Method for improving yield of monensin by constructing anti-oxidation system

By overexpressing catalase and superoxide dismutase genes in *Streptomyces cinnamonis*, an endogenous antioxidant system was constructed, which solved the oxidative stress problem in monensin fermentation and significantly increased monensin yield.

CN121555538APending Publication Date: 2026-02-24XIAMEN UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511987335.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-02-24

AI Technical Summary

Technical Problem

During monensin fermentation, reactive oxygen species produced by cell metabolism lead to oxidative stress, resulting in cell membrane lipid peroxidation, enzyme activity damage, and obstruction of secondary metabolic pathways, which severely limits the efficiency of monensin synthesis. Current technologies lack sufficient research on the regulation of oxidative stress, and exogenous antioxidants are expensive and have short-lived effects.

Method used

Overexpressing the encoding genes for catalase and/or superoxide dismutase in the genome of *Streptomyces cinnamon* to construct an endogenous sustainable antioxidant system and enhance the antioxidant capacity of the bacteria, *Streptomyces cinnamon* was transformed by ligating the recombinant vector with the basic vector pSET152.

Benefits of technology

It enhanced the antioxidant capacity of Streptomyces cinnamon, effectively scavenged ROS, reduced oxidative stress damage, and significantly increased the yield of monensin, especially the recombinant strains that co-expressed katX and SOD showed the best results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121555538A_ABST
    Figure CN121555538A_ABST
Patent Text Reader

Abstract

The invention provides a method for improving the yield of monensin by constructing an anti-oxidation system, and belongs to the technical field of genetic engineering. The invention provides a method for transforming monensin fermentation strain streptomyces cinnamomi by constructing an endogenous anti-oxidation system, which comprises the following steps: connecting a coding gene of catalase and / or a coding gene of superoxide dismutase with a basic vector such as pSET152 by a homologous recombination method to construct an overexpression recombinant vector; and carrying out overexpression on the gene in streptomyces cinnamomi by using a genetic transformation method. According to the three overexpression strains obtained by the invention, the oxidation resistance of the streptomyces cinnamomi can be improved, ROS (reactive oxygen species) generated in cells can be effectively eliminated, the damage of oxidative stress to thalli can be reduced, particularly, the oxidation resistance of the recombinant strain which jointly overexpresses katX and sod is the highest, and the titer of monensin is improved to the maximum extent.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for constructing an antioxidant system to increase monensin production. Background Technology

[0002] Monensin is produced by *Streptomyces cinnamon* ( Streptomyces cinnamonensis Monensin is a polyether antibiotic produced through fermentation, and it has been found to have broad-spectrum anticoccal activity. As a highly effective polyether antibiotic, monensin is widely used in livestock farming for anticoccal and growth-promoting purposes.

[0003] Monensin production relies on the fermentation process of *Streptomyces cinnamon*, but the reactive oxygen species (ROS) produced during fermentation trigger oxidative stress, leading to cell membrane lipid peroxidation (such as MDA accumulation), enzyme activity damage, and obstruction of secondary metabolic pathways, severely limiting monensin synthesis efficiency. Current technologies for increasing monensin yield focus on optimizing fermentation parameters (such as the carbon-to-nitrogen ratio and pH) or modifying biosynthetic gene clusters, but research on the regulation of oxidative stress is insufficient. Some studies have also shown that adding exogenous antioxidants (such as GSH and vitamin C) can alleviate oxidative damage, but these methods suffer from drawbacks such as high cost, short-lived effects, and inability to sustainably respond to the metabolic needs of the cells. Summary of the Invention

[0004] This invention provides a method for constructing an antioxidant system to increase monensin production by constructing an endogenous and sustainable antioxidant system within the fermentation strain to enhance the antioxidant capacity of the bacteria.

[0005] This invention provides a method for improving the antioxidant capacity of Streptomyces cinnamon, comprising overexpressing the encoding genes of catalase and / or superoxide dismutase in the genome of Streptomyces cinnamon.

[0006] In a preferred embodiment of the present invention, the gene encoding catalase includes katX The gene encoding the superoxide dismutase includes sod Gene.

[0007] The present invention also provides the application of the above method in increasing the yield of monensin from *Streptomyces cinnamon*.

