Promoter and engineering bacterium capable of being used for increasing yield of butenyl spinosad
By constructing an efficient constitutive promoter, the problem of insufficient transcriptional activity in Polysporus sphaeroides was solved, resulting in a significant increase in the yield of butenyl spinosad and meeting the needs of industrial production.
Patent Information
- Application Number
- CN202610100605.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-26
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2046-01-26
AI Technical Summary
Existing constitutive promoters have insufficient transcriptional activity in Polysaccharidobacterium spp., making it difficult to increase the yield of butenyl spinosad and meet the needs of industrial production.
A highly efficient constitutive promoter adapted to *Busurus polysporus* was constructed. A random mutant library was constructed by error-prone PCR of the endogenous promoter 07000p and sorted by flow cytometry to obtain a strongly expressed promoter that drives the expression of the busR and busS genes.
It significantly improved the intracellular transcription level of the synthetic gene of butenyl spinosad, increasing the yield of butenyl spinosad produced by fermentation by more than 1.9 times that of the existing promoter-driven level.
Smart Images

Figure CN121555508A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to promoters and engineered bacteria that can be used to increase the yield of butenyl spinosad. Background Technology
[0002] Under natural conditions, the yield of secondary metabolites in organisms is generally low, and the synthesis process is easily regulated by environmental factors, making it difficult to meet the needs of industrial production and practical applications. Promoters, as core regulatory elements of gene expression, drive the transcription initiation and expression intensity of downstream structural genes, directly affecting the expression levels of key enzyme genes in secondary metabolic pathways. Compared to complex strategies such as gene knockout and metabolic pathway reconstruction, promoter-based regulation techniques offer advantages such as ease of operation, high specificity, and minimal impact on host growth, and have become a core means of increasing secondary metabolite yields in microbial synthetic biology and plant metabolic engineering. By screening for strong natural promoters, modifying and optimizing existing promoters, or designing artificially synthesized promoters, the transcriptional efficiency of secondary metabolic pathways can be precisely controlled, overcoming metabolic flux limitations and thus significantly increasing the synthetic yield of target products.
[0003] *Saccharomyces cerevisiae* is a crucial substrate for the synthesis of butenyl spinosad. However, the current industrial production of butenyl spinosad is still limited by the expression efficiency of key synthetic genes, with constitutive promoter performance being one of the core constraints. Existing commonly used constitutive promoters in *Saccharomyces cerevisiae* suffer from insufficient transcriptional activity and low expression levels, making it difficult to efficiently drive the sustained expression of key genes in secondary metabolic pathways, thus hindering the breakthrough of the target product's yield.
[0004] Therefore, constructing efficient constitutive promoters adapted to Polysaccharidobacterium spp. through molecular modification and artificial design has become a key direction for the metabolic engineering improvement of this strain. Summary of the Invention
[0005] To address the aforementioned technical challenges, in a first aspect, the present invention provides a promoter whose nucleotide sequence is shown in SEQ ID No. 1.
[0006] The aforementioned promoter is obtained by modifying the endogenous promoter. 07000 A mutant strong expression promoter was obtained by constructing a random mutant library using error-prone PCR and sorting it by flow cytometry. This promoter is a highly efficient constitutive promoter adapted to Polysaccharidobacterium spp. and can be used to increase the yield of butenyl spinosad produced by the fermentation of Polysaccharidobacterium spp.
[0007] The aforementioned promoters maintained high activity during the 48-72 hour growth phase of Polysporus sacchariformis.
[0008] Secondly, the present invention provides an expression box containing the aforementioned promoter.
[0009] Preferably, the expression box contains the aforementioned promoter and bus and bus Gene.
[0010] Thirdly, the present invention provides a biological material containing the aforementioned promoter or expression cassette.
[0011] Preferably, the biological material is recombinant DNA, transposon, plasmid vector, or viral vector.
[0012] Fourthly, the present invention provides an engineered bacterium containing the aforementioned promoter, expression cassette, or biological material.
[0013] Preferably, the engineered bacteria are enhanced using the promoter. bus and bus Gene expression to increase the production of butenyl spinosadin.
[0014] Preferably, the engineered bacteria also include other genetic engineering methods to increase the yield of butenyl spinosad.
[0015] Preferably, the substrate bacteria of the engineered bacteria are Escherichia coli or Polysporus spp.
