Taq DNA polymerase mutant as well as preparation method and application thereof

By introducing specific amino acid mutations into Taq DNA polymerase, a Taq DNA polymerase mutant with improved performance was prepared, solving the problem of slow amplification speed and achieving faster amplification and higher detection efficiency, which is suitable for high-throughput sequencing and rapid clinical diagnosis.

CN121555464APending Publication Date: 2026-02-24ZHUHAI BIORI BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610032216.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-29
Publication Date
2026-02-24

AI Technical Summary

Technical Problem

The current Taq DNA polymerase has a slow amplification rate, which has become a bottleneck for PCR reaction time, especially affecting detection efficiency and cost in high-throughput sequencing and rapid clinical diagnosis.

Method used

By introducing specific amino acid mutations, such as E9G, T26A, G59W, and L98P, performance-enhanced Taq DNA polymerase mutants were prepared, significantly improving catalytic activity and amplification speed.

Benefits of technology

The catalytic activity is increased by more than two times, the amplification rate reaches 5 s/kb, significantly shortening the PCR reaction time, improving detection efficiency and reducing costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121555464A_ABST
    Figure CN121555464A_ABST
Patent Text Reader

Abstract

The invention provides a Taq DNA polymerase mutant as well as a preparation method and application thereof, and relates to the technical field of biology. According to the Taq DNA polymerase mutant, the loci of L98P, R175W, D191G, I232V, K292M, T385A, H676R, E742V and K767E are subjected to mutation. The performance of the Taq DNA polymerase mutant is remarkably superior to that of a wild type, the catalytic activity of the Taq DNA polymerase mutant is improved by more than two times, the amplification speed is increased to 5 s / kb, the total consumed time of PCR reaction can be greatly shortened, and the Taq DNA polymerase mutant has important value of saving time and cost in the fields of rapid detection and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a Taq DNA polymerase mutant, its preparation method, and its application. Background Technology

[0002] DNA polymerases are a class of key enzymes present in all living organisms. Their basic function is to catalyze the polymerization of deoxyribonucleotides using DNA as a template, thereby completing the replication of DNA molecules. This biological function is widely used in molecular biology techniques in vitro, especially polymerase chain reaction (PCR). PCR technology, by simulating the in vivo DNA replication process in vitro, can exponentially amplify specific DNA fragments in a short time, and has become an indispensable basic tool in life science research, clinical diagnosis, forensic identification, and molecular breeding. The efficiency and specificity of PCR technology largely depend on the performance of the DNA polymerase used.

[0003] The application of Taq DNA polymerase, isolated from thermophilic bacteria (Thermus aquaticus), is a milestone in the development of PCR technology. Due to the thermophilic nature of its source organism, Taq DNA polymerase exhibits excellent thermostability, maintaining its activity under the high-temperature denaturation conditions required for PCR cycles. This eliminates the need to replenish the enzyme after each cycle, greatly simplifying the process and automating PCR reactions. Thanks to its excellent catalytic activity and stability, wild-type Taq DNA polymerase has become the most widely used enzyme in routine PCR experiments, leading to the development of various commercially available PCR premixes and related reagents.

[0004] However, as molecular detection technologies advance towards faster and higher throughput, the inherent limitations of wild-type Taq DNA polymerase have gradually become apparent. One of the most prominent drawbacks is its amplification rate—the rate at which the polymerase synthesizes a new strand along the template strand—which is relatively limited. In standard PCR procedures, the time required for the extension step directly depends on the length of the target amplified fragment and the extension rate of the polymerase. For longer DNA fragments, or in high-throughput sequencing library construction workflows requiring the processing of large numbers of samples, the time cost determined by the enzymatic extension rate becomes the bottleneck of the entire experimental process, significantly extending the total reaction time.

[0005] In summary, while wild-type Taq DNA polymerases widely used in existing technologies offer stable performance, they suffer from significant limitations in amplification efficiency. This speed limitation directly leads to longer experimental cycles, reduced throughput, and, to some extent, increased instrument usage and human resource costs. This deficiency is particularly pronounced in applications requiring extremely high time sensitivity, such as rapid clinical diagnosis and pathogen screening for public health emergencies, hindering the further realization of the potential of PCR technology. Therefore, there is an urgent need for a DNA polymerase with faster amplification speed and higher efficiency.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] The purpose of this invention is to provide a Taq DNA polymerase mutant, its preparation method, and its applications. The Taq DNA polymerase mutant exhibits significantly superior performance compared to the wild type, with its catalytic activity more than doubled and amplification speed as fast as 5 s / kb, greatly reducing the total PCR reaction time. This characteristic makes it of significant value in saving time and costs in applications such as rapid clinical diagnosis and high-throughput sequencing.

