Alkaline protease mutants
By mutating a specific amino acid sequence of the alkaline protease AprE from Bacillus clausti, a thermostable alkaline protease mutant was constructed, which solved the problems of insufficient enzyme activity and stability in the existing technology, improved the enzyme's heat resistance and thermal stability, and promoted its application in the detergent industry.
Patent Information
- Application Number
- CN202511927476.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-27
- Publication Date
- 2026-02-24
AI Technical Summary
The existing alkaline protease production strains and fermentation processes lack updates, resulting in output and cost that cannot compete with international companies, making it difficult to enter the detergent alkaline protease market. Furthermore, the enzyme activity and stability of commonly used production strains are insufficient.
Thermoresistant alkaline protease mutants were constructed by making specific mutations in the amino acid sequence of wild-type alkaline protease AprE from Bacillus clausti, especially substitutions at positions 30, 77, 101, 127, 138, 183, 197, 219, 226, and 232, and expressed in Bacillus subtilis or Bacillus licheniformis.
The enzyme's heat resistance and thermal stability were improved, and the residual enzyme activity was significantly increased under high temperature conditions, making it suitable for the detergent industry and enhancing its application potential in this field.
Abstract
Description
Technical Field
[0001] This invention relates to the field of protein engineering technology, and more specifically to an alkaline protease mutant. Background Technology
[0002] Alkaline proteases are enzymes that can hydrolyze protein peptide bonds under alkaline conditions, with an optimal pH range of 9-11. Alkaline proteases are the most important class of proteases, functioning effectively in extremely alkaline environments and widely used in the food, textile, pharmaceutical, and detergent industries. Annual production of alkaline proteases accounts for 50% of global enzyme production, with over two-thirds used in the detergent industry. The alkaline proteases in detergents are almost exclusively serine proteases produced by natural Bacillus microorganisms and their variants, possessing properties such as alkali resistance, surfactant resistance, and broad selectivity in peptide bond hydrolysis. Alkaline proteases can hydrolyze various protein-based stains, such as blood, sweat, and milk stains, and can release stains that are encapsulated by proteins or have enhanced adhesion to substrates due to proteins, exhibiting excellent synergistic detergency with surfactants.
[0003] Currently, the main Bacillus species that produce alkaline proteases and the subjects of research include: Bacillus subtilis ( Bacillus subtilis ), Bacillus licheniformis ( Bacillus licheniformis ), Bacillus pumilus ( Bacillus pumilus ), Bacillus amyloliquefaciens ( Bacillus amyloliqueaciens ), alkalophilic Bacillus ( Bacillus alcalophilus ) and Bacillus clausti ( Bacillus clausii (Liu Yihan et al., 2008) etc. my country's alkaline protease industry is maturing, but the commonly used production strains and fermentation processes lack updates, resulting in output and costs that cannot compete with international giants (Yuan Yuan et al., 2021). Currently, most domestic enzyme preparation companies produce alkaline protease using strain 2709, with a fermentation level of approximately 50,000 U / mL. This is mainly used for hydrolyzing animal and plant proteins in food raw materials and for dehairing leather. The market is small (less than 10 million RMB) and has low profits, making it difficult to enter the alkaline protease market for detergents.
[0004] In the past few decades, protein engineering has become an important technical means to improve the activity and performance of alkaline proteases. Protein modification techniques can effectively enhance the catalytic activity, acid-base stability, thermal stability, substrate specificity, and expression titer of enzymes. An increasing number of commercially available alkaline proteases are protein-engineered mutants of wild-type proteases. Therefore, the protein engineering modification and screening of high-activity, high-stability, and high-titer alkaline proteases, as well as the construction of high-yield engineered bacteria, have become research hotspots both domestically and internationally. Protein engineering technology has opened up new avenues for improving enzyme performance and expanding its application fields. Summary of the Invention
[0005] The purpose of this invention is to provide a thermoresistant alkaline protease mutant. Compared with the wild type, the mutant exhibits significantly improved heat resistance, which is beneficial for the widespread application of this enzyme in industrial fields.
[0006] This invention is achieved through the following technical solution: The present invention relates to an alkaline protease mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising, compared with SEQ ID NO:1, an amino acid substitution at at least one position selected from the group consisting of: 30, 77, 101, 127, 138, 183, 197, 219, 226, 232.
[0007] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.
[0008] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.
[0009] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: V30M / I, I77L / V, S101G, P127M, N138Q / K, F183K / D, V197I / L, P219F / E, A226S / T, N232D.