[0008] The present invention also provides a recombinant vector with high antioxidant capacity, wherein the base vector of the recombinant vector includes pSET152, and the encoding genes of catalase and / or superoxide dismutase are linked to the base vector.

[0009] The present invention also provides a method for constructing the above-mentioned recombinant vector, comprising the following steps: (1) using the genomic DNA of Streptomyces cinnamon as a template to amplify the encoding genes of catalase and / or superoxide dismutase; (2) The fragments amplified in step (1) are respectively or together ligated with the linearized pSET152 plasmid fragment to obtain the recombinant vector.

[0010] In a preferred embodiment of the present invention, the primer pair for amplifying the coding gene of catalase in step (1) includes an upstream primer with a nucleotide sequence as shown in SEQ ID No. 3. katX -F and SEQ ID No. 4 katX -R; The amplification program included: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 63℃ annealing for 30 s, 72℃ extension for 34 s, 30 cycles; and 72℃ final extension for 4 min.

[0011] In a preferred embodiment of the present invention, the primer pair for amplifying the superoxide dismutase encoding gene in step (1) includes an upstream primer with a nucleotide sequence as shown in SEQ ID No. 5. sod -F and SEQ ID No. 6 sod -R; The amplification program included: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 21 s, 30 cycles; and 72℃ final extension for 3 min.

[0012] The present invention also provides recombinant Streptomyces cinnamon obtained by transforming Streptomyces cinnamon with the above-mentioned recombinant vector.

[0013] The present invention also provides the application of the above-mentioned recombinant Streptomyces cinnamon in high-yield monensin production.

[0014] The present invention also provides a method for producing monensin using the above-mentioned recombinant Streptomyces cinnamonis, comprising the following steps: inoculating a single colony of the recombinant Streptomyces cinnamonis into a seed culture medium and culturing it for a period of time to obtain a seed solution; The seed culture is inoculated into a fermentation medium for fermentation culture, and the fermentation broth contains the monensin.

[0015] Beneficial effects: This invention provides a method for modifying the monensin-producing strain *Streptomyces cinnamonina* by constructing an endogenous antioxidant system. Specifically, it involves modifying the gene encoding catalase, an enzyme that catalyzes the decomposition of hydrogen peroxide into water and oxygen. katX Genes, and / or genes encoding superoxide dismutase, an enzyme that can convert superoxide anions into hydrogen peroxide and oxygen. sod The gene was linked to a basic vector such as pSET152 via homologous recombination to construct an overexpression recombinant vector, and then the gene was overexpressed in *Streptomyces cinnamon* using genetic transformation.

[0016] The three overexpression strains obtained in this invention can enhance the antioxidant capacity of *Streptomyces cinnamon*, effectively scavenge intracellular ROS, and reduce oxidative stress damage to the bacterial cells, especially those with co-overexpression. katX and sod The recombinant strains showed the highest antioxidant capacity and the greatest increase in monensin potency.

[0017] Biological Preservation Information Streptomyces cinnamon Streptomyces cinnamoneus SDSL6002 was deposited on April 22, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 30409. Attached Figure Description

[0018] Figure 1 DNA electrophoresis gel image; Figure 2 A schematic diagram of the carrier construction. Detailed Implementation

[0019] This invention provides a method for improving the antioxidant capacity of Streptomyces cinnamon, comprising overexpressing the encoding genes of catalase and / or superoxide dismutase in the genome of Streptomyces cinnamon.

[0020] The encoding gene for catalase described in this invention includes katX Gene, as described in one embodiment katX The nucleotide sequence of the gene is shown in SEQ ID No. 1: The gene encoding the superoxide dismutase includes... sod Gene, as described in one embodiment sod The nucleotide sequence of the gene is shown in SEQ ID No. 2. In this embodiment of the invention, overexpression assays were constructed respectively. katX Recombinant Streptomyces cinnamonii gene overexpression sod Recombinant Streptomyces cinnamon and its simultaneous overexpression katX Genes and sod The recombinant Streptomyces cinnamon strains were verified to have higher antioxidant capacity. Enzyme activity assays showed enhanced expression, and the detection of membrane lipid peroxidation and protein carbonylation indicators at this time showed that oxidative damage was alleviated, and the monensin titer was significantly improved in the later stage.