[0008] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides a Taq DNA polymerase mutant, comprising at least one of the mutation sites E9G, T26A, G59W, L98P, D142N, R175W, D191G, I232V, K292M, L351P, T385A, A391V, D488G, P548A, D551V, A608G, H676R, E687K, E708G, E742Q, L817Q, K767E, E742V, and E471G.

[0009] In an optional embodiment, the Taq DNA polymerase mutant is selected from any one of the first mutant, the second mutant, and the third mutant; In this case, the A391V site of the first mutant is mutated; The second mutant has mutations at the L98P, R175W, D191G, I232V, K292M, T385A, H676R, E742V and K767E sites; The third mutant exhibits mutations at the E9G, T26A, G59W, D142N, L351P, E471G, D488G, P548A, D551V, A608G, E687K, E708G, E742Q, and L817Q sites.

[0010] In an optional embodiment, the Taq DNA polymerase mutant is selected from any one of the first mutant with an amino acid sequence as shown in SEQ ID NO.4, the second mutant with an amino acid sequence as shown in SEQ ID NO.6, and the third mutant with an amino acid sequence as shown in SEQ ID NO.8.

[0011] In a second aspect, the present invention provides a nucleic acid molecule comprising the coding sequence of a Taq DNA polymerase mutant as described in any of the foregoing embodiments.

[0012] In an optional embodiment, the nucleotide sequence of the nucleic acid molecule is shown as any one of SEQ ID NO.3, SEQ ID NO.5, and SEQ ID NO.7.

[0013] Thirdly, the present invention provides an expression vector comprising nucleic acid molecules as described in the foregoing embodiments.

[0014] Fourthly, the present invention provides a recombinant expression transformant comprising a nucleic acid molecule as described in the foregoing embodiments, and / or an expression vector as described in the foregoing embodiments.

[0015] Fifthly, the present invention provides a detection product comprising the Taq DNA polymerase mutant as described in any of the foregoing embodiments.

[0016] Sixthly, the present invention provides a method for preparing a Taq DNA polymerase mutant as described in any of the foregoing embodiments, comprising: Culture host cells; The host cells are induced to express the Taq DNA polymerase mutant. The Taq DNA polymerase mutant was isolated and obtained.

[0017] In a seventh aspect, the present invention provides the application of the Taq DNA polymerase mutant as described in any of the foregoing embodiments in nucleic acid amplification.

[0018] This application provides a Taq DNA polymerase mutant, its preparation method, and its applications. Compared with wild-type Taq DNA polymerase, the Taq DNA polymerase mutant containing at least one specified mutation site exhibits significant performance improvements. These improvements are mainly reflected in two key aspects: catalytic activity and amplification rate.

[0019] First, introducing these specific amino acid mutations significantly enhances the enzyme's catalytic activity. Experimental data show that the polymerase activity of the mutant is more than twice that of the wild type, with specific activity increases ranging from 2.11 to 2.30 times. Higher catalytic activity means that, within the same reaction time, this mutant can catalyze the polymerization of deoxyribonucleotides more efficiently, synthesizing more DNA products, thereby improving the overall efficiency of the amplification reaction.

[0020] Secondly, and most importantly, this mutant exhibits an amplification rate far exceeding that of the wild-type enzyme. When amplifying a 1kb DNA fragment, this mutant can complete effective amplification within an extension time of as little as 5 seconds, meaning an amplification rate of at least 5 s / kb. Under the same rapid conditions, wild-type Taq DNA polymerase fails to amplify the target fragment. This characteristic directly shortens the extension time required for each cycle in the polymerase chain reaction, thereby significantly reducing the total time consumed in the entire amplification process.