[0010] In some embodiments of the present invention, the mutant comprises substitutions or combinations of substitutions selected from the following substitutions and combinations of substitutions: V30I; V30I / I77V; V30I / S101G; V30I / N138K; V30IV197L; V30I / P219E; V30I / A226T; V30I / N232D; V30I / I77V / S101G; V30I / I77V / N138K; V30I / I77V / F183D; V30I / I77V / V197L / ; V30I / I77V / P219E; V30I / I77V / A226T; V30I / I77V / A226T / N232D; V30I / I77V / S101G / N138K; V30I / I77V / S101G / F183D; V30I / I77V / S101G / V197L; V30I / I77V / S101G / P219E; V30I / I77V / S101G / A226T; V30I / I77V / S101G / N232D; V30I / S101G / N138K / F183D; V30I / S101G / N138K / V197L; V30I / S101G / N138K / P219E; V30I / S101G / N138K / A226T; V30I / S101G / N138K / N232D; V30I / / N138K / F183D / V197L; V30I / N138K / F183D / P219E; V30I / N138K / F183D / A226T; V30I / / F183D / V197L / P219E; V30I / F183D / V197L / A226T; V30I / F183D / V197L / N232D; V30I / I77V / S101G / N138K / F183D; V30I / I77V / S101G / N138K / V197L; V30I / I77V / S101G / N138K / P219E; V30I / I77V / S101G / N138K / A226T; V30I / S101G / N138K / F183D / V197L; V30I / S101G / N138K / F183D / P219E; V30I / S101G / N138K / F183D / A226T; V30I / N138K / F183D / V197L / P219E; V30IN138K / F183D / V197L / A226T; V30I / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L; V30I / I77V / S101G / N138K / F183D / P219E; V30I / I77V / S101G / N138K / F183D / A226T; V30I / I77V / S101G / V197L / P219E / A226T; V30I / I77V / S101G / N138K / P219E / A226T; V30I / S101G / F183D / V197L / P219E / A226T; V30I / S101G / N138K / V197L / P219E / A226T; V30I / S101G / N138K / F183D / P219E / A226T; V30I / S101G / N138K / F183D / V197L / A226T; V30I / S101G / N138K / F183D / V197L / A226T; V30I / N138K / F183D / V197L / P219E / A226T; V30I / N138K / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / P219E; V30I / I77V / S101G / N138K / F183D / V197L / A226T; V30I / I77V / S101G / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / A226T; V30I / I77V / S101G / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / V197L / P219E / A226T; V30I / I77V / N138K / F183D / V197L / P219E / A226T; V30I / S101G / N138K / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / P219E / N232D; V30I / I77V / S101G / N138K / F183D / V197L / A226T / N232D; V30I / I77V / S101G / F183D / V197L / P219E / A226T / N232D; V30I / I77V / S101G / N138K / V197L / P219E / A226T / N232D; V30I / I77V / S101G / N138K / F183D / / P219E / A226T / N232D; V30I / I77V / S101G / N138K / F183D / V197L / A226T / N232D; V30I / I77V / S101G / F183D / V197L / P219E / A226T / N232D; V30I / I77V / S101G / N138K / V197L / P219E / A226T / N232D; V30I / I77V / N138K / F183D / V197L / P219E / A226T / N232D; V30I / S101G / N138K / F183D / V197L / P219E / A226T / N232D; V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226T / N232D; V30I / I77V / S101G / P127M / F183D / V197L / P219E / A226T / N232D; V30I / I77V / S101G / P127M / N138K / V197L / P219E / A226T / N232D; V30I / I77V / P127M / N138K / F183D / V197L / P219E / A226T / N232D; V30I / S101G / P127M / N138K / F183D / V197L / P219E / A226T / N232D; V30I / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226T; V30I / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226T / N232D; V30I / I77V / S101G / P127M / N138Q / F183D / V197L / P219E / A226T / N232D; V30I / I77V / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D; V30I / I77V / S101G / P127M / N138K / F183D / V197I / P219E / A226T / N232D; V30I / I77V / S101G / P127M / N138K / F183D / V197L / P219F / A226T / N232D; V30I / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226S / N232D; V30I / I77L / S101G / P127M / N138K / F183D / V197L / P219E / A226T / N232D; V30I / I77L / S101G / P127M / N138Q / F183D / V197L / P219E / A226T / N232D; V30I / I77L / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D; V30I / I77L / S101G / P127M / N138K / F183D / V197I / P219E / A226T / N232D; V30I / I77L / S101G / P127M / N138K / F183D / V197L / P219F / A226T / N232D; V30I / I77L / S101G / P127M / N138K / F183D / V197L / P219E / A226S / N232D; I77V; I77V / S101G; I77V / N138K; I77V / F183D; I77V / V197L; I77V / P219E; I77V / A226T; I77V / S101G / N138K; I77V / S101G / F183D; I77V / S101G / V197L; I77V / S101G / P219E; I77V / S101G / A226T; I77V / N138K / F183D; I77V / N138K / V197L; I77V / N138K / P219E; I77V / N138K / A226T; I77V / 183D / V197L; I77V / P219E / A226T; I77V / S101G / N138K / F183D; I77V / S101G / P219E / A226T; I77V / S101G / N138K / A226T; I77V / N138K / V197L / P219E; I77V / N138K / F183D / A226T; I77V / N138K / V197L / A226T; I77V / F183D / V197L / P219E; I77V / F183D / V197L / A226T; I77V / F183D / P219E / A226T; I77V / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L; I77V / S101G / N138K / F183D / P219E; I77V / S101G / N138K / F183D / A226T; I77V / N138K / F183D / V197L / P219E; I77V / N138K / F183D / V197L / A226T; I77V / N138K / V197L / P219E / A226T; I77V / N138K / F183D / P219E / A226T; I77V / F183D / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L / P219E; I77V / S101G / N138K / F183D / V197L / A226T; I77V / S101G / F183D / V197L / P219E / A226T; I77V / S101G / N138K / V197L / P219E / A226T; I77V / N138K / F183D / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L / P219E / A226T; N138K; N138K / F183D; N138K / V197L; N138K / P219E; N138K / A226T; N138K / F183D / V197L / P219E; N138K / F183D / V197L / A226T; N138K / V197L / P219E / A226T; N138K / F183D / V197L / P219E / A226T; F183D; F183D / V197L; F183D / P219E; F183D / A226T; F183D / V197L / P219E; F183D / V197L / A226T; F183D / P219E / A226T; F183D / V197L / P219E / A226T; V197L; V197L / P219E; V197L / A226T; V197L / P219E / A226T; P219E; P219E / A226T; A226T; V30M; V30M / I77L; V30M / P127M; V30M / N138Q; V30M / F183K; V30M / V197I; V30M / P219F; V30M / A226S; V30M / N232D; V30M / I77L / P127M; V30M / I77L / N138Q; V30M / I77L / F183K; V30M / I77L / V197I; V30M / I77L / P219F; V30M / I77L / A226S; V30M / I77L / N232D; V30M / P127M / N138Q; V30M / P127M / F183K; V30M / P127M / V197I; V30M / P127M / P219F; V30M / P127M / A226S; V30M / N138Q / F183K; V30M / N138Q / V197I; V30M / N138Q / P219F; V30M / N138Q / N232D; V30M / V197I / P219F; V30M / V197I / A226S; V30M / V197I / N232D; V30M / P219F / A226S; V30M / P219F / N232D; V30M / I77L / P127M / A226S; V30M / I77L / P127M / N232D; V30M / I77L / F183K / V197I; V30M / I77L / P219F / A226S / ; V30MP127M / N138Q / F183K; V30M / P127M / N138Q / V197I; V30M / P127M / N138Q / A226S; V30M / P127M / N138Q / N232D; V30M / N138Q / F183K / V197I; V30M / N138Q / F183K / P219F; V30M / N138Q / F183K / A226S; V30M / F183K / V197I / P219F; V30M / F183K / V197I / A226S; V30M / F183K / V197I / N232D; V30MV197I / P219F / A226S; V30M / V197I / P219F / N232D; V30M / P219F / A226S / N232D; V30M / I77L / P127M / N138Q / F183K; V30M / I77L / P127M / N138Q / V197I; V30M / I77L / P127M / N138Q / P219F; V30M / I77L / P127M / N138Q / A226S; V30M / P127M / N138Q / F183K / V197I; V30M / P127M / N138Q / F183K / P219F; V30M / P127M / N138Q / F183K / A226S; V30M / P127M / N138Q / F183K / N232D; V30M / N138Q / F183K / V197I / P219F; V30M / N138Q / F183K / A226S / N232D; V30M / F183K / V197I / P219F / A226S; V30M / F183K / V197I / P219F / N232D; V30M / V197I / P219F / A226S / N232D; V30M / I77LV197I / P219F / A226S / N232D; V30M / P127M / N138Q / F183K / V197I / P219F; V30M / P127M / N138Q / F183K / P219F / A226S; V30M / N138Q / F183K / V197I / P219F / A226S; V30M / N138Q / F183K / V197I / P219F / N232D; V30M / N138Q / F183K / P219F / A226S / N232D; V30M / N138Q / V197I / P219F / A226S / N232D; V30M / N138Q / V197I / P219F / A226S / N232D; V30M / F183K / V197I / P219F / A226S / N232D; V30M / I77L / P127M / N138Q / F183K / V197I / P219F; V30M / I77L / F183K / V197I / P219F / A226S / N232D; V30M / I77L / P127M / F183K / P219F / A226S / N232D; V30M / P127M / F183K / V197I / P219F / A226S / N232D; V30M / P127M / N138Q / F183K / V197I / P219F / A226S; V30M / N138Q / F183K / V197I / P219F / A226S / N232D; V30M / I77L / N138Q / F183K / V197I / P219F / A226S / N232D V30M / I77L / P127M / F183K / V197I / P219F / A226S / N232D V30M / I77L / P127M / N138Q / F183K / P219F / A226S / N232D V30M / I77L / P127M / N138Q / F183K / V197I / A226S / N232D V30M / I77L / P127M / N138Q / F183K / V197I / P219F / N232D V30M / I77L / P127M / N138Q / F183K / V197I / P219F / A226S; V30M / I77L / P127M / N138Q / F183K / V197I / P219F / N232D; V30M / I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D; V30M / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226T / N232D; V30M / I77V / S101G / P127M / N138Q / F183D / V197L / P219E / A226T / N232D; V30M / I77V / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D; V30M / I77V / S101G / P127M / N138K / F183D / V197I / P219E / A226T / N232D; V30M / I77V / S101G / P127M / N138K / F183D / V197L / P219F / A226T / N232D; V30M / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226S / N232D; V30M / I77L / S101G / P127M / N138K / F183D / V197L / P219E / A226T / N232D; V30M / I77L / S101G / P127M / N138Q / F183D / V197L / P219E / A226T / N232D; V30M / I77L / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D; V30M / I77L / S101G / P127M / N138K / F183D / V197I / P219E / A226T / N232D; V30M / I77L / S101G / P127M / N138K / F183D / V197L / P219F / A226T / N232D; V30M / I77L / S101G / P127M / N138K / F183D / V197L / P219E / A226S / N232D; I77L; I77L / P127M; I77L / N138Q; I77L / F183K; I77L / V197I; I77L / P219F; I77L / A226S; I77L / N232D; I77L / P127M / N138Q; I77L / P127M / F183K; I77L / P127M / V197I; I77L / N138Q / V197I; I77L / F183K / P219F; I77L / V197I / P219F; I77L / P219F / A226S; I77L / P219F / N232D; I77L / A226S / N232D; I77L / P127M / N138Q / F183K; I77L / F183K / V197I / P219F; I77L / V197I / P219F / A226S; V30M / P219F / A226S / N232D; I77L / P127M / N138Q / F183K / V197I; I77L / N138Q / F183K / V197I / P219F; I77L / F183K / V197I / P219F / A226S; I77L / V197I / P219F / A226S / N232D; I77L / P127M / N138Q / F183K / V197I / P219F; I77L / N138Q / F183K / V197I / P219F / N232D; I77L / F183K / V197I / P219F / A226S / N232D; I77L / P127M / N138Q / F183K / V197I / P219F / A226S; I77L / P127M / N138Q / F183K / V197I / P219F / N232D; I77L / P127M / N138Q / V197I / P219F / A226S / N232D; I77L / P127M / N138Q / F183K / V197I / A226S / N232D; I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D; P127M; P127M / N138Q; P127M / F183K; P127M / V197I; P127M / P219F; P127M / A226S; P127M / N232D; P127M / N138Q / F183K; P127M / F183K / V197I; P127M / V197I / P219F; P127M / V197I / A226S; P127M / V197I / N232D; P127M / / P219F / A226S; P127M / P219F / N232D; P127M / N138Q / F183K / V197I; P127M / F183K / V197I / P219F; P127M / V197I / P219F / A226S; P127M / P219F / A226S / N232D; P127M / N138Q / F183K / V197I / P219F; P127M / / F183K / V197I / P219F / A226S; P127M / V197I / P219F / A226S / N232D; P127M / N138Q / F183K / V197I / P219F / A226S; P127M / N138Q / F183K / V197I / P219F / N232D; P127M / F183K / V197I / P219F / A226S / N232D; P127M / N138Q / F183K / V197I / P219F / A226S / N232D; N138Q; N138Q / F183K; N138Q / V197I; N138Q / P219F; N138Q / A226S; N138Q / N232D; N138Q / F183K / V197I; N138Q / V197I / P219F; N138Q / P219F / A226S; N138Q / P219F / N232D; N138Q / A226S / N232D; N138Q / F183K / V197I / P219F; N138Q / V197I / P219F / A226S; N138Q / P219F / A226S / N232D; N138Q / F183K / V197I / P219F / A226S; N138Q / F183K / V197I / P219F / N232D; N138Q / V197I / P219F / A226S / N232D; N138Q / F183K / V197I / P219F / A226S / N232D; F183K; F183K / V197I; F183K / P219F; F183K / A226S; F183K / N232D; F183K / V197I / P219F; F183K / P219F / A226S; F183K / A226S / N232D; F183K / V197I / P219F / A226S; F183K / V197I / P219F / N232D; F183K / V197I / A226S / N232D; F183K / P219F / A226S / N232D; F183K / V197I / P219F / A226S / N232D; V197I; V197I / P219F; V197I / A226S; V197I / N232D; V197I / P219F / A226S; V197I / P219F / N232D; V197I / A226S / N232D; V197I / P219F / A226S / N232D; P219F; P219F / A226S; P219F / N232D; P219F / A226S / N232D; A226S; A226S / N232D; N232D.