[0016] Fifthly, the present invention provides the application of the promoter, expression cassette, biomaterial, or engineered bacteria in the fermentation production of butenyl spinosad.
[0017] In a sixth aspect, the present invention provides the application of the promoter, the expression cassette, or the biomaterial described herein in constructing engineered bacteria for fermentation production of butenyl spinosad.
[0018] In a seventh aspect, the present invention provides a method for producing butenyl spinosad, comprising: fermenting the engineered bacteria as described above.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention utilizes random mutation to obtain a highly efficient constitutive promoter adapted to *Polysporium sacchariformis*. This promoter significantly enhances the intracellular transcriptional level of butenyl spinosad-related synthetic genes, thereby increasing the yield of butenyl spinosad produced through fermentation. This invention not only provides a core regulatory element for increasing the yield of *Polysporium sacchariformis* secondary metabolites but also promotes the technological upgrading of its synthetic biology modification, possessing significant theoretical and practical value. Attached Figure Description
[0020] Figure 1This is the plasmid map of recombinant plasmid pSET159-07000p-bpsA and the sequencing results of the strain; where a is the plasmid map of recombinant plasmid pSET159-07000p-bpsA; b is the gel image of each target fragment; and c is the sequencing image of the strain.
[0021] Figure 2 These are the plasmid map of the recombinant plasmid pSET159-07000p-sfgfp-aac and the gel image for strain verification; where a is the plasmid map of the recombinant plasmid pSET159-07000p-sfgfp-aac; and b is the gel image for strain verification.
[0022] Figure 3 This is a schematic diagram of the construction and sequencing mutation strategy of the promoter plasmid library; where a is a schematic diagram of the mutation strategy; and b is a gel image of the single-clone mutant verification.
[0023] Figure 4 This represents the relative yield of butenyl spinosad produced by engineered bacteria through fermentation. Detailed Implementation
[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. In the embodiments provided in this specification, where specific techniques or conditions are not specified, they are performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0025] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. Furthermore, depending on the experimental purpose, those skilled in the art may conduct corresponding experiments under the guidance of the operating manuals accompanying various commercially available kits or entrust them to specialized companies, such as gene sequencing, plasmid sequencing, and molecular weight determination.
[0026] The culture media involved in the following examples are as follows: (1) Fermentation medium (g / L): glucose 60.0, starch 20.0, corn steep liquor 10.0, CaCO3 5.0, MgSO4·7H2O 1.0, peptone milk 20.0, NaCl 1.0, pH of fermentation medium 7.2.
[0027] (2) LB medium (g / L): tryptone 10.0, yeast extract 5.0, sodium chloride 10.0, solid medium with 2% agar added.
[0028] (3) TSB medium (g / L): tryptone 17.0, sodium chloride 5.0, soybean peptone 3.0, glucose 2.5, dipotassium hydrogen phosphate 2.5.
[0029] (4) MISP4 medium (g / L): soluble starch 10.0, dipotassium hydrogen phosphate 1.0, sodium chloride 1.0, ammonium sulfate 2.0, CaCO3 2.0, yeast extract 0.5, peptone 1.0, inorganic salt solution 1.0 mL, agar 20.0.
[0030] (5) R2YE medium (g / L): sucrose 103, glucose 10, K2SO4 0.25, MgCl2·6H2O 10.12, casein hydrolysate 0.1, agar 20; add 0.2 mL of trace element solution, 1 mL of 0.5% KH2PO4, 1.5 mL of 20% L-proline, 5 mL of 10% yeast extract, 8 mL of 3.68% CaCl2, and 10 mL of 5.73% TES buffer per 80 mL.
[0031] The primer sequences used in the following examples are shown in Table 1.
[0032] Table 1 Primer sequences
[0033] Protoplast preparation method: Inoculate spores of *Polysporium spp.* stored at -80℃ or collect fresh spores into 20 mL of TSB medium and incubate at 30℃ and 200 rpm for 48 h; transfer the well-grown bacterial culture at a 10% inoculation rate to 20 mL of TSB medium containing 0.2% glycine (to inhibit cell wall formation), and incubate at 30℃ and 200 rpm for 24-36 h; transfer the grown bacterial culture to a 50 mL sterile centrifuge tube, centrifuge at 4℃ and 4000 rpm for 5 min, discard the supernatant and collect the bacterial cells (this step should be performed on ice from the beginning); add 15 mL of TSB medium to the collected bacterial cells. Mix gently with a 10.3% sucrose solution, centrifuge at 4000 rpm for 5 min at 4°C, and repeat this step twice. Resuspend the bacterial cells in 20 mL of phosphate buffer containing 5 mg / mL lysozyme, and incubate at 37°C and 150 rpm for 1 h to fully digest the mycelium. Filter the enzymatically digested bacterial solution using a filter device equipped with two layers of lens paper and defatted cotton. The collected liquid is the protoplast suspension. Centrifuge at 4000 rpm for 5 min, discard the supernatant, and the yellow precipitate is the protoplast. Add 15 mL of phosphate buffer, centrifuge at 4000 rpm for 5 min at 4°C, wash the protoplast twice, and resuspend in 3 mL of phosphate buffer.
