogenic substances, comprising the following steps: (1) Analyze the changes in endogenous metabolites after systemic diseases cause itching using metabolomics technology, and select endogenous substances with the highest upregulated content. (2) Detect the effect of endogenous substances obtained in step (1) on calcium influx in dorsal root neurons, and analyze and screen potential endogenous pruritogenic substances that can activate calcium influx in dorsal root neurons; (3) The G protein dissociation detection system based on NanoBiT was used to detect the dissociation effect of potential endogenous pruritogenic substances on downstream G proteins of MRGPR related to pruritus, and substances that can promote the dissociation of downstream G proteins of MRGPR were initially obtained. (4) Using the NanoBiT-based β-arrestin2 recruitment detection system and the Calflux VTN calcium ion sensor, the downstream β-arrestin2 recruitment and calcium signal of the substance that can promote the dissociation of downstream G protein of MRGPR obtained in step (3) are detected to obtain the agonist or biased agonist of MRGPR. (5) Use a mouse model to verify the pruritus effect of the agonist or biased agonist obtained in step (4) in vivo, and obtain endogenous pruritus substances.

[0008] The metabolomics technology described in step (1) is a conventional technology with high throughput, which can comprehensively detect and analyze the metabolites of individuals with systemic diseases causing itching and healthy individuals.

[0009] The metabolites mentioned are metabolic products found in the blood.

[0010] The systemic disease mentioned in step (1) is cholestatic disease, uremia or diabetes; preferably cholestatic disease with itching.

[0011] The analysis described in step (2) is preferably performed through pathway analysis as described in the Kyoto Encyclopedia of Genes and Genomes.

[0012] The screening described in step (2) is preferably done through the HMDB database.

[0013] The NanoBiT-based G protein dissociation detection system described in step (3) includes Gαq-LgBiT plasmid, Gβ plasmid, SmBiT-Gγt1 plasmid and RIC8A plasmid.

[0014] The MRGPR mentioned in step (3) is Mrgpra1, Mrgpra3, Mrgprc11, MRGPRX1 or MRGPRX2; preferably Mrgpra1.

[0015] The detection described in step (3) involves co-transfecting the plasmid of the NanoBiT-based G protein dissociation detection system and the MRGPR expression plasmid into animal cells. After adding substrate, the resulting cells are transferred to 384-well plates for incubation. Potential endogenous pruritogenic substances are then added using an Echo ultrasonic pipetting system, and the intensity of the luminescence is immediately detected using the ultrasensitive luminescence mode of an Envision microplate reader. The Echo ultrasonic pipetting system is characterized by high throughput, while the Envision microplate reader is characterized by high sensitivity. By constructing the NanoBiT-based G protein dissociation detection system, high-throughput and high-sensitivity detection of the G protein dissociation effect of differential metabolites on different MRGPRs can be achieved.

[0016] The animal cells mentioned are preferably human embryonic kidney cells.

[0017] The preferred substrate is coelenterin h.

[0018] The preferred concentration of the substrate in the cell sap is 10 μM.

[0019] The incubation time is preferably 60-120 min.

[0020] The NanoBiT-based β-arrestin2 recruitment detection system described in step (4) includes the MRGPR-SmBiT plasmid and the LgBiT-β-arrestin2 plasmid.

[0021] The MRGPR-SmBiT plasmid is a plasmid that can express MRGPR and SmBiT.

[0022] The LgBiT-β-arrestin2 plasmid is a plasmid that can express LgBiT and β-arrestin2.

[0023] In step (4), the NanoBiT-based β-arrestin2 recruitment detection system was used. The MRGPR-SmBiT plasmid and LgBiT-β-arrestin2 plasmid were co-transfected into animal cells. After adding substrate, the cells were transferred to 384 wells for incubation. Potential endogenous irritants were then added using an Echo ultrasonic pipetting system, and the intensity of the light was immediately detected using the ultrasensitive luminescence mode of an Envision microplate reader. The Echo ultrasonic pipetting system offers high throughput, while the Envision microplate reader offers high sensitivity. By constructing the NanoBiT-based β-arrestin2 recruitment detection system, high-throughput and high-sensitivity detection of the recruitment effect of differentially metabolites on Mrgpra1 downstream β-arrestin2 can be achieved.

[0024] The animal cells mentioned are preferably human embryonic kidney cells.

[0025] The preferred substrate is coelenterin h.

[0026] The preferred concentration of the substrate in the cell sap is 10 μM.