[0021] In summary, these beneficial effects make this mutant particularly suitable for applications requiring high speed and efficiency. For example, in clinical diagnosis and pathogen screening, faster amplification speeds can significantly shorten the detection cycle, allowing results to be obtained more quickly. Similarly, in high-throughput sequencing and other processes that require handling large numbers of samples, improving amplification efficiency not only saves valuable time but also effectively reduces related costs such as instrument operation. Attached Figure Description

[0022] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0023] Figure 1 This is a schematic diagram illustrating the principle of primer extension electrophoresis for detecting mutant activity in Example 2; Figure 2 The above image shows the electrophoresis diagrams and data charts of the three mutants with enhanced activity screened by primer extension electrophoresis in Example 2 (the top image is the gel electrophoresis diagram; the bottom image is a bar chart of the quantitative analysis of the gel electrophoresis results in the upper part). Figure 3 This is the amplification and verification result of the crude Taq DNA polymerase mutant in the PCR system in Example 3. Detailed Implementation

[0024] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0025] This application provides a Taq DNA polymerase mutant, including at least one of the following mutation sites: E9G, T26A, G59W, L98P, D142N, R175W, D191G, I232V, K292M, L351P, T385A, A391V, D488G, P548A, D551V, A608G, H676R, E687K, E708G, E742Q, L817Q, K767E, E742V, and E471G.

[0026] In some embodiments, the Taq DNA polymerase mutant is selected from any one of the first mutant, the second mutant, and the third mutant, and the matrix can be as shown in Table 1: Table 1. Mutants and their mutation sites

[0027] Furthermore, the Taq DNA polymerase mutant is selected from any one of the following: the first mutant with an amino acid sequence as shown in SEQ ID NO.4, the second mutant with an amino acid sequence as shown in SEQ ID NO.6, and the third mutant with an amino acid sequence as shown in SEQ ID NO.8.

[0028] The amino acid sequences of the first to third mutants mentioned above can be found in Table 2.

[0029] Table 2. Mutants and their corresponding sequence numbers

[0030] This application provides a nucleic acid molecule that contains the coding sequence of a Taq DNA polymerase mutant as described in any of the foregoing embodiments.

[0031] In some embodiments, the nucleotide sequence of the nucleic acid molecule is shown in any one of SEQ ID NO. 3, SEQ ID NO. 5, and SEQ ID NO. 7. The specific correspondence between the nucleic acid molecule and the Taq DNA polymerase mutant can be as follows: Table 3. Mutants and their corresponding sequence numbers

[0032] In this embodiment, an expression vector is provided, comprising nucleic acid molecules as described in the foregoing embodiments.

[0033] In this application embodiment, a recombinant expression transformant is provided, the recombinant expression transformant comprising the nucleic acid molecule as described in the foregoing embodiments, and / or the expression vector as described in the foregoing embodiments.

[0034] In this application embodiment, a detection product is provided, the detection product comprising the Taq DNA polymerase mutant as described in any of the foregoing embodiments.

[0035] In this application embodiment, a method for preparing a Taq DNA polymerase mutant as described in any of the foregoing embodiments is provided, comprising: Step S1: Culture host cells.

[0036] Step S2: The host cells are induced to express the Taq DNA polymerase mutant.

[0037] Step S3: The Taq DNA polymerase mutant is isolated and obtained.

[0038] In this application embodiment, the application of a Taq DNA polymerase mutant as described in any of the foregoing embodiments in nucleic acid amplification is provided.

[0039] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0040] Example 1 In this embodiment, the generation, culture induction, and lysis of a Taq DNA polymerase random mutant clonal library were performed.

[0041] Experimental methods: 1. Generation of random mutant clone libraries: (1) The nucleic acid encoding the Taq DNA polymerase gene was constructed by error-prone (mutagenic) PCR between the NdeI and XhoI restriction endonuclease sites of the commonly used pET28a plasmid.

[0042] (2) Design Taq-F and Taq-R primers containing NdeI and XhoI restriction sites of pET28a based on the wild-type Taq DNA polymerase gene sequence (SEQ ID NO.1).

[0043] Taq-F: (underlined is the NdeI restriction site), as shown in SEQ ID NO.9: TTC CATATGAGGGGGATGCTGCCCCTCT.

[0044] Taq-R: (underlined is the XhoI restriction site), as shown in SEQ ID NO.10: CGC ctcgag ctctccgccaaggagtga.

[0045] (3) Amplification: Table 4. Error-prone PCR amplification systems

[0046] Table 5. Commonly Misunderstood PCR Amplification Procedures

[0047] Configure the error-prone PCR amplification system according to Table 4, and amplify the Taq DNA polymerase gene according to the amplification program in Table 5 to form a Taq DNA polymerase gene fragment library containing random mutations. Digest the linearized plasmid vector pET28a with NdeI and XhoI enzymes.