[0011] The present invention also provides a gene encoding the above-mentioned alkaline protease mutant, the nucleotide sequence of which is SEQ ID NO:2.
[0012] The present invention also provides a recombinant expression vector containing the above-mentioned alkaline protease mutant gene.
[0013] The present invention also provides a host cell comprising the above-described recombinant expression vector.
[0014] The host cell is Bacillus subtilis (B. subtilis) Bacillus subtilis ) or Bacillus licheniformis ( Bacillus licheniformis ).
[0015] This invention provides single-point mutants based on the wild-type alkaline protease AprE of Bacillus claurifolium, containing any one of the mutation sites V30M / I, I77L / V, S101G, P127M, N138Q / K, F183K / D, V197I / L, P219F / E, A226S / T, and N232D. Compared with the wild type, the single-point mutants, after treatment at 80℃ for 5 min, generally showed a 7.6%-38.6% increase in relative enzyme activity residual rate, indicating a significant improvement in heat resistance; after treatment at 60℃ for 2 h, their relative enzyme activity residual rate generally increased by 5.6%-24.5%, indicating a significant enhancement in thermal stability. Furthermore, the heat resistance of the alkaline protease mutants containing two or more mutation sites provided by this invention has been further improved. After treatment at 80°C for 5 minutes, the relative enzyme activity residual rate is generally increased by 10.2%-34.5% compared with the corresponding single-site mutant; after treatment at 60°C for 2 hours, the relative enzyme activity residual rate is generally increased by 11.7%-25.4%, achieving unexpected technical effects and promoting its widespread application in the detergent industry. Detailed Implementation
[0016] This invention relates to a thermostable alkaline protease mutant, its preparation method and application, the DNA molecule encoding the alkaline protease mutant, the vector, and the host cell.
[0017] Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. The methods and applications of this invention have been described through preferred embodiments. It is evident that those skilled in the art can modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0018] The method of the present invention will be further illustrated below with reference to examples. Experimental methods not specified in the examples can be performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master the present invention with the help of these examples. However, the methods for implementing the present invention should not be limited to the specific method steps described in the embodiments of the present invention.
[0019] The culture medium formulation involved in the embodiments of the present invention is as follows: LB liquid medium: 1% tryptone, 0.5% yeast extract, 0.5% NaCl; LB agar: 1% tryptone, 0.5% yeast extract, 0.5% NaCl, 2% agar; Skim milk agar plates: 1% tryptone, 0.5% yeast, 0.5% NaCl, 1% skim milk, 1.5% agar; The preparation method for GM I is as follows: 95.6 ml of 1* minimum salt solution, 2.5 ml of 20% glucose, 0.4 ml of 5% hydrolyzed casein, and 1 ml of 10% yeast extract; wherein the preparation method for the 1* minimum salt solution is as follows: 14 g / L K2HPO4, 6 g / L KH2PO4, 2 g / L (NH4)2SO4, 1 g / L trisodium citrate, and 0.2 g / L MgSO4•7H2O are dissolved in distilled water in sequence; The preparation method for GM II is as follows: 96.98 ml of 1* minimum salt solution, 2.5 ml of 20% glucose, 0.08 ml of 5% hydrolyzed casein, 0.04 ml of 10% yeast extract, 0.25 ml of 1 M MgCl2, and 0.05 ml of 1 M CaCl2. Seed culture medium: yeast extract 0.5%, tryptone 0.5%, NaCl 0.5%; Fermentation medium: 1% glucose, 0.2% disodium hydrogen phosphate, 1% peptone, 1% sodium chloride, and 0.5% yeast extract.
[0020] The method for determining the enzyme activity of alkaline protease in this embodiment of the invention is as follows: 1. Principle Under specific temperature and pH conditions, proteases hydrolyze casein substrates to produce amino acids containing phenolic groups (such as tyrosine and tryptophan). Under alkaline conditions, Folin reagent is reduced to produce molybdenum blue and tungsten blue. The absorbance of the solution is measured at a wavelength of 680 nm using a spectrophotometer. Enzyme activity is directly proportional to absorbance, thus allowing the calculation of the product's enzyme activity.
[0021] 2. Definition of enzyme activity The definition of protease activity, expressed in units, is as follows: 1 g of solid enzyme powder (or 1 ml of liquid enzyme) hydrolyzes casein to produce 1 μg of tyrosine in 1 minute under certain temperature and pH conditions, which is 1 unit of enzyme activity, expressed as u / g (u / ml).