[0027] The incubation time is preferably 60-120 min.

[0028] In step (4), the detection using the Calflux VTN calcium ion sensor involves co-transfecting the Calflux VTN plasmid and the Mrgpra1 plasmid into animal cells. After adding substrate, the resulting cells are transferred to 384-well plates for incubation. Potential endogenous inflammatory substances are then added using an Echo ultrasonic pipetting system, and luminescence is immediately measured using an Envision multimode plate reader. The Echo ultrasonic pipetting system offers high throughput, while the Envision microplate reader offers high sensitivity. The Calflux VTN calcium ion sensor enables high-throughput and high-sensitivity detection of intracellular calcium ion release.

[0029] The animal cells mentioned are preferably human cervical cancer cells.

[0030] The preferred substrate is formazan.

[0031] The preferred concentration of the substrate in the cell sap is 10 μM.

[0032] The incubation time is preferably until the baseline stabilizes.

[0033] The mouse model described in step (5) is preferably a cheek itch animal model.

[0034] The experiment using a mouse model described in step (5) also uses an MRGPR inhibitor, thus demonstrating the function of the agonist from the reverse perspective.

[0035] The above screening method is applied in screening endogenous pruritogenic substances.

[0036] Through the above screening method, the present invention obtained the endogenous pruritus LPC (18:1), which can be used to prepare pruritus preparations or to screen antipruritic drugs.

[0037] The present invention has the following advantages and effects compared with the prior art: (1) Taking cholestatic pruritus as an example, the experimental data of this invention systematically demonstrates that endogenous pruritogenic substances in cholestatic pruritus can be effectively screened through metabolomics technology. The results were verified by combining the NanoBiT-based MRGPR detection system with in vivo experiments, realizing the integrated screening of endogenous pruritogenic substances in cholestatic pruritus. This overcomes the shortcomings of the current single mode of discovery and screening of pruritogens in cholestatic pruritus, which has not yet achieved a breakthrough.

[0038] (2) This invention is the first to combine metabolomics technology with the NanoBiT-based MRGPR detection system. Through in vitro and in vivo experiments, it has been demonstrated that the endogenous substance LPC (18:1) has a strong activation and selectivity of Mrgpra1 itch receptor in cholestatic pruritus. It can be used as a Mrgpra1 itch receptor agonist tool molecule for screening tool drugs targeting Mrgpra1 itch receptor.

[0039] (3) The technology provided by this invention has the advantage of high throughput in metabolomics. For example, it can comprehensively detect and analyze endogenous differential metabolites in the body as potential endogenous pruritus substances, narrow down the scope before verifying the pruritus effect, which greatly saves money and time. In addition, in the NanoBiT-based MRGPR detection system constructed in this invention, not only is the Echo ultrasonic pipetting system with high throughput used, but also the Envision microplate reader with high sensitivity is used. Combined with metabolomics technology, it realizes high-throughput, high-sensitivity and integrated screening of endogenous pruritus substances in systemic pruritus. Attached Figure Description

[0040] Figure 1 This is a graph showing the results of metabolomics screening of differentially expressed metabolites in the ANIT cholestatic pruritus model; where A represents the number of scratches by mice; B represents the serum AKP content; C represents the principal component analysis of mice in the control and model groups; D represents the partial least squares discriminant analysis of mice in the control and model groups; E represents the classification of differentially expressed metabolites; F represents the volcano plot comparing the model and control groups; and G represents the expression heatmap of differentially expressed metabolites.

[0041] Figure 2 This is a graph showing the effect of differential metabolites on calcium influx in primary mouse DRG neurons. In this graph, A represents the calcium influx in primary mouse DRG neurons caused by different differential metabolites as detected by an ELISA reader; B is a statistical graph of fluorescence images of calcium influx in primary mouse DRG neurons caused by different differential metabolites, where δF / F0 represents the percentage increase of this ratio compared to the baseline ratio divided by the baseline ratio; and C is a fluorescence image.

[0042] Figure 3This is a diagram showing the agonistic effect of LPC on pruritus-related MRGPR receptors; where A is a schematic diagram of G protein dissociation; BF are the effects of LPC on the G protein dissociation of Mrgpra1, Mrgpra3, Mrgprc11, MRGPRX1, and MRGPRX2 receptors, respectively.