[0034] Example 1 Promoter 07000 p-activity characterization Comparative transcriptomics is used to identify stably expressed genes and their potential upstream promoter sequences. These sequences are then analyzed using... S. pogona Genome and strong promoter of ASAGF58 (CCTCC M20241920) ErmE Using p as a template, the endogenous promoter was amplified using primers 07000p-F / 07000p-R and ermE-F and ermE-R, respectively. 07000 p-fragments and strong promoters ErmE p fragment; respectively using pSET159 plasmid (disclosed in "The Influence of LysR Family Transcription Regulatory Factors on Butenyl Spontamine Biosynthesis") and indigo synthase gene bpsA Using the template of "Cloning and Characterization of a Streptomyces Single Module Type Non-ribosomal Peptide Synthetase Catalyzing a Blue Pigment Synthesis", primer pairs 159-F / 159-R and bpsA-F / bpsA-R were used to amplify the vector backbone and... bpsAFragments. Plasmids were constructed using Gibson assembly; the correct plasmids were pSET159-07000p-bpsA and pSET159-ermE. p-bpsA was first transformed into E. coli and cultured in LB medium, and then introduced via conjugation transfer. S. to the factory In ASAGF58, the cells were incubated upside down at 30°C for 7 days.
[0035] The PCR reaction system and PCR reaction procedure for the target gene are shown in Tables 2 and 3.
[0036] Table 2 PCR reaction system
[0037] Table 3 PCR reaction procedure
[0038] The sequence of the 07000p promoter is shown in SEQ ID No. 22. ErmE The sequence of the p promoter is shown in SEQ ID No. 23.
[0039] SEQ ID NO.22: CCTTCTCGTAACGGATGGACATAGTTGTCGACTCGCGACCCCCATCTGCGATCGATGACACACCGAAACCCCTGGTCAAGCCCTGTCGATCTTTCAGGTGAGTTCCCTCACCACACGAGATCGAACTCTTGACATCGCGGCAGTTCGTGAAAGTATTCACAAGCACACGGACTCCGTGAAAGCATTCACAAACACCCCGAACGAAACGAGCGGCGCGCGTGGGCGCGCCTAGCGAGGAGCAAGGAACG SEQ ID No. 23: AGCCCGACCCGAGCACGCGCCGGCACGCCTGGTCGATGTCGGACCGGAGTTCGAGGTACGCGGCTTGCAGGTCCAGGAAGGGGACGTCCATGCGAGTGTCCGTTCGAGTGGCGGCTTGCGCCCGATGCTAGTCGCGGTTGATCGGCGATCGCAGGTGCAC GCGGTCGATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACGCGGTCCACACGTGGCACCGCGATGCTTGTTGTGGGCACAATCGTGCCGGTTGGTAGGATCGATCCACTAGTTCTAGAAATAATTTTGTTTAACATTAAAGAGGAGAAATTA The plasmid map of recombinant plasmid pSET159-07000p-bpsA is as follows: Figure 1 As shown in 'a', the gel images of each target fragment of the plasmid are as follows: Figure 1 As shown in b, the sequencing diagram of the strain is as follows. Figure 1 As shown in c in the figure.
[0040] Strains with the correct promoters were inoculated into TSB medium, with three replicates for each strain. The cultures were incubated at 30°C and 200 rpm for 24 h. The OD values of the recombinant strains were then measured using a microplate reader. 600 The absorbance of indigo was measured at an absorption wavelength of 590 nm. Simultaneously, it was compared with a promoter widely used in Streptomyces. ErmE A of strain p 590 / OD 600 The promoter strength is normalized based on numerical values to reflect the relative strength of the promoter. ErmE p-promoter strain A 590 A is 1.186. 590 / OD 600 It is 0.0544, while 07000 p-promoter strain A 590 A is 1.579. 590 / OD 600 The value is 0.1390, and the unit absorbance is ErmE 2.27 times that of p.