[0022] 3. Reagents and solutions (1) Folin reagent (Folin:water = 1:2); (2) 42.4 g / L sodium carbonate solution; (3) 0.5 mol / L sodium hydroxide solution; (4) borate buffer (pH 10.5); (5) 10.0 g / L casein solution; (6) 100 g / mL and 1 mg / mL L-tyrosine standard solutions; (7) 6.54% trichloroacetic acid.
[0023] 4. Measurement Method (1) Preparation of standard curve: Prepare L-tyrosine standard solutions with concentrations of 0 g / mL, 10 g / mL, 20 g / mL, 30 g / mL, 40 g / mL and 50 g / mL. Take 1.00 mL of each standard solution, add 5.00 mL of 0.4 mol / L sodium carbonate solution and 1.00 mL of Folin reagent working solution, shake well, and place in a 40℃ water bath for color development for 20 min. Remove and use a spectrophotometer at a wavelength of 680 nm with a 10 mm cuvette, using a tyrosine-free tube (C) as a blank, to measure the absorbance of each. Plot the standard curve with absorbance A as the ordinate and the concentration of tyrosine C as the abscissa (this line should pass through the zero point).
[0024] (2) Enzyme activity assay Take a pre-diluted amount of enzyme solution, then add an equal volume of 10% casein preheated at 40℃, and react at 40℃ for 10 min. Then add an equal volume of trichloroacetic acid (6.54% concentration) to the reaction system, mix well, and let stand at room temperature for 10 min to terminate the reaction. Take 1 ml of the terminated reaction solution, then add 5 ml of 42.4 g / L sodium carbonate solution, followed by 1 ml of Folin reagent, and perform a colorimetric reaction at 40℃ for 20 min. Finally, measure the OD608 value.
[0025] (3) Calculation Read the enzyme activity of the final diluted sample from the standard curve, in units of u / mL. The enzyme activity of the sample is calculated using the following formula: X = (A × K × 4 × n) / 10.
[0026] Where: X — enzyme activity of the sample (u / g or u / ml); A—The average absorbance of the sample in parallel tests; K—absorption constant; 4 — Total volume of reaction reagents (ml); 10 — Reaction time 10 min, calculated as 1 min; n – dilution factor.
[0027] The present invention will be further described below with reference to specific embodiments.
[0028] Example 1 Construction of alkaline protease mutant Bacillus claurinus ( Bacillus clausii alkaline protease gene aprE The lead peptide and mature peptide were optimized based on Bacillus codon preferences, and the optimized nucleotide sequence was synthesized by Beijing Liuhe BGI Genomics Co., Ltd. The protease gene was named... aprE Its amino acid sequence is SEQ ID NO:1, and its encoding nucleotide sequence is SEQ ID NO:2.
[0029] by aprE Using gene (SEQ ID NO:2) as a template, PCR amplification was performed using the above primers and the GeneMorph II random mutagenesis PCR kit. The PCR primers and reaction conditions are as follows: aprE-F: gcactgctggcaggaggcgcaactcaagcttttgccgctgaagaagcaaaagaaaaata; aprE-Rv: ggaaacagctatgaccatgattacgccaagctttagcgtgttgccgcttctgcattg.
[0030] PCR conditions were: 98℃ for 2 min; 98℃ for 10 s; 58℃ for 20 s, 72℃ for 45 s, 30 cycles; 72℃ for 5 min. PCR amplification products were recovered using a gel extraction kit, digested with HindIII, and ligated into the HindIII-treated vector pX131. The digestion conditions for expression vector pX131 were as follows: pX131 20 μL, 10× Buffer 5 μL. HindIII 2.5uL, ddH2O 22.5ul, total volume 50ul.
[0031] Enzyme digestion was performed in a 37℃ water bath for 2 hours. After electrophoresis, the target fragments were recovered and dissolved in 20 μL ddH2O.
[0032] Using the NEB Gbison assembly kit, in a 20 μL reaction system, genes aprE The molar ratio of fragment to carrier pX131 was 1:3, and the reaction was carried out at 50℃ for 60 min.
[0033] Example 2 Screening of thermostable alkaline protease mutants The above 20 μL assembly reaction solution was transformed into Bacillus subtilis 1A751 host cells using the competent cell method. The specific transformation process is as follows: Freshly activated Bacillus subtilis 1A751 was inoculated into 5 ml GMI solution on an LB plate and cultured overnight at 30°C and 125 rpm with shaking. The next day, 1 ml of the culture solution was transferred to 9 ml of GMI and cultured at 37°C and 220 rpm for 3.5 h. Then, 1 ml of the culture solution from the previous step was transferred to 9 ml of GMII solution and cultured at 37°C and 125 rpm for 90 min. The cells were then collected by centrifugation at 5000 g for 10 min. The cells were gently resuspended in 1 ml of GMII solution. The resuspended cells are the competent cells. Then, take 0.2 ml of competent cells, add 20 uL of assembly reaction solution, and culture at 37℃ and 200 rpm for 60 min with shaking. Spread the mixture onto a skim milk plate containing 30 μg / mL kanamycin and culture at 37℃ overnight. The next day, check the transformants and the size of the corresponding clear zone, using wild-type alkaline protease aprE as a control.
[0034] Transformants with large clear zones were picked from transformation plates and purified by streaking on skim milk plates containing 30 μg / mL kanamycin to obtain single colonies. Each colony was individually inoculated into a 96-well plate using a toothpick, with 200 μL of LB solution added to each well. The plates were incubated at 37°C and 500 rpm for approximately 48 hours with shaking. The bacterial cells were centrifuged to obtain the supernatant, and the alkaline protease activity in the supernatant was measured. The fermentation supernatant in the wells was then treated at 80°C for 5 minutes, and the residual enzyme activity was measured. Different mutants retained different activities after high-temperature treatment. Finally, the applicant screened from over 10,000 transformants for mutations that significantly improved the thermostability of the alkaline protease: V30M / I, I77L / V, S101G, P127M, N138Q / K, F183K / D, V197I / L, P219F / E, A226S / T, and N232D.