[0043] Figure 4 The graph shows the results of downstream calcium release induced by LPC activation of MRGPR, but without affecting the recruitment of β-arrestin2; where A represents the effect of LPC on downstream calcium signaling of MRGPR; and B represents the effect of LPC on the recruitment of β-arrestin2 after MRGPR activation.

[0044] Figure 5 The diagram shows the results of LPC activating Mrgpra1 to induce cheek itching in mice; where A represents the wiping behavior induced by LPC in mice; BC represents different manifestations of the scratching behavior induced by LPC in mice; and DE represents different manifestations of the effect of combined treatment of LPC and QWF on the scratching behavior of mice. Detailed Implementation

[0045] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0046] Experimental materials: C57BL / 6 mice, SPF grade, male, 6-8 weeks old, purchased from Zhuhai Beston Biotechnology Co., Ltd. The sequence of the Mrgpra1 gene, referenced from positions 34-1027 in GenBank NM_153095.2, was synthesized by the company and then processed via restriction enzyme sites. EcoRI and XhoI The plasmid Mrgpra1 was obtained by inserting it into the vector pCDNA3.1(+). The sequence of the Mrgpra3 gene, referenced from positions 69-1329 in GenBank NM_153067.2, was synthesized by the company and then processed via restriction enzyme sites. EcoRI and XhoI The plasmid Mrgpra3 was obtained by inserting it into the vector pCDNA3.1(+). The sequence of the Mrgprc11 gene, referenced from positions 155-1482 in GenBank NM_207540.3, was synthesized by the company and then processed via restriction enzyme sites. EcoRI and XhoI The plasmid Mrgprc11 was obtained by inserting it into the vector pCDNA3.1(+). The sequence of the MRGPRX1 gene, referenced from positions 241 to 1189 in GenBank accession number NM_001393578.1, was synthesized by the company and then processed via restriction enzyme sites. EcoRI and HindIII Inserted into the vector pCDNA3.1(+), the MRGPRX1 plasmid was obtained; The sequence of the MRGPRX2 gene, referenced from positions 399-1391 in GenBank accession number NM_001303615.2, was synthesized by the company and then processed via restriction enzyme sites. EcoRI and HindIII The plasmid MRGPRX2 was obtained by inserting it into the vector pCDNA3.1(+). The cDNA sequence of the SmBiT gene is as follows: GTGACCGGCTACCGGCTGTTCGAGGAGATTCTG, which was synthesized by the company. The sequence of the Gβ gene, referenced from positions 488 to 1241 in GenBank accession number NM_001282538.2, was synthesized by the company and then processed via restriction enzyme sites. EcoR I and Hind III was inserted into the vector pCDNA3.1(+) to obtain the Gβ plasmid; The sequence of the RIC8A gene, referenced from positions 1148 to 2743 in GenBank accession number NM_001286134.2, was synthesized by the company and then processed via restriction enzyme sites. EcoRI and HindIII The plasmid RIC8A was obtained by inserting it into the vector pCDNA3.1(+). The sequence of linker1: GGATCGAGCGGTGGTGGCGGGAGCGGAGGTGGAGGGTCGTCAGGT; Construction of SmBiT-Gγt1 plasmid: Specific construction method and gene sequence reference (Inoue A, Raimondi F, Kadji FMN, et al. Illuminating G-Protein-Coupling SelectivityofGPCRs. Cell. 2019 Jun 13;177(7):1933-1947).

[0047] Construction of Gαq-LgBiT plasmid: Specific construction method and gene sequence reference (Inoue A, Raimondi F, Kadji FMN, et al. Illuminating G-Protein-Coupling Selectivity of GPCRs. Cell. 2019 Jun 13;177(7):1933-1947).

[0048] Construction of the Mrgpra1-SmBiT plasmid: The cDNA of Mrgpra1, linker1, and SmBiT were sequentially ligated and synthesized to obtain the Mrgpra1-SmBiT gene; the Mrgpra1-SmBiT gene was then cloned into the pCDNA3.1(+) vector. Nhe I and EcoR I restriction enzyme sites were used to obtain the Mrgpra1-SmBiT plasmid.

[0049] Construction of LgBiT-β-arrestin2 plasmid: Specific construction method and gene sequence reference (Wang J, YeRD. Agonist concentration-dependent changes in FPR1 conformation leadtobiased signaling for selective activation of phagocyte functions. Proc NatlAcad Sci US A. 2022 Aug 2;119(31):e2201249119.).