[0041] Example 2: Construction of promoter mutant libraries by S. pogona Using the ASAGF58 genome as a template, amplification was performed using primers 07000p-F / R to obtain... 07000p promoter. Synthesis optimized with codons. sfgfp Using the gene plasmid as a template, the gene was amplified using 07000-sfgfp-F / 159-sfgfp-R with a 25bp homologous arm. sfgfp Using pEST159 plasmid as a template, a linearized integration vector pEST159 was obtained. After three-segment ligation using Gibson assembly, it was transformed into *E. coli*. Colony PCR and sequencing were performed using the validation primers T159-F / Y2-R to obtain the correct recombinant plasmid pSET159-07000p-sfgfp-aac. The plasmid map and validation gel image of the recombinant plasmid pSET159-07000p-sfgfp-aac are shown below. Figure 2 As shown.
[0042] Using this plasmid as a template, the mutant promoter fragment (289 bp) was amplified using 07000-mut-F / 07000-mut-R. Then, reverse PCR was performed using primers V07000-mut-R / V07000-mut-F to amplify the promoter fragment containing… egfp The pSET59 vector backbone was used to extract the correctly sized DNA fragments, which were then gel-cleaved and recovered. Using Gibson assembly, the linearized vector was recombinated and ligated with the mutant promoter fragment, yielding approximately 1 × 10⁻⁶ DNA fragments. 4 A recombinant plasmid library consisting of several transformants was constructed. Single clones were randomly selected and verified by PCR using the validation primers T159-F / Y2-R (correct size is 1120bp) and Sanger sequencing. The number of mutated bases was between 1 and 6bp.
[0043] Error-prone PCR reactions were performed using the Solarbio random mutation kit. The error-prone PCR reaction system and PCR reaction procedure are shown in Tables 4 and 5.
[0044] Table 4 Commonly Misunderstood PCR Reaction Systems
[0045] Table 5 PCR reaction procedure
[0046] Using bonding transfer containing 07000 The donor bacterial library of the p promoter mutant plasmid was transformed into... S. pogona In the culture, the cells were inverted at 30°C for 7 days. Conjugates from the MISP4 plates were then picked and purified on GYM (Apr) plates, yielding approximately 1 × 10⁻⁶ cells. 4 A transformant S. pogonaMutant library. After randomly selecting conjugates for colony PCR, the samples were sent for Sanger sequencing to confirm the integrity of the plasmid insert and verify that the library quality met the requirements for subsequent functional screening. A schematic diagram of the promoter plasmid library construction and sequencing mutation strategy is shown below. Figure 3 As shown.
[0047] Example 3: Screening of promoter mutation libraries Based on a feasible flow cytometry method for sfGFP, for S. pogona The artificial promoter library was used for characterization and screening. During the sorting process, [the following was employed]: S. pogona 07000p-sfGFP served as a negative control, while 07000p-sfGFP served as a positive control. GFP signals were acquired using the FL1 channel. Fluorescence intensities higher than [a certain value] were screened using a threshold gate (P3). 07000 The first 2% of single cells were collected, totaling 1 million single cells, at a sorting rate of 10,000 events / s. The sorted droplets were then evenly spread on plates containing R2YE (Apr) and incubated upside down at 30°C for 7-10 days.
[0048] Single colonies from conjugation transfer MISP4 plates containing promoter mutants were purified. A portion of the purified cells was picked up with a sterile toothpick and transferred to each well of a sterile 96-well plate containing 600 μL of TSB medium (containing 50 μg / mL apramycin). Simultaneously, 20 μL of the wild-type strain stored at -80℃ was aspirated from each well. S. pogona ASAGF58 glycerol bacillus and promoter mutant parent glycerol bacillus were cultured at 30℃ and 240 rpm for 65 h. 50 μL of the bacterial suspension was then aspirated from each well and mixed to prepare protoplasts. The prepared protoplast suspension was resuspended in PBS solution containing 0.5 M NaCl, and the protoplast count was adjusted to 1 × 10⁻⁶. 6 Cells / mL. Protoplasts were analyzed and screened using a BD FACSAria™ III flow cytometer (Fluorescence activated Cell Sorting, FACS) with an excitation wavelength of 488 nm and FL1 (530 / 30 nm) channels. The nozzle was 70 μm in diameter. Appropriate FSC and SSC settings were used. Target cells were screened by changes in GFP fluorescence intensity. Single-cell droplets under different screening conditions were collected using sterile flow cytometry tubes.