[0035] Based on the wild-type alkaline protease aprE, this invention provides a single-point mutant including any one of the mutation sites among V30M / I, I77L / V, S101G, P127M, N138Q / K, F183K / D, V197I / L, P219F / E, A226S / T, and N232D.
[0036] This invention also provides mutants comprising combinations of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 mutation sites selected from V30M / I, I77L / V, S101G, P127M, N138Q / K, F183K / D, V197I / L, P219F / E, A226S / T, and N232D. For example: V30I / I77V, V30I / S101G, V30M / N138Q, I77V / S101G, I77L / N232D, N138K / F183D, N138K / V197L、N138Q / P219F、F183D / V197L、F183K / A226S、V197L / P219E、V197I / N232D、P219E / A226T, A226S / N232D two-point mutants; V30I / I77V / S101G, V30M / P127M / N138Q, I77V / S101G / N138K, I77L / N138Q / V197I, I77L / N138Q / V197I, V197L / P219E / A226T, P219F / A226S / N232D Three-point mutants: V30I / I77V / S101G / N138K, V30I / F183D / V197L / A226T, V30M / I77L / P219F / A226S, I77V / N138K / V197L / P219E, I77V / V197L / P219E / A226T, I77L / F183K / V197I / P219F, The four-point mutants are P127M / V197I / P219F / A226S, N138K / F183D / V197L / P219, F183D / V197L / P219E / A226T, and V197I / P219F / A226S / N232D; V30I / I77V / S101G / N138K / F183D, and V30M / P127M / N Five-point mutants: 138Q / F183K / V197I, I77V / S101G / N138K / F183D / V197L, I77L / V197I / P219F / A226S / N232D, P127M / / F183K / V197I / P219F / A226S, N138K / F183D / V197L / P219E / A226T;V30I / I77V / S101G / N138K / F183D / V197L, V30M / N138Q / F183K / V197I / P219F / N2 32D, I77V / S101G / N138K / F183D / V197L / P219E, P127M / F183K / V197I / P219F / A2 26S / N232D, six-point mutant; V30I / I77V / S101G / N138K / F183D / V197L / P219E, V30M / N138Q / F183K / V197I / P219F / A226S / N232D, I77V / S101G / N138K / F183D / V197L / P219 E / A226T, I77L / P127M / N138Q / F183K / V197I / A226S / N232D, P127M / N138Q / F183K / V197I / P219F / A226S / N232D seven-point mutants and V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226T, V30M / I77L / P127M / N138Q / F183K / V197I / P219F / N232D, I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D eight-point mutant; V30I / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226T, V30I / I77V / S101G / P127M / F183D / V197L / P219E / A226T / N232D, V30M / I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D nine-point mutant; V30M / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226T / N232D, V30M / I77L / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D ten-point mutant.
[0037] Example 3: Heat resistance analysis of alkaline protease mutants The recombinant Bacillus subtilis strains expressing wild-type alkaline protease AprE or its mutants, constructed in Example 2, were inoculated into fermentation medium (0.5% yeast extract, 0.5% tryptone, 1% glucose, 1.8% K₂HPO₄) and fermented in shake flasks for 48 h. After centrifugation at 5000 rpm for 10 min, the supernatants were collected, and the alkaline protease activity in the supernatants was measured. The supernatants were then treated at 80℃ for 5 min, and the residual enzyme activity was measured. The residual enzyme activity of alkaline protease after high-temperature treatment was calculated as 100% of the original enzyme activity before treatment.
[0038] Then, the relative enzyme activity residual rate of the mutant was calculated with the enzyme activity residual rate of wild-type alkaline protease AprE as 100%. The specific results are shown in Table 1.
[0039] Relative enzyme activity residual rate (%) = enzyme activity residual rate of mutant / enzyme activity residual rate of wild type × 100%.
[0040] Table 1. Comparison of heat resistance of alkaline protease mutants alkaline protease mutant Relative enzyme activity residual rate after treatment at 80℃ for 5 min Wild-type AprE 100% V30I 109.4% V30M 107.2% I77V 108.0% I77L 114.5% S101G 115.8% P127M 126.2% N138K 107.6% N138Q 129.4% F183D 112.6% F183K 116.4% V197L 117.6% V197I 118.0% P219W 116.2% P219F 110.5% A226T 110.1% A226S 113.8% N232D 138.6% As can be seen from the data in Table 1, compared with the wild-type alkaline protease AprE, the alkaline protease mutants provided by this invention, which contain single mutation sites of V30M, V30I, I77L, I77V, S101G, P127M, N138Q, N138K, F183K, F183D, V197I, V197L, P219F, P219E, A226S, A226T, and N232D, respectively, showed a general increase in enzyme activity residual rate of 7.6%-38.6% after treatment at 80℃ for 5 min, and the heat resistance was significantly improved.