[0050] The Calflux VTN calcium ion sensor consists of Venus, troponin C (TnC), and NanoLuc fragments linked sequentially. Troponin C has specific, high-affinity calcium ion-binding sites that rapidly and specifically bind to calcium ions, causing a change in the three-dimensional structure of troponin C. By linking Venus and NanoLuc to both ends of TnC, the degree of conformational change in TnC is detected to represent changes in intracellular calcium ion concentration. The Calflux VTN plasmid was constructed as follows: pVenus-N1 (Addgene ID#61854) was used as the template DNA for the Venus fragment, and PCR was performed using primers VenusF and VenusR to obtain the Venus fragment; pNL 1.1 plasmid (purchased from Promega) was used as the template DNA for the NanoLuc fragment, and PCR was performed using primers NanoLuc F and NanoLuc R to obtain the NanoLuc fragment. Using the TnC domain (Addgene ID #49532) as a template, the TnC fragment was synthesized using overlap PCR. Primer sequences are referenced in the literature (Yang J, et al. Coupling optogenetic stimulation with NanoLuc-based luminescence (BRET) Ca++sensing. Nat Commun. 2016 Oct 27;7:13268.). The adapter sequences RMQDA and PLAEL were ligated to the two ends (TnC fragment) of the blunt-ended PCR product using T4 DNA ligase. The end with the RMQDA adapter sequence was then ligated to the Venus (N-terminus), and the end with the PLAEL adapter sequence was ligated to the NanoLuc (C-terminus), yielding the Venus-RMQDA(CGCATGCAGGACGCG)-TnC-PLAEL(CCGCTGGCGGAACTG)-NanoLuc gene. The Venus-TnC-NanoLuc gene was then cloned into the PCDNA3.1 vector. EcoRI and KpnI Restriction enzyme sites were identified to obtain the assembly product. The assembly product was transformed into competent *E. coli*, cultured on LB agar plates containing ampicillin, and positive clones were screened. Positive colonies were cultured, and plasmids were extracted. After DNA sequencing confirmed the presence of the plasmid, the Calflux VTN plasmid was obtained.

[0051] NanoLuc F:5'-CTGTGGTACCTTACGCCAGAATGCGTTCGCACAGCCGCC-3'; NanoLuc R: 5'-ATCGAAGCTTACGCCAGAATGCGTTCGCACAGCCGCC-3'; Venus F: 5'-ATCGGAATTCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3'; Venus R: 5'-ATCGGAGCTCCTTGTACAGCTCGTCCATGCCGAGAGTG-3'.

[0052] All modified plasmids were verified for accuracy by DNA sequencing.

[0053] Example 1 Male C57BL / 6 mice, after one week of acclimatization, were randomly divided into a control group (N=7-8) and a model group (N=7-8) each. The model group was administered α-naphthyl isothiocyanate (ANIT) by gavage at a dose of 25 mg / kg once daily for 5 consecutive days to induce cholestasis. The control group received the same volume of olive oil solution. Twelve hours after the last ANIT administration, behavioral recordings were performed. After recording, blood was collected from the orbital rim of the mice. The blood was allowed to stand at room temperature for 30 min, then centrifuged at 3500 r / min for 10 min. The supernatant serum was collected, aliquoted, and stored at -80 °C unless immediately tested. Serum alkaline phosphatase (AKP) was measured according to the manufacturer's instructions. Behavioral results showed a significant increase in scratching behavior after ANIT modeling (see [link to product details]). Figure 1 In A), the AKP content increased significantly (see A). Figure 1 (B in the middle).

[0054] Remove serum samples from a -80 °C freezer and thaw at room temperature. Pre-cool the samples with methanol at -20 °C for 15 min. After thawing, transfer 100 μL of the sample to a 2 mL centrifuge tube, add 300 μL of pre-cooled methanol at a methanol:serum ratio of 3:1, vortex for 30 s, and then incubate the sample at 4 °C overnight to precipitate proteins and other solids. After overnight incubation, centrifuge the sample at 4 °C and 14000 rpm for 10 min, and transfer 100 μL of the supernatant to a new centrifuge tube and dry it.

[0055] Take 50 μL of serum from the model group and 50 μL of serum from the control group, mix them in equal volumes in 50 mL centrifuge tubes, aliquot them, and prepare quality control (QC) samples using methanol as described above. These QC samples can be used to assess experimental repeatability. During the instrumental testing process, insert a QC sample after testing five samples in sequence for subsequent analysis.