[0048] (4) After purification and recovery of the Taq DNA polymerase gene fragment library and the enzyme-digested linearized plasmid vector pET28a, ligation was performed according to the instructions of TAKARA DNA Ligation Kit Ver.2.1, with the fragment / vector ratio of 0.03-0.3 pmol: 0.03 pmol, and incubation at 16°C for 2 h. The ligation reaction system was then transformed into Escherichia coli competent cells BL21DE3.

[0049] (5) Take 100 μL of BL21 DE3 competent cells from the -80 ℃ freezer and thaw them on ice. Add 5 μL of ligation reaction solution to each competent cell, gently pipette to mix, and let stand on ice for 30 min. Then heat shock in a 42 ℃ water bath for 90 s, immediately cool in an ice water bath, add 750 μL of LB liquid medium after 3 min, and resuscitate in a shaker at 37 ℃ for 50 min.

[0050] (6) After resuscitation, centrifuge at 4000 rpm for 2 min. Remove the supernatant, resuspend the bacteria in the remaining 100 μL of liquid, and spread it evenly on LB Kan solid plates. Incubate upside down at 37 ℃ for about 12 h. The collection of single colonies on the plate is the random mutant clone library.

[0051] 2. Culture induction and lysis of random mutant clone libraries: (1) Primary deep-well plate culture: Single colonies of random mutant clone library plates were inoculated into 96-well deep-well plates (500 μL LB medium, 50 μg / mL Kan antibiotic), and cultured overnight at 37 ℃ and 250 rpm. Three wild-type colonies were set up as controls for each 96-well deep-well plate.

[0052] (2) Secondary deep-well plate induction: 10 μL of culture medium was taken from the primary 96-well deep-well plate and transferred to the secondary 96-well deep-well plate. 500 μL of LB medium (50 μg / mL Kan antibiotic) was added and cultured at 37 ℃ and 250 rpm until the OD600 was about 0.6. A certain amount of IPTG (final concentration of 1 mM) was added to induce enzyme expression. The plateau was reached overnight at 37 ℃ and 250 rpm until the growth plateau was reached. The bacterial density of each well was made similar. Three wild-type cells were set up as controls.

[0053] (3) Cell lysis: Add 100 μL of cell lysis buffer (50 mM Tris 7.5, 0.3% lysozyme) to the cultured 96-well secondary deep plate, mix well, and then freeze at -80 ℃ for 1 h, followed by freezing at 37 ℃ for 1 h. Repeat this freeze-thaw cycle 3 times. Centrifuge at 4000 rpm for 20 min, and the supernatant is the crude enzyme solution. The activity of the crude enzyme solution is then measured.

[0054] Example 2 In this embodiment, a mutant Taq DNA polymerase with enhanced polymerase activity was identified.

[0055] Technical principles: such as Figure 1 As shown, when a primer modified with FAM fluorescence pairs with a complementary single-stranded template, under the conditions of an enzyme containing DNA polymerase activity (such as Taq DNA polymerase), the FAM fluorescently modified primer can extend to the full length of the template. Finally, in urea denaturing polyacrylamide gel electrophoresis, a longer band (FL) is displayed. The stronger the activity, the higher the FL content of the full-length band; conversely, the lower the activity or the absence of activity, the lower or absent the FL content of the full-length band.

[0056] Experimental methods: 1. Test system preparation: (1) The oligonucleotide sequence S-Temp59 dry powder was diluted to 100 μmol / L with TE according to the instructions on the synthesis sheet and stored at -20°C. When using, it was taken out from -20°C and brought to room temperature, mixed on a vortex mixer for 10 s, and centrifuged on a microcentrifuge for a few seconds.

[0057] (2) The fluorescently labeled oligonucleotide sequence S1-FAM dry powder was diluted to 100 μmol / L with TE according to the instructions on the synthesis sheet and stored at -20°C. When using, it was taken out from -20°C and brought to room temperature, mixed on a vortex mixer for 10 s, and centrifuged on a microcentrifuge for a few seconds.

[0058] (3) Take the diluted DNA template S-Temp59 and primer S1-FAM and mix them in a 1:1 ratio. Heat at 75℃ for 5 min and then cool to 25℃ at a rate of 0.1℃ / s to anneal S1-FAM onto S-Temp59 to obtain a detection template of 50 μmol / L.