[0041] Furthermore, the present invention provides V30I / I77V, V30I / S101G, V30M / N138Q, I77V / S101G, I77L / N232D, N138K / F183D, N138K / V197L, N138Q / P219F, F183D / V197L, F183K / A226S, V197L / P219E, and V197I / N232D. Two-point mutants: P219E / A226T and A226S / N232D; V30I / I77V / S101G, V30M / P127M / N138Q, I77V / S101G / N138K, I77L / N138Q / V197I, I77L / N138Q / V197I, V197L / P219E / A226T, P219F / A226S / N232D Three-point mutants: V30I / I77V / S101G / N138K, V30I / F183D / V197L / A226T, V30M / I77L / P219F / A226S, I77V / N138K / V197L / P219E, I77V / V197L / P219E / A226T, I77L / F183K / V197I / P219F, The four-point mutants are P127M / V197I / P219F / A226S, N138K / F183D / V197L / P219, F183D / V197L / P219E / A226T, and V197I / P219F / A226S / N232D; and V30I / I77V / S101G / N138K / F183D, V30M / P127M / N138Q / F183K / V197I, I77V / S101G / N138K / F183D / V197L, and I77L / V197I / P219F / A226S / N232. D, P127M / / F183K / V197I / P219F / A226S, N138K / F183D / V197L / P219E / A226T five-point mutants; V30I / I77V / S101G / N138K / F183D / V197L, V30M / N138Q / F183K / V197I / P219F / N232D, I77V / S101G / N138K / F183D / V197L / P219E, P127M / F183K / V197I / P219F / A226S / N232D, six-point mutants;V30I / I77V / S101G / N138K / F183D / V197L / P219E, V30M / N138Q / F183K / V197I / P219F / A226S / N232D, I77V / S101G / N 138K / F183D / V197L / P219E / A226T, I77L / P127M / N138Q / F183K / V197I / A226S / N232D, P127M / N138Q / F183K / V197I / The seven-point mutant P219F / A226S / N232D and the eight-point mutant V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226T, V30M / I77L / P127M / N138Q / F183K / V197I / P219F / N232D, I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D; V30I / I77V / S101G / P127M The nine-point mutant is / N138K / F183D / V197L / P219E / A226T, V30I / I77V / S101G / P127M / F183D / V197L / P219E / A226T / N232D, V30M / I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D; V30M / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226T / N232D, V30M / I77L / S101G / P127M / N138K. The heat resistance of the / F183K / V197L / P219E / A226T / N232D ten-point mutant was further improved. After treatment at 80℃ for 5 min, its relative enzyme activity was generally increased by 10.2%-34.5% compared with the corresponding single-point mutant, achieving unexpected technical results.
[0042] Example 4: Thermal stability analysis of alkaline protease mutants The recombinant Bacillus subtilis strain expressing wild-type alkaline protease AprE or its mutant, constructed in Example 2, was inoculated into fermentation medium (0.5% yeast extract, 0.5% tryptone, 1% glucose, 1.8% K₂HPO₄) and fermented in shake flasks for 48 h. After centrifugation at 5000 rpm for 10 min, the supernatant was collected, and the alkaline protease activity in the supernatant was measured. The supernatant was then incubated at 60℃ for 2 h, and the residual enzyme activity was measured. The residual enzyme activity rate of alkaline protease was calculated as 100% of the original enzyme activity before treatment.
[0043] Then, the relative enzyme activity residual rate of the mutant was calculated with the enzyme activity residual rate of wild-type alkaline protease AprE as 100%, and the specific results are shown in Table 2.
[0044] Table 2 Comparison of thermal stability of alkaline protease mutants alkaline protease mutant Relative enzyme activity residual rate after treatment at 60℃ for 2 hours Wild-type AprE 100% V30I 109.3% V30M 110.3% I77V 106.5% I77L 118.0% S101G 115.6% P127M 120.8% N138K 106.5% N138Q 122.2% F183D 112.7% F183K 112.7% V197L 120.4% V197I 119.3% P219W 117.0% P219F 111.5% A226T 109.1% A226S 116.7% N232D 124.5% As can be seen from the data in Table 2, compared with the wild-type alkaline protease AprE, the alkaline protease mutants provided by this invention, which contain single mutation sites of V30M, V30I, I77L, I77V, S101G, P127M, N138Q, N138K, F183K, F183D, V197I, V197L, P219F, P219E, A226S, A226T, and N232D, respectively, showed a general increase in relative enzyme activity residual rate of 5.6%-24.5% and significantly enhanced thermostability after treatment at 60℃ for 2 hours.
[0045] Furthermore, the present invention provides V30I / I77V, V30I / S101G, V30M / N138Q, I77V / S101G, I77L / N232D, N138K / F183D, N138K / V197L, N138Q / P219F, F183D / V197L, F183K / A226S, V197L / P219E, and V197I / N232D. Two-point mutants: P219E / A226T and A226S / N232D; V30I / I77V / S101G, V30M / P127M / N138Q, I77V / S101G / N138K, I77L / N138Q / V197I, I77L / N138Q / V197I, V197L / P219E / A226T, P219F / A226S / N232D Three-point mutants: V30I / I77V / S101G / N138K, V30I / F183D / V197L / A226T, V30M / I77L / P219F / A226S, I77V / N138K / V197L / P219E, I77V / V197L / P219E / A226T, I77L / F183K / V197I / P219F, The four-point mutants are P127M / V197I / P219F / A226S, N138K / F183D / V197L / P219, F183D / V197L / P219E / A226T, and V197I / P219F / A226S / N232D; and V30I / I77V / S101G / N138K / F183D, V30M / P127M / N138Q / F183K / V197I, I77V / S101G / N138K / F183D / V197L, and I77L / V197I / P219F / A226S / N232. D, P127M / / F183K / V197I / P219F / A226S, N138K / F183D / V197L / P219E / A226T five-point mutants; V30I / I77V / S101G / N138K / F183D / V197L, 30M / N138Q / F183K / V197I / P219F / N232D, I77V / S101G / N138K / F183D / V197L / P219E, P127M / F183K / V197I / P219F / A226S / N232D, six-point mutants;V30I / I77V / S101G / N138K / F183D / V197L / P219E, V30M / N138Q / F183K / V197I / P219F / A226S / N232D, I77V / S101G / N 138K / F183D / V197L / P219E / A226T, I77L / P127M / N138Q / F183K / V197I / A226S / N232D, P127M / N138Q / F183K / V197I / The seven-point mutant P219F / A226S / N232D and the eight-point mutant V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226T, V30M / I77L / P127M / N138Q / F183K / V197I / P219F / N232D, I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D; V30I / I77V / S101G / P127M The nine-point mutant is / N138K / F183D / V197L / P219E / A226T, V30I / I77V / S101G / P127M / F183D / V197L / P219E / A226T / N232D, V30M / I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D; V30M / I77V / S101G / P127M / N138K / F183D / V197L / P219E / A226T / N232D, V30M / I77L / S101G / P127M / N138K. The thermal stability of the / F183K / V197L / P219E / A226T / N232D ten-point mutant was further improved. After treatment at 60℃ for 2 hours, its relative enzyme activity was generally increased by 11.7%-25.4% compared with the corresponding single-point mutant, achieving unexpected technical results.