[0056] After reconstitution of the processed samples and quality control samples, they were analyzed by LC-MS. The instrument used for LC-MS was a Thermo Fisher Scientific UHPLC-Q Exactive system; the column was an ACQUITY UPLCHSS T3 (2.1 mm × 100 mm, 1.8 μm). The chromatographic conditions were as follows: column oven temperature was set to 40 ℃; mobile phase A was an aqueous solution containing 0.1% v / v formic acid, mobile phase B was acetonitrile, and the elution mode was gradient elution (v / v): 0-11 min 5% -95% B; 11-16 min 95% B; 16-16.1 min 95% - 5% B; 16.1-19 min 5% B; injection volume was 3 μL, and the LC flow rate was 0.25 mL / min. Mass spectrometry analysis was performed in both positive and negative ion modes. The ion source temperature was 500 °C, and ion source gas 1 was 55 psi; ion source gas 2 was 60 psi. The ion ejection voltage ranged from 5.5 kV to -4.5 kV. The mass range of the mass spectrometry scan was 100-1700, and the collision energy was cyclic at 20-40-60 V. After the analysis, the raw data was exported and processed using Progenesis QI (Waters Corporation, Milford, USA) software, including both detection and QC samples. Baseline filtering, retention time correction, peak identification, and integration alignment were performed to obtain a data matrix containing retention time, mass-to-charge ratio, and peak intensity. The data matrix was preprocessed using the cloud platform cloud.majorbio.com. The first step was to filter out missing values ​​in the data matrix, with a standard of 80% filtering and imputation to ensure that at least 80% of the non-zero variables in each sample group were retained. The second step is to normalize the processed data matrix, setting the exclusion criterion to a standard deviation (RSD) > 30%, meaning variables exceeding this standard are excluded. The normalized data, after being processed to log10, can be used for subsequent analysis. Subsequently, the ropls package (Version 1.6.2) in R software was used to perform Principal Component Analysis (PCA) and Partial Least Squares Discriminant Analysis (OPLS-DA) on the preprocessed dataset, and a seven-cycle cross-validation was used for evaluation. The results are as follows: Figure 1 Figures C and D show that the two groups of sample points exhibited a classification and aggregation phenomenon with good aggregation degree, suggesting that there are differences in metabolites between the control group and the ANIT model group.

[0057] Differentially regulated metabolites were analyzed using the Kyoto Encyclopedia of Genes and Genomes (KEGG). MS and MS / MS mass spectrometry data were also imported into the HMDB (http: / / www.hmdb.ca / ) public metabolic database for further screening and identification. After comparison with the HMDB database, a total of 110 differentially regulated metabolites were identified, of which 66 were downregulated and 44 were upregulated. Classification and comparison of these compounds revealed that lipids and lipid molecules accounted for the highest proportion, followed by organic acids and their derivatives. Based on the criteria of increasing content to the maximum and optimal level, endogenous substances in lipids and lipid molecules with the highest proportion were selected, and differentially expressed metabolites that did not meet the criteria were removed. The 14 differentially expressed metabolites that met the criteria included: 3-hydroxytetradecanedioic acid, Lpc(18:3-sn1), Lpc(17:2-sn1), Lpc(16:2-sn1), palmitoylcarnitine, phoenicoxanthin, O-(17-carboxyheptadecanoyl)carnitine, and taurocholic acid. acid), (9E)-9-nitrooctadecyl-9-enoylcarnitine, Pc(pge1 / p-18:0), 5-hydroxyhexadecanoylcarnitine, Carbopros, Glycerophosphocholine, Cholic acid glucuronide (see Figure 1 The EG in the sample was selected from several commercially available standards, namely 3-Hydroxytetradecanedioic acid (abbreviated as 3-HA), LPC (18:1) representing Lpc (18:3-sn1), Lpc (17:2-sn1), and Lpc (16:2-sn1) metabolites, Palmitoylcarnitine, Taurocholic acid, PC (18:1) representing Pc (pge1 / p-18:0) metabolites, and the positive control drug LCA (lithocholic acid), for subsequent validation of pruritus effects.