[0021] The present invention also provides the application of the above method in increasing the yield of monensin from *Streptomyces cinnamon*.

[0022] In this invention, when using *Streptomyces cinnamon* to produce monensin through fermentation, reactive oxygen species (ROS) produced by the microbial metabolism can trigger oxidative stress, leading to cell membrane lipid peroxidation, enzyme activity damage, and obstruction of secondary metabolic pathways, severely limiting the efficiency of monensin synthesis. This invention improves the monensin synthesis efficiency by modifying the genome of *Streptomyces cinnamon* to endogenously enhance its antioxidant capacity, thereby reducing the impact of ROS.

[0023] The present invention also provides a recombinant vector with high antioxidant capacity, wherein the base vector of the recombinant vector includes pSET152, and the encoding genes of catalase and / or superoxide dismutase are linked to the base vector.

[0024] In one embodiment of the present invention, pSET152 is used as the basic carrier, and its... C31 integrase coding sequence, origin of replication (oriT), and apramycin resistance gene ( aac(3)-IV ) as a screening marker, and the catalase katX Gene insertion into the MCS region to deliver superoxide dismutase ​ Genes are inserted into the MCS region.

[0025] The present invention also provides a method for constructing the above-mentioned recombinant vector, comprising the following steps: (1) using the genomic DNA of Streptomyces cinnamon as a template to amplify the encoding genes of catalase and / or superoxide dismutase; (2) The fragments amplified in step (1) are respectively or together ligated with the linearized pSET152 plasmid fragment to obtain the recombinant vector.

[0026] This invention uses the genomic DNA of *Streptomyces cinnamon* as a template to amplify the aforementioned... ​ Genes and ​ Genes, and in the process of amplification ​ When generating genes, the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID No. 3. ​ -F and SEQ ID No. 4 ​ -R; The amplification program includes: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 63℃ annealing for 30 s, 72℃ extension for 34 s, 30 cycles; 72℃ final extension for 4 min. This invention amplifies... ​ When generating genes, the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID No. 5. ​ And shown in SEQ ID No. 6 ​-R; The amplification program includes: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 21 s, 30 cycles; 72℃ final extension for 3 min. All amplifications described in this invention are performed using high-fidelity enzymes, such as the PCR amplification reaction using 2×Super PfxMaster Mix high-fidelity enzyme in the examples.

[0027] ​ -F:GGTTGGTAGGATCCACATGAGAGTCCTGAAACACCGTGT; ​ -R: GAGCCTTTAATTGTATCGGTATCCATCTCGACCGGATCCTCGC; ​ -F:GGTTGGTAGGATCCACATGTGAAGATGTGGGGCTTCCC; ​ -R: GAGCCTTTAATTGTATCGGTTTCTTCGGACCCGTCGTCAC.

[0028] In linearizing pSET152, this invention also employs PCR to amplify the linearized fragment. Specifically, using the pSET152 plasmid as a template, and with primer pairs containing the upstream primer PF (as shown in SEQ ID No. 7) and the downstream primer PR (as shown in SEQ ID No. 8), a reverse PCR amplification reaction is performed using a high-fidelity enzyme 2×Super Pfx Master Mix to obtain the linearized pSET152 plasmid fragment. The amplification program includes: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 45 s, 30 cycles; and 72℃ final extension for 7 min.

[0029] PF: ACCGATACAATTAAAGGCTC; PR:ATGTGGATCCTACCAACCGGC.

[0030] The present invention will amplify the obtained ​ Fragments and / or ​ The fragment is ligated with a linearized pSET152 plasmid fragment, and the ligation process also includes the PermE promoter and ​ Terminator, and then perform Gibson assembly of the two biosynthesized fragments with the above fragments, specifically by first combining the linearized vector with the PermE promoter and ​ Terminate the sub-connection, then ​ ,​ The two fragments were then ligated to the aforementioned construct vector for Gibson assembly. The kits used for this assembly were the Hieff Clone® Plus MultiOne Step Cloning Kit, yielding pSET152- ​ pSET152- ​ pSET152- ​ - ​ Recombinant vector. The PermE promoter and... ​ The nucleotide sequences of the terminators are as follows: PermE promoter (SEQ ID No. 9): GTGCACGCGGTCGATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACGCGGTCCACACGTGGCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGTAGGATCCACAT; ​ Terminator (SEQ ID No. 10): AAAATCTCCAAAAAAAAAGGCTCCAAAAGGAGCCTTTAATTGTATCGGT.

