Application of GmSIK1a gene and encoded protein thereof in regulation and control of soybean root development and Cd resistance
By knocking out or overexpressing the GmSIK1a gene in soybeans using CRISPR-Cas9 technology, soybean root development can be regulated to enhance or reduce its resistance to cadmium, solving the problem of soybean growth in cadmium-contaminated soil and providing new breeding gene targets.