[0058] Calcium ions, as second messengers, play a crucial role in cell signal transduction, especially in itch signal transduction. Abnormal calcium ion signals can affect the occurrence and development of chronic pruritus. Primary neurons from mouse DRGs (dorsal root ganglia) were isolated, and the specific procedures were described in the reference (Meixiong J, et al. MRGPRX4 is a Gprotein-coupled receptor activated by bile acids that may contribute to cholestatic pruritus[J]. Proceedings of the National Academy of Sciences, 2019, 116(21): 201903316. DOI: 10.1073 / pnas.1903316116). The neurons were cultured in serum-free Neurobasal medium containing 1×B27, 1×GlutaMAX™, and 20 ng / mL β-NGF. After 24 hours of adherent culture, calcium imaging experiments were performed. Figure 2 ).

[0059] Primary DRG neurons were cultured in BeyoGold™ 96-well black plates in serum-free Neurobasal medium containing 1×B27, 1×GlutaMAX™, and 20 ng / mL β-NGF. On day 5 of differentiation, the medium was discarded, and the cells were washed once with PBS. Fluo 4 staining solution was prepared at a 1:500 volume ratio, with 100 μL per well. Cells were incubated at 37 ℃ in the dark for 40 min. Cells were then analyzed using a fluorescence microplate reader (Ex / Em = 490 / 525 nm). The results are shown below. Figure 2 As shown in A in the figure. It was finally determined that LPC (18:1) has the potential to activate calcium influx into DRG neurons and possess endogenous itch-inducing substances.

[0060] Primary DRG neurons were cultured in 6-well plates. On day 5 of differentiation, the culture medium was discarded, and the cells were washed once with PBS. Fluo 4 staining solution (1:500 volume ratio, i.e., diluted 500 times with water) was prepared according to the volume of the 6-well plate. 1600 μL of staining solution was added to each well and incubated at 37 ℃ in the dark for 40 min. After incubation, the blank group was washed with HBSS and then imaged using a laser confocal microscope. Other groups were treated with different compounds at a concentration of 40 μM before imaging (Ex / Em = 490 / 525 nm). Results are as follows: Figure 2 As shown in BC, it was initially found that LPC (18:1) activated calcium ion influx in DRG neurons.

[0061] We then examined the activation effect of differentially metabolites on MRGPR. A NanoBiT-based G protein dissociation detection system was constructed (see...). Figure 3 (A) NanoBiT is a combination of LgBiT and SmBiT. When these two combine to form NanoBiT, fluorescence can be detected at 450-480 nm by adding the substrate coelenterazine. Mrgpra1, Mrgpra3, Mrgprc11, MRGPRX1, and MRGPRX2 plasmids were co-transfected into human embryonic kidney HEK293 cells with four plasmids: Gαq-LgBiT, Gβ, SmBiT-Gγt1, and RIC8A, respectively. The plasmids were mixed at a mass ratio of 2:1:5:5:1. After transfection for 24 hours, the cells were digested with trypsin and resuspended in HBSS to achieve a cell count of 1×10⁶ cells. 6 The concentration of substrate Coelenterazineh was increased to a final concentration of 10 μM, and 20 μL was transferred to each well of a 384-well plate. The plates were incubated at room temperature for 60–120 min. Then, using an Echo sonic pipetting system, 5 μL of LPC (18:1) at concentration gradients of 12.5, 25, 50, 100, 200, 300, and 400 μM, positive control drugs chloroquine (CQ) and deoxycholic acid (DCA) at concentration gradients of 25, 50, 100, 200, 400, 800, and 1600 μM, and positive control drug clomipramine (CHO) at concentration gradients of 1, 10, 50, 100, 200, 400, and 800 μM were added. Immediately, the intensity of the cold light was detected using the ultrasensitive luminescence mode of an Envision microplate reader to detect the G protein dissociation effect of differentially metabolites on different MRGPRs. Results are as follows: Figure 3 BF analysis showed that LPC (18:1) dose-dependently increased the dissociation of downstream G proteins of Mrgpra1.

[0062] HEK293 cells were co-transfected with the constructed Mrgpra1-SmBiT plasmid and LgBiT-β-arrestin2 plasmid at a mass ratio of 2:1. After transfection for 24 h, the cells were digested with trypsin and resuspended in HBSS to achieve a cell count of 1×10⁶ cells / year. 6Add substrate Coelenterazine h (final concentration 10 μM) at a concentration of 10 μM / mL and transfer to 384-well plates, 20 μL per well. Incubate at room temperature for 60–120 min. Then, using an Echo sonic pipetting system, add 5 μL of LPC (18:1) at concentration gradients of 1, 3.125, 6.25, 12.5, 25, 50, and 100 μM and DCA at concentration gradients of 1, 10, 500, 100, and 800 μM. Immediately use an Envision microplate reader in ultrasensitive luminescence mode to detect the luminescence intensity and assess the recruitment effect of differentially metabolites on Mrgpra1 downstream β-arrestin2. Results are as follows: Figure 4 B in the study showed that LPC (18:1) dose-dependently increased the recruitment of β-arrestin2 downstream of Mrgpra1.