[0046] In summary, the mutation sites V30M, V30I, I77L, I77V, S101G, P127M, N138Q, N138K, F183K, F183D, V197I, V197L, P219F, P219E, A226S, A226T, and N232D provided by this invention can significantly improve the heat resistance and thermal stability of the alkaline protease AprE, which is beneficial to promoting its widespread application in the field of industrial enzymes.
Claims
1. An alkaline protease mutant, characterized in that, The mutant is an alkaline protease with the amino acid sequence SEQ ID NO:1 containing substitutions or combinations of substitutions for at least one amino acid from the group consisting of: V30I / I77V / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D; V30I / I77L / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D; V30M / F183K; V30M / I77L / F183K; V30M / P127M / F183K; V30M / N138Q / F183K; V30M / I77L / F183K / V197I; V30MP127M / N138Q / F183K; V30M / N138Q / F183K / V197I; V30M / N138Q / F183K / P219F; V30M / N138Q / F183K / A226S; V30M / F183K / V197I / P219F; V30M / F183K / V197I / A226S; V30M / F183K / V197I / N232D; V30M / I77L / P127M / N138Q / F183K; V30M / P127M / N138Q / F183K / V197I; V30M / P127M / N138Q / F183K / P219F; V30M / P127M / N138Q / F183K / A226S; V30M / P127M / N138Q / F183K / N232D; V30M / N138Q / F183K / V197I / P219F; V30M / N138Q / F183K / A226S / N232D; V30M / F183K / V197I / P219F / A226S; V30M / F183K / V197I / P219F / N232D; V30M / P127M / N138Q / F183K / V197I / P219F; V30M / P127M / N138Q / F183K / P219F / A226S; V30M / N138Q / F183K / V197I / P219F / A226S; V30M / N138Q / F183K / V197I / P219F / N232D; V30M / N138Q / F183K / P219F / A226S / N232D; V30M / F183K / V197I / P219F / A226S / N232D; V30M / I77L / P127M / N138Q / F183K / V197I / P219F; V30M / I77L / F183K / V197I / P219F / A226S / N232D; V30M / I77L / P127M / F183K / P219F / A226S / N232D; V30M / P127M / F183K / V197I / P219F / A226S / N232D; V30M / P127M / N138Q / F183K / V197I / P219F / A226S; V30M / N138Q / F183K / V197I / P219F / A226S / N232D; V30M / I77L / N138Q / F183K / V197I / P219F / A226S / N232D V30M / I77L / P127M / F183K / V197I / P219F / A226S / N232D V30M / I77L / P127M / N138Q / F183K / P219F / A226S / N232D V30M / I77L / P127M / N138Q / F183K / V197I / A226S / N232D V30M / I77L / P127M / N138Q / F183K / V197I / P219F / N232D V30M / I77L / P127M / N138Q / F183K / V197I / P219F / A226S; V30M / I77L / P127M / N138Q / F183K / V197I / P219F / N232D; V30M / I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D; V30M / I77V / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D; V30M / I77L / S101G / P127M / N138K / F183K / V197L / P219E / A226T / N232D; I77L / F183K; I77L / P127M / F183K; I77L / F183K / P219F; I77L / P127M / N138Q / F183K; I77L / F183K / V197I / P219F; I77L / P127M / N138Q / F183K / V197I; I77L / N138Q / F183K / V197I / P219F; I77L / F183K / V197I / P219F / A226S; I77L / P127M / N138Q / F183K / V197I / P219F; I77L / N138Q / F183K / V197I / P219F / N232D; I77L / F183K / V197I / P219F / A226S / N232D; I77L / P127M / N138Q / F183K / V197I / P219F / A226S; I77L / P127M / N138Q / F183K / V197I / P219F / N232D; I77L / P127M / N138Q / F183K / V197I / A226S / N232D; I77L / P127M / N138Q / F183K / V197I / P219F / A226S / N232D; P127M / F183K; P127M / N138Q / F183K; P127M / F183K / V197I; P127M / N138Q / F183K / V197I; P127M / F183K / V197I / P219F; P127M / N138Q / F183K / V197I / P219F; P127M / / F183K / V197I / P219F / A226S; P127M / N138Q / F183K / V197I / P219F / A226S; P127M / N138Q / F183K / V197I / P219F / N232D; P127M / F183K / V197I / P219F / A226S / N232D; P127M / N138Q / F183K / V197I / P219F / A226S / N232D; N138Q / F183K; N138Q / F183K / V197I; N138Q / F183K / V197I / P219F; N138Q / F183K / V197I / P219F / A226S; N138Q / F183K / V197I / P219F / N232D; N138Q / F183K / V197I / P219F / A226S / N232D; F183K; F183K / V197I; F183K / P219F; F183K / A226S; F183K / N232D; F183K / V197I / P219F; F183K / P219F / A226S; F183K / A226S / N232D; F183K / V197I / P219F / A226S; F183K / V197I / P219F / N232D; F183K / V197I / A226S / N232D; F183K / P219F / A226S / N232D; F183K / V197I / P219F / A226S / N232D.
2. A DNA molecule encoding the alkaline protease mutant of claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2.
4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3; the host cell is a non-animal or non-plant variety.
5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ) or Trichoderma reesei ( Trichoderma reesei ).
6. The application of the alkaline protease mutant of claim 1 in detergent production.