[0031] The construction process of the pSET152 plasmid containing the ermE promoter and fd terminator in this embodiment of the invention is as follows: Preparation of linearized pSET152 vector fragment: A pair of primers was designed to amplify the linearized pSET152 vector. The upstream primer introduced the fd terminator sequence (49 bp) at its 5′ end, and PCR amplification yielded a linearized pSET152 vector fragment with homologous arms to the fd terminator. Using a synthesized ermE promoter fragment (120 bp) as a template, primers were designed for amplification, yielding the ermE promoter fragment. The upstream primer contained a sequence homologous to the downstream region of the vector, and the downstream primer contained a sequence homologous to the fd terminator region. PCR amplification yielded the ermE promoter fragment with homologous arms at both ends. The two fragments were ligated using seamless cloning technology to form a complete new plasmid, “pSET152-ermE-fd”. This plasmid can then be used for subsequent insertion of target genes.

[0032] Fd-F (SEQ ID No. 13): ACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAGATTTTATGTTGGGGATCCTCTAGA; Fd-R (SEQ ID No. 14): CTGCGATCGCCGATC; ermE-fd-F (SEQ ID No. 15):GATCGGCGATCGCAGGTGCACGCGGTCGATCT; ermE-fd-R (SEQ ID No. 16): GAGCCTTTAATTGTATCGGTATGTGGATCCTACCAACCGGC.

[0033] The Gibson assembly described in this invention involves single-segment ligation at 50°C for 10 min, and multi-segment ligation at 50°C for 20-30 min. The reaction system consists of: 5 μL Clone® Plus Multi One Step Cloning Kit and 0.02 pmol pre-linearized pSET152. ​ / ​ 0.02 pmol.

[0034] The present invention also provides recombinant Streptomyces cinnamon obtained by transforming Streptomyces cinnamon with the above-mentioned recombinant vector.

[0035] This invention introduces the above-mentioned fusion gene vector into *Streptomyces cinnamonii* via conjugation transfer. The vector is then transferred through... C31 integrase mediates site-specific integration into a non-essential site on the host chromosome to obtain recombinant strains.

[0036] The present invention also provides the application of the above-mentioned recombinant Streptomyces cinnamon in high-yield monensin production.

[0037] The recombinant *Streptomyces cinnamon* strains constructed using the method described in this invention can all produce high levels of monensin, but... ​ and ​ The recombinant strains that co-overexpressed KATX had a synergistic effect with SOD due to the construction of an antioxidant system within the strain, resulting in stronger antioxidant capacity and the highest monensin production.

[0038] The present invention also provides a method for producing monensin using the above-mentioned recombinant Streptomyces cinnamonis, comprising the following steps: inoculating a single colony of the recombinant Streptomyces cinnamonis into a seed culture medium and culturing it for a period of time to obtain a seed solution; The seed culture is inoculated into a fermentation medium for fermentation culture, and the fermentation broth contains the monensin.

[0039] This invention relates to the production of monensin via shake-flask fermentation. In the experiment, the recombinant Streptomyces was inoculated into a shake-flask seed culture (100 mL / 500 mL) and cultured at 33.0 °C and 180 rpm for 24 h. Then, 10% of the inoculum was transferred to fermentation medium (50 mL / 500 mL) and fermented at 33.0 °C and 200 rpm for 12 days.

[0040] The culture medium contained in the shake flask seed culture of the present invention is a seed culture medium, which includes the following components at the following concentrations: soybean meal 15 g / L, glucose 5 g / L, dextrin 20 g / L, yeast extract 2.5 g / L, and light calcium carbonate 1 g / L; the fermentation culture medium includes the following components at the following concentrations: soybean meal 35 g / L, glucose 35 g / L, Na2SO4 2.2 g / L, K2HPO4 0.08 g / L, FeSO4·7H2O 0.1 g / L, Al2(SO4)3 0.7 g / L, soybean oil 45 g / L, and CaCO3 2.5 g / L.