[0059] The oligonucleotide sequence S-Temp59 used as the DNA template (nucleotide sequence SEQ ID NO.11: TCTATTACATTCTAAGAGTTAGAGTTAGGGTCTACTCTTGCTATGCGTGGAGT GCTGAA).

[0060] The fluorescently labeled oligonucleotide sequence S1-FAM (nucleotide sequence SEQ ID NO.12: FAM-TTCAGCACTCCACGCATAGC) was used as the primer for ssDNA.

[0061] 2. Test system reaction: (1) Preparation of polymerization reaction solution: Table 6. Preparation system for Taq DNA polymerase crude enzyme activity assay

[0062] Table 6 shows the 10×Taq DNA polymerase PCR buffer (200mM Tris-HCl, 400mM KCl, 30mM MgCl2, pH 8.3).

[0063] Prepare the polymerization reaction solution in microcentrifuge tubes according to the proportions in the table above (prepare on ice). After the polymerization reaction solution is prepared, vortex mix it for 10 seconds and centrifuge it for a few seconds.

[0064] (2) Reactions of the polymerization reaction solution: Reaction conditions: 65℃ for 1 minute.

[0065] Terminate the reaction: After the reaction is complete, add four volumes of termination buffer (99% formamide, 0.1% SDS and 20mM EDTA) to terminate the reaction.

[0066] 3. Gel migration experiment of polymerization products: (1) Prepare 12% urea denatured polyacrylamide gel.

[0067] (2) Boil the sample to terminate the reaction at 95°C for 5 minutes.

[0068] (3) Apply bromophenol blue sample buffer to the white electrophoresis wells, and load the remaining samples in sequence in 8 μL.

[0069] (4) Use 1×TBE electrophoresis solution and run the gel at 230V until the sample is close to the bottom of the gel.

[0070] (5) The primers and full-length products were photographed under ultraviolet conditions using the ChampGel 5000 imaging system (Caizhi), and the yield ratio of the full-length products was analyzed (grayscale analysis) using the matching gel imaging system.

[0071] Experimental results: Using the above method, approximately 1000 Taq DNA polymerase mutant clones were screened, and three mutant clones with enhanced activity were obtained, named MT1 (first mutant), MT2 (second mutant), and MT3 (third mutant).

[0072] refer to Figure 2 1-2 represent Primer; 3-4 represent MT1 clones; 5-6 represent MT2 clones; 7-8 represent MT3 clones; 9-10 represent wild-type Taq DNA polymerase. Figure 2 As can be seen, clones MT1, MT2, and MT3 all have higher polymerase activity than wild-type Taq DNA polymerase.

[0073] Table 7. Statistics Figure 2 Three clones with enhanced activity were screened using primer extension electrophoresis.

[0074] In Table 7, the activity enhancement factor is calculated as follows: Activity enhancement factor = average percentage of FL content in mutant clones / average percentage of FL content in wild-type clones.

[0075] Compared to wild-type Taq DNA polymerase, MT1, MT2, and MT3 showed activities increased by 2.30-fold, 2.20-fold, and 2.11-fold, respectively. DNA sequencing was performed on the MT1, MT2, and MT3 clones to determine amino acid changes based on sequence variations. The sequencing results show: (1) The amino acid mutation site of MT1 is (A391V); (2) The amino acid mutation sites of MT2 are (L98P, R175W, D191G, I232V, K292M, T385A, H676R, E742V, K767E); (3) The amino acid mutation sites of MT3 are (E9G, T26A, G59W, D142N, L351P, E471G, D488G, P548A, D551V, A608G, E687K, E708G, E742Q, L817Q). The amino acid sequences of the MT1, MT2, and MT3 mutants correspond to SEQ ID NO.4, SEQ ID NO.6, and SEQ ID NO.8, respectively.

[0076] Example 3 In this embodiment, the extension rate of the crude Taq DNA polymerase mutant in a conventional PCR amplification system was tested.

[0077] Technical principle: A 1 kb target fragment is amplified under normal PCR amplification conditions. The control group is amplified under a program with a longer extension time (60 ℃ for 60 s) to verify the reliability of the system. The experimental group is amplified with a shorter extension time to reflect the difference in amplification rate between wild type and mutant. The higher the brightness of the target fragment product, the faster the amplification rate.