[0049] Single-cell samples sorted by FACS were spread onto R2YE plates containing the corresponding antibiotics. After the plates were dried, they were incubated upside down at 30°C for 7–10 days until single colonies appeared. Single colonies were then inoculated into TSB medium and incubated at 30°C and 200 rpm. The fluorescence intensity and corresponding OD of each promoter were measured using a microplate reader at 24 h, 48 h, and 72 h. 600 Calculate its unit OD600 Fluorescence intensity; based on this, the trigger promoter will be determined. 07000 The unit fluorescence intensity of p at the corresponding time point is normalized to 1, and then the relative fluorescence intensity of the promoter to be tested is calculated. This relative fluorescence intensity is the fold, which can verify the intensity and stability of the promoter expression at different times. The test results are shown in Table 6.
[0050] Table 6. Promoter fluorescence intensity at different times
[0051] Promoter S2 exhibited the strongest promoter activity, with promoter strength at the highest level across the three time periods. 07000 p was 11.03, 11.65, and 14.89 times that of p.
[0052] After culturing the mutants, the genomes were extracted and sequenced to obtain the specific sequences. The promoter mutations are shown in Table 7.
[0053] Table 7 Promoter Mutation Status
[0054] The sequence of promoters S1, S2, S3 and S4 is as follows.
[0055] S1: (SEQ ID No. 24) CCTTCTTGTAACGGATGGACACAGTTGTCGACTCGCGATCCCCATCTGCGATCGATGACACACCGAAACCCCTGGTCAAGCCCTGTCGACCTTTCAGGTGAGTTCCCTCACCACACGAGATCGAACTCTTGACATCGCGGCAGTTCGTGAAAGTATTCACAAGCACACGGACTCCGTGAAAGCATTCACAAACACCCCGAACGAAACGAGCGGCGCGCGTGGGCGCGCCTAGCGAGGAGCGATGAACG S2: (SEQ ID No.1) CCTTCTCGTAACGGATGGACATAGTTGTCGACTCGCGGCCCCATCTGCGATCGATGACACACCGAAACCCTGGACAAGCCCTGTCGATCTTTCAGGTGAGTTCCCTCACCACACGAGATCGAACTCTTGACATCGCGGCAGTTCGTGATAGTATTCACAAGCACACGGACTCCGTGAAAGCATTCACAAACACCCCGAACGAAACGAGCGGCGCGCGTGGGCGCGCCTAGCGAGGAGCAAGGAACG S3: (SEQ ID No. 25) CCTTCTCGTAACGGATGGACATAGTTGTCGACTCGCGACCCCCATCTGCGATCGATGACACACCGAAACCCCTGGTCAAGCCCTGTCGATCTTCAGGTGAGTTCCCTCACCACACGAGATCGAACTCTTGACATCGCGGCAGTTCGTGAAAGTATTCACAAGCACACGGACTCCGTGAAAGCATTCACAAACACCCCGAACGAAACGAGCGGCGCGCGTGGGCGCGCCTAGCGAGGAGCAAGGAACG S4: (SEQ ID No. 26) CCTTCTCGTAACGGATGGACATAGTTGTCGACTCGCGACCCCCATCTGCGATCGATGACACACCGAAACCCCTGGTCAAGCCCTGTCGATCTTTCAGGTGAGTTCCCTCACCACACGAGATCGAACTCTTGACATCGCGGCAGTTCGTGAAAGTATTTACAAGCACACGGACTCCGTGAACGCATTCACAAACACCCCGAACGAAACGAGCGGCGCGCGTGGGCGCGCCTAGCGAGGAGCAAGGAACG
[0056] Example 4: Engineered bacteria containing promoter S2 and fermentation production of butenyl spinosad. This embodiment provides a method driven by the promoter S2. bus R / bus The engineered strain of the S gene was used to ferment and produce butenyl spinosad, and... ErmE p、07000 p and S4 drivers bus R / bus The engineered bacteria containing the S gene served as a control. The construction steps for the engineered bacteria are as follows: by S. pogona Using the ASAGF58 genome as a template, amplification was performed using primers 07000-busR-F / 159-busS-R. busR-busS Gene fragments; containing S2 and S4 mutants respectively. S. pogona Using the genome as a template, the S2 and S4 promoter fragments were amplified using 07000-F / busR-07000-R; the plasmids pSET159-07000p-bpsA and pSET159-ermE from Example 1 were then used. Using p-bpsA as a template, the linearized vector backbones of pSET159-07000p and pSET159-ermE were amplified using 159-F / busR-07000-R and 159-F / busR-ermE-R, respectively; the pSET59 linearized vector backbone was the same as in Example 1. The linearized vector backbone, promoters, and... were assembled using Gibson assembly. busR-busS Ligation was performed to construct recombinant plasmids pSET159-S2-busR-busS and pSET159-ermE. p-busR-busS, pSET159-07000p-busR-busS, and pSET159-S4-busR-busS. Recombinant plasmids that were verified to be correct by sequencing were first transformed into *E. coli* and cultured in LB medium, then introduced via conjugation transfer. S. pogona In ASAGF58, transformants were incubated upside down at 30°C for 7 days to obtain transformants driven by various promoters. bus and bus Recombinant engineered bacteria with tandem gene co-expression.