[0041] To further illustrate the present invention, the following detailed description of a method for constructing an antioxidant system to increase monensin production, in conjunction with embodiments, is provided by the present invention, but should not be construed as limiting the scope of protection of the present invention.

[0042] Unless otherwise specified, the reagents and methods used in the embodiments of this invention are all from conventional sources in the art.

[0043] 1. Fermentation production and detection of monensin Shake-flask fermentation of monensin: A single inoculum was inoculated into a shake-flask seed culture (100 mL / 500 mL) and cultured at 33.0 ℃ and 180 rpm for 24 h. Then, 10% of the inoculum was transferred into the fermentation medium (50 mL / 500 mL) and fermented at 33.0 ℃ and 200 rpm for 12 days.

[0044] Monensin yield assay: 1.0 g of fermentation broth was mixed thoroughly with 50 mL of methanol. The mixture was then sonicated for 30 min. Subsequently, the crude extract was filtered through a 0.45 µm organic filter membrane and transferred to a liquid chromatography vial.

[0045] High-performance liquid chromatography (HPLC) was used with a C18 column (250 × 4.6 mm, 5 µm) and a mobile phase of methanol:water:glacial acetic acid (94:6:0.1). The flow rate was set to 0.7 mL / min. The detection wavelength was 520 nm, and the injection volume was 20.0 µL. The derivatization temperature was maintained at 98 °C. The diluent consisted of a 90:10 mixture of methanol and water.

[0046] 2. Oxidation index detection 2.1 The method in the reference (Disruption of ergosterol biosynthesis confers resistance to amphotericin B in Candida lusitaniae) was used to detect lipid peroxidation, especially the content of malondialdehyde (MDA): centrifugation and weighing of the wet weight of the bacterial cells were performed; Preparation of TBA-TCA reagent: Dissolve 0.375% thiobarbituric acid (TBA) in 15% trichloroacetic acid (TCA), and use immediately after preparation; add 2 mL of the prepared reagent to the bacterial cells; then boil in a water bath for 30 min, and rapidly cool on ice; centrifuge at 8000 rpm for 5 min, aspirate the supernatant, and measure the OD. 450 OD 532 and OD 600 The value at which MDA content is calculated, and the formula for calculating MDA content: Lipid peroxidation (μmol•g) -1 = [6.452 × (A)] 532 -A 600 -0.559×A 450 ] / wet weight; 2.2 Determination of protein carbonylation content: Take an appropriate amount of Streptomyces cinnamonis cells, mix with PBS, and sonicate to disrupt the cells for 30 min. After an 8 min interval, incubate on ice for 2 min, centrifuge, collect the supernatant, and aspirate 200 μL to measure the protein content of the sample. Take 100 μL of the supernatant and add 400 μL of 10 mM 2,4-dinitrophenylhydrazine (DNPH). Use the supernatant without DNPH as a control. Place the reaction system in the dark for 1 h and vortex once every 10 min. After the reaction is complete, add 500 μL of 20% trichloroacetic acid solution, place on ice for 20 min, and then centrifuge at 12000 g for 15 min at 4 ℃, and retain the precipitate. The precipitate was washed three times with a mixture of 1 mL of ethyl acetate and ethanol (1:1), then resuspended in 800 μL of 6 M guanidine hydrochloride and 200 μL of PBS solution, incubated in a water bath at 37 °C for 15 min, centrifuged at 12000 g for 15 min, and the supernatant was collected. The absorbance at 370 nm was measured using a UV spectrophotometer.