[0078] Experimental methods: 1. Test system preparation: (1) The amplification performance of the Taq DNA polymerase mutant was detected using a standard PCR amplification system. The reaction system is shown in Table 8. Table 8. Configuration of PCR amplification detection system for Taq DNA polymerase

[0079] Table 8 shows the 10×Taq Buffer (100 mmol / L Tris, 400 mmol / L KCl, 30 mmol / L MgCl2, pH 8.3 (25 ℃)).

[0080] (2) Primers: The primer F sequence (SEQ ID NO.13) is: TAACACGCTCACCATGAAGC.

[0081] The primer R sequence (SEQ ID NO.14) is: CAGCAGATACGGGATATCGA.

[0082] The amplified target fragment is 1000 bp in length.

[0083] (3) Reaction conditions: The control group reaction conditions were: 95 °C for 3 min for one cycle; 95 °C for 5 s and 60 °C for 60 s for 20 cycles. The resulting amplicon was then maintained at 23 °C.

[0084] The experimental reaction conditions were as follows: 95 °C for 3 min for one cycle; 95 °C for 5 s and 60 °C for 30 / 15 / 5 s for 20 cycles. The resulting amplicon was then maintained at 23 °C.

[0085] 2. Electrophoretic verification of PCR products: After PCR amplification, the amplicon in the reaction mixture was separated by gel electrophoresis under the following conditions: the gel used was 1.2% agarose; the 1x buffer consisted of the following: 20 mM Tris-HCl, 80 mM Tris-acetate, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 3 mM Mg-acetate, 0.1% pH 8.8, at 25°C; electrophoresis was run at 150V for 20 minutes.

[0086] Experimental results: refer to Figure 3 The results of the amplification and validation of the crude Taq DNA polymerase mutant in the PCR system are shown. Here, M / bp represents DL2000 DNA Marker; Taq DNA polymerase represents wild-type Taq DNA polymerase; MT1 represents MT1 mutant; MT2 represents MT2 mutant; MT3 represents MT3 mutant; and N represents negative control. Extensions of 60 s, 30 s, 15 s, and 5 s represent the extension times during the PCR amplification phase.

[0087] (1) Electrophoresis results of PCR products in the control group (60 ℃ for 60 s) showed that wild-type Taq DNA polymerase and MT1, MT2 and MT3 all amplified the target fragment, indicating that the amplification system was reliable.

[0088] (2) Electrophoresis results of PCR products in the experimental group (60 ℃ for 30 s) showed that MT1, MT2 and MT3 amplified the target fragments, and the brightness of the target fragments amplified by wild-type Taq DNA polymerase was significantly lower than that of the control group.

[0089] (3) The electrophoresis results of the PCR products of the experimental group (60 ℃ for 15 and 5 s) showed that MT1, MT2 and MT3 amplified the target fragment, while wild-type Taq DNA polymerase did not amplify the target fragment, indicating that the amplification speed of mutant MT1, MT2 and MT3 was significantly better than that of wild-type Taq DNA polymerase, and the amplification speed was not less than 5 s / kb.

[0090] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Taq DNA polymerase mutant, characterized in that, The Taq DNA polymerase mutants exhibited mutations at the L98P, R175W, D191G, I232V, K292M, T385A, H676R, E742V, and K767E sites.

2. The Taq DNA polymerase mutant as described in claim 1, characterized in that, The amino acid sequence of the Taq DNA polymerase mutant is shown in SEQ ID NO.

6.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule contains the coding sequence of the Taq DNA polymerase mutant as described in claim 1 or 2.

4. The nucleic acid molecule as described in claim 3, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

5.

5. An expression carrier, characterized in that, It includes the nucleic acid molecule as described in claim 3.

6. A recombinant expression transformant, characterized in that, The recombinant expression transformant comprises the nucleic acid molecule as described in claim 3, or the expression vector as described in claim 5.

7. A testing product, characterized in that, The test product contains the Taq DNA polymerase mutant as described in claim 1 or 2.

8. A method for preparing a Taq DNA polymerase mutant as described in claim 1 or 2, characterized in that, include: Culture host cells; The host cells are induced to express the Taq DNA polymerase mutant. The Taq DNA polymerase mutant was isolated and obtained.

9. The application of a Taq DNA polymerase mutant as described in claim 1 or 2 in nucleic acid amplification.