[0063] The calcium ion sensor Calflux VTN plasmid and Mrgpra1 plasmid were co-transfected into human cervical cancer HeLa cells. After transfection with the plasmids at a mass ratio of 5:1 for 24 hours, the cells were digested with trypsin and resuspended in HBSS to achieve a cell count of 1 × 10⁻⁶ cells / year. 6 Cells were injected at a concentration of 10 μM with formalin (furimazine solution). The solution was then transferred to 384-well white agar plates (20 μL per well) to detect the baseline. After the baseline stabilized, 5 μL of LPC (18:1) and DCA were added to the cells using an Echo sonication pipetting system at concentration gradients of 12.5, 25, 50, 100, 200, 300, 400 μM and 25, 50, 100, 200, 800, 1600 μM. The luminescence was measured using an Envision multimode plate reader to detect the degree of intracellular calcium ion release. Results are as follows: Figure 4 As shown in A, LPC(18:1) did not increase the concentration of intracellular calcium ions downstream of Mrgpra1 in a dose-dependent manner, indicating that LPC(18:1) is biased to activate Mrgpra1 and is a biased agonist of Mrgpra1.

[0064] Finally, the pruritus-inducing effect of the differentially metabolites through activation of MRGPR was evaluated in vivo. C57BL / 6 mice were randomly divided into two groups: a control group (Con) and an LPC group (LPC18:1), with six mice in each group. On the day of the experiment, mice were placed in cages for 30 minutes to acclimatize. Then, mice were administered a single dose according to the prescribed volume. The control group received a 50 μL injection of physiological saline in the cheek, while the LPC group received a 50 μL injection of a 10 mM LPC solution prepared with physiological saline in the cheek. Immediately after administration, the mice were returned to their cages, and their behavior was recorded using a camera for 1 hour. After recording, animal behavior was observed. One scratching action was defined as the mouse raising its hind paw and scratching the modeled area on its cheek before placing it on the ground. The scratching behavior was judged and counted to determine the pruritus-inducing effect of the differentially metabolites. The experimental animals were further divided into three groups: a control group (Con), an LPC group (LPC), and an inhibitor group (LPC+QWF), with six mice in each group. The solvent was physiological saline containing 5% DMSO and 5% Tween-80. In the LPC+QWF group, LPC and QWF were mixed and dissolved in the solvent to a concentration of (LPC 10 mM, QWF 100 μM), and then injected into the cheeks of mice. Otherwise, the experimental procedures and administration methods were the same for the Con and LPC groups. Results showed that acute intradermal injection of LPC into the cheeks of mice did not significantly increase the total number of scratches. Figure 5 The A in the figure indicates that LPC does not induce pain in mice. However, it significantly increases scratching behavior, producing a strong pruritus effect. Figure 5 The number of scratches was significantly reduced when Mrgpra1 inhibitor tripeptide QWF (100 µM) was administered intradermally in combination with LPC. Figure 5 (DE in the text). This indicates that LPC induces itching in mice by activating Mrgpra1.

[0065] The data in this application demonstrate the importance of MRGPR in itch signal transduction and the itch-inducing effect of MRGPR agonists. This method includes, but is not limited to, an ANIT-induced cholestatic pruritus model, and can also be applied to the screening of metabolites in human patients with cholestatic pruritus and patients with pruritus due to various systemic diseases, including but not limited to pruritus caused by uremia, diabetes, and other systemic diseases. Furthermore, for pruritus caused by other systemic diseases, the NanoBiT-based MRGPR detection system can be used for validation after screening for differentially expressed metabolites, facilitating high-throughput and rapid screening of endogenous itch-inducing substances in vivo.