[0047] Calculate using the following formula: Protein carbonyl content (nmol / mg prot) = (OD of test tube - OD of control tube) / [Extinction coefficient 22nmol / (L.cm) × colorimetric radius (cm) × sample protein concentration (mg / L)] × 125 × 105; 2.3 Determination of superoxide dismutase (SOD) activity (NBT method): Centrifuge at 8000 g for 3 min to collect *Streptomyces cinnamonis* cells; sonicate to disrupt cells; centrifuge at 12000 rpm, 4 ℃ for 8 min, collect the supernatant, and use the Coomassie brilliant blue method to determine the protein content in the supernatant; prepare sufficient clean test tubes, one for blank control zeroing, one for light control, and the rest for enzyme addition tubes, with 3 replicates per sample tube, and add the reaction reagents as listed in Tables 1 and 2; after shaking and mixing, place the control tube in the dark, and react the other tubes under fluorescent light for 20 min; after the reaction is complete, use the dark control tube to zero the spectrophotometer, and then measure the absorbance of each sample tube at 560 nm.

[0048] Table 1. Preparation of the Master Mix

[0049] Table 2 shows the reagents added to each tube.

[0050] 2.4 Detection of catalase (KATX) activity: Take 100 μL of the enzyme solution obtained by the above method, add 2.9 mL of PBS buffer, add 10 mM H2O2 when preparing the buffer, and react at 30 °C; measure the absorbance at 240 nm every minute for a total of 5 times. The blank control is the one without enzyme solution and is used for zeroing.

[0051] Enzyme activity (U / mL) = (ΔA) 240 / min×688), where ΔA 240 / min is the average of the absorbance differences between adjacent time points (taking the linear phase).

[0052] Example 1 according to ​ The following experiment was conducted using the procedure shown: (1) PCR amplification fragments and recovery Using the extracted genome of *Streptomyces cinnamon* as a template, ​ -F and ​ -R is the primer. PCR amplification was performed using the high-fidelity enzyme 2×Super Pfx Master Mix, yielding the result shown in SEQ ID No. 1. ​ Excerpt ( ​ ); Using the extracted genome of *Streptomyces cinnamon* as a template, ​ -F and ​-R is the primer. PCR amplification was performed using high-fidelity enzyme 2×Super Pfx Master Mix, yielding the result shown in SEQ ID No. 2. ​ Excerpt ( ​ ); Using pSET152 plasmid as a template and PF and PR as primers, reverse PCR amplification was performed using high-fidelity enzyme 2×Super PfxMaster Mix to obtain the linearized pSET152 plasmid fragment. (2) Gibson assembly The linearized carrier is respectively with ​ , ​ The two fragments were assembled using the Hieff Clone® Plus Multi One StepCloning Kit using Gibson assembly, yielding pSET152- ​ pSET152- ​ pSET152- ​ - ​ Recombinant vector.

[0053] (3) Bacterial transformation, colony PCR identification, and identification of binding transfer and recombinant plasmids The recombinant plasmid was transformed into E. coli JM109 competent cells, and positive clones were initially screened by PCR and sequenced for verification. The confirmed recombinant plasmid was further transformed into E. coli ET12567 / pUZ8002 donor bacteria. Subsequent intermolecular fusion transfer was performed. The donor bacteria were amplified in LB medium containing triple antibodies (Apr, Chl, Kan) and then washed with antibiotic-free LB medium containing MgCl2 to prepare the final product. Recipient strain SDSL6002, preservation number CGMCC No. 30409, was cultured on SM medium, and competent cells were prepared by repeatedly washing the mycelium with 2×YT medium. Donor and recipient bacterial strains were mixed at a 1:1 ratio and spread on antibiotic-free MS plates. After co-culturing at 30 °C for 18 h, the plates were covered with sterile water containing Na1 and Apr for resistance selection. After 7 days of culture, conjugates were picked, and genomic PCR was performed using 2×Taq MasterMix (Dye) to... ​ -F and ​ -R were used as primers to amplify the apramycin resistance marker. After verifying the positive strain, it was stabilized through three generations of relaxation culture on antibiotic-free slant medium, and spores were collected for preservation. The entire process was confirmed by DNA sequencing to ensure correct genome integration and successful construction of the overexpression strain.

[0054] ​ -F (SEQ ID No.11): GTGCAATACGAATGGCGAAA; ​ -R (SEQ ID No. 12): TCAGCCAATCGACTGGCGAG.

[0055] Ampramycin resistance marker amplification program: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 15 s, 30 cycles; final extension for 2 min.