[0057] Furthermore, this embodiment provides a method for producing butenyl spinosad, which involves fermentation using the aforementioned recombinant engineered bacteria. The specific steps are as follows: The recombinant engineered bacteria were inoculated into TSB medium at 200 rpm and cultured at 30°C for 48 h. Then, a 10% inoculum was transferred to fermentation medium and cultured at 200 rpm and 30°C for 168 h to obtain fermentation samples. The yield of butenyl spinosad in the fermentation samples was then determined. The methods for detecting and calculating the relative yield of butenyl spinosad were based on the literature "Exploring a High-Efficiency Genetic Transformation System for Engineering...". Saccharopolyspora to the factoryASAGF58 To Improve Butenyl-Spinosyn Production" was carried out.
[0058] Test results as follows Figure 4 As shown, in bus R / bus In the metabolic engineering of the S combination, promoters were used. 07000 p driver bus R / bus When the S gene is expressed, the yield of butenyl spinosad is: ErmE p-driven 121.23%; using the starter S Under 2-drive conditions, the yield of butenyl spinosad is: ErmE p-driven 189.78%; using the starter S Under 4-stage driving, the yield of butenyl spinosad is ErmE p-driven 146.23%.
[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A promoter, characterized in that, Its nucleotide sequence is shown in SEQ ID No.
1.
2. An expression box, characterized in that, It contains the promoter as described in claim 1.
3. A biomaterial, characterized in that, It contains the promoter as described in claim 1 or the expression box as described in claim 2.
4. Engineered bacteria, characterized in that, It contains the promoter of claim 1, the expression cassette of claim 2, or the biological material of claim 3.
5. The engineered bacteria according to claim 4, characterized in that, The engineered bacteria are enhanced using the aforementioned promoter. busR and busS Gene expression to increase the production of butenyl spinosadin.
6. The engineered bacteria according to claim 5, characterized in that, The engineered bacteria also include other genetic engineering methods to increase the yield of butenyl spinosad.
7. The engineered bacteria according to any one of claims 4 to 6, characterized in that, The substrate bacteria of the engineered bacteria are Escherichia coli or Polysporus spp.
8. The use of the promoter of claim 1, the expression cassette of claim 2, the biomaterial of claim 3, or the engineered bacteria of any one of claims 4 to 7 in the fermentation production of butenyl spinosad.
9. The application of the promoter of claim 1, the expression cassette of claim 2, or the biomaterial of claim 3 in constructing engineered bacteria for fermentation production of butenyl spinosad.
10. A method for producing butenyl spinosad, characterized in that, include: Fermentation production is carried out using the engineered bacteria described in any one of claims 4 to 7.
Citation Information
Patent Citations
Saccharopolyspora tuberosa engineering strain with high yield of butenyl spinosad as well as construction method and application thereof
CN116218692A
Saccharopolyspora tuberosa engineering strain for efficiently synthesizing butenyl spinosad as well as construction method and application of saccharopolyspora tuberosa engineering strain
CN117925672A
Application of TetR / AcrR family transcriptional regulation factor TF13245 in regulation of butenyl spinosad yield
CN118222601A
Component and method for improving expression of target gene in heterologous host
CN118345077A