[0066] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A high-throughput, high-sensitivity screening method for endogenous itch mediators, characterized by Comprising the following steps: (1) analyzing the changes of endogenous metabolites after systemic diseases leading to itching by metabolomics technology, and selecting the top-ranked endogenous substances with up-regulated content; (2) detecting the effect of the endogenous substances obtained in step (1) on the calcium influx of dorsal root neurons, and analyzing and screening to obtain potential endogenous itch substances that can activate the calcium influx of dorsal root neurons; (3) detecting the dissociation effect of potential endogenous itch substances on the downstream G protein of MRGPR associated with itching using a NanoBiT-based G protein dissociation detection system, and preliminarily obtaining substances that can promote the dissociation of the downstream G protein of MRGPR; (4) detecting the recruitment of downstream β-arrestin2 and calcium signal of the substances obtained in step (3) that can promote the dissociation of the downstream G protein of MRGPR using a NanoBiT-based β-arrestin2 recruitment detection system and a Calflux VTN calcium ion sensor, and obtaining agonists or biased agonists of MRGPR; (5) verifying the itching effect of the agonists or biased agonists obtained in step (4) in vivo using a mouse model, and obtaining endogenous itch substances.

2. The screening method according to claim 1, wherein: in step (1), the metabolomics technology is to analyze the metabolites of individuals with systemic diseases leading to itching and healthy individuals; and the systemic diseases are cholestatic diseases, uremia or diabetes.

3. The screening method according to claim 2, wherein: the metabolites are metabolites in blood.

4. The screening method according to claim 1, wherein: in step (2), the analysis is Kyoto Encyclopedia of Genes and Genomes pathway analysis; and in step (2), the screening is performed by database HMDB.

5. The screening method according to claim 1, wherein: in step (3), the NanoBiT-based G protein dissociation detection system comprises Gαq-LgBiT plasmid, Gβ plasmid, SmBiT-Gγt1 plasmid and RIC8A plasmid; in step (3), the MRGPR is Mrgpra1, Mrgpra3, Mrgprc11, MRGPRX1 or MRGPRX2; and in step (4), the NanoBiT-based β-arrestin2 recruitment detection system comprises MRGPR-SmBiT plasmid and LgBiT-β-arrestin2 plasmid.

6. The screening method according to claim 5, wherein: in step (3), the detection using the NanoBiT-based G protein dissociation detection system is to co-transfect the plasmids of the NanoBiT-based G protein dissociation detection system and MRGPR expression plasmid into animal cells, add the obtained cells into substrate, transfer to 384-well plate for incubation, then add potential endogenous itch substances using Echo ultrasonic pipetting system, immediately detect the luminescence intensity using Envision enzyme label instrument in super-sensitive cold light mode, and detect the G protein dissociation effect of different MRGPRs on differential metabolites. ​ ​ ​ ​ ​ ​ ​ ​ ​ In step (4), the MRGPR-SmBiT plasmid and LgBiT-β-arrestin2 plasmid were co-transfected into animal cells, and the obtained cells were transferred to 384-well plates after adding a substrate, then potential endogenous pruritogens were added by using an Echo ultrasonic pipetting system, and immediately the luminescence intensity was detected by using an Envision microplate reader in the super-sensitive cold light mode to detect the recruitment effect of the differential metabolites on β-arrestin2 downstream of Mrgpra1; In step (4), the calcium ion sensor Calflux VTN plasmid and Mrgpra1 plasmid were co-transfected into animal cells, and the obtained cells were transferred to 384-well plates after adding a substrate, then potential endogenous pruritogens were added by using an Echo ultrasonic pipetting system, and immediately the luminescence was measured by using an Envision multi-mode plate reader to detect the degree of calcium ion release in the cells.

7. The screening method of claim 6, wherein: In the detection using the NanoBiT-based G protein dissociation detection system: the animal cells are human embryonic kidney cells; the substrate is coelenterazine h; the concentration of the substrate in the cell solution is 10 μM; the incubation time is 60-120 min; In the detection using the NanoBiT-based β-arrestin2 recruitment detection system: the animal cells are human embryonic kidney cells; the substrate is coelenterazine h; the concentration of the substrate in the cell solution is 10 μM; the incubation time is 60-120 min; In the detection using the Calflux VTN calcium ion sensor: the animal cells are human cervical cancer cells; the substrate is furimazine; the concentration of the substrate in the cell solution is 10 μM; the incubation time is until the baseline is stable.

8. The screening method of claim 1, wherein: in step (5), the mouse model is a facial itching animal model; in step (5), the mouse model is used to verify the experiment, and an MRGPR inhibitor is also used.

9. The screening method of any one of claims 1-8 for screening endogenous pruritogens.

10. Use of LPC (18:1) in the preparation of an anti-itching preparation or in the screening of anti-itching drugs.