[0056] Example 2 Effects of the KATX / SOD antioxidant system on monensin fermentation The fermentation process of *Streptomyces cinnamon* to produce monensin is lengthy, with a large number of cells dying in the later stages. It is speculated that oxidative damage to the cells during this later stage leads to mass cell death, affecting the potency level. Therefore, we measured cellular oxidative damage indicators (membrane lipid peroxidation and protein carbonylation) in *Streptomyces cinnamon* SDSL6002 at the early (96 h), middle (192 h), and late (288 h) stages of fermentation. The results are shown in Table 3, indicating significant oxidative damage in the later stages. The data in the table are the mean ± standard deviation of three parallel experiments, and the same applies below.

[0057] Table 3 Results of oxidative damage index determination for strains at different time points

[0058] The results obtained in Example 1 ​ overexpressing strain S- ​ , ​ overexpressing strain S- ​ as well as ​ and ​ Co-overexpression strain S- ​ - ​ The same tests were performed, and the results are shown in Tables 4, 5 and 6. It was found that oxidative damage was alleviated, and the potency of monensin was significantly improved in the later stages.

[0059] Table 4 S- ​ The test results of SDSL6002

[0060] Table 5 S- ​ The test results of SDSL6002

[0061] Table 6 S- ​ - ​ The test results of SDSL6002

[0062] Vitamin C (to neutralize hydroxyl radicals ·OH) and superoxide anion ·O2 were added during the fermentation culture of the original strain. - (etc.) and GSH (neutralizes hydroxyl radicals ·OH, hydrogen peroxide H2O2, lipid peroxide radicals LOO· etc.), and the detection of cell membrane lipid peroxidation and protein carbonylation also showed that they were overexpressed and respectively. ​ and ​ The genetically similar results demonstrate the effectiveness of constructing the KATX and SOD antioxidant system.

[0063] Table 7. Results of index measurement for SDSL6002 with external vitamin C.

[0064] Table 8. Measurement results of SDSL6002 with external GSH.

[0065] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for improving the antioxidant capacity of *Streptomyces cinnamon*, characterized in that, This includes genes encoding catalase and / or superoxide dismutase that are overexpressed in the genome of *Streptomyces cinnamon*.

2. The method according to claim 1, characterized in that, The gene encoding catalase includes katX The gene encoding the superoxide dismutase includes sod Gene.

3. The application of the method according to claim 1 or 2 in increasing the yield of monensin from *Streptomyces cinnamon*.

4. A recombinant vector with high antioxidant capacity, characterized in that, The recombinant vector is based on pSET152, on which genes encoding catalase and / or superoxide dismutase are linked.

5. The method for constructing the recombinant vector according to claim 4, characterized in that, Includes the following steps: (1) Using the genomic DNA of Streptomyces cinnamon as a template, amplify the encoding genes of catalase and / or superoxide dismutase; (2) The fragments amplified in step (1) are respectively or together ligated with the linearized pSET152 plasmid fragment to obtain the recombinant vector.

6. The construction method according to claim 5, characterized in that, The primer pair used in step (1) to amplify the coding gene for catalase includes the upstream primer with the nucleotide sequence shown in SEQ ID No.

3. katX -F and SEQ ID No. 4 katX -R; The amplification program included: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 63℃ annealing for 30 s, 72℃ extension for 34 s, 30 cycles; and 72℃ final extension for 4 min.

7. The construction method according to claim 5, characterized in that, The primer pair used in step (1) to amplify the superoxide dismutase encoding gene includes the upstream primer with the nucleotide sequence shown in SEQ ID No.

5. sod -F and SEQ ID No. 6 sod -R; The amplification program included: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 21 s, 30 cycles; and 72℃ final extension for 3 min.

8. The recombinant Streptomyces cinnamon obtained by transforming Streptomyces cinnamon with the recombinant vector of claim 4.

9. The application of the recombinant Streptomyces cinnamonii according to claim 8 in high-yield monensin production.

10. A method for producing monensin using the recombinant *Streptomyces cinnamon* as described in claim 8, characterized in that, The process includes the following steps: inoculating a single colony of the recombinant Streptomyces cinnamoninus into a seed culture medium and culturing it for a period of time to obtain a seed solution; The seed culture is inoculated into a fermentation medium for fermentation culture, and the fermentation broth contains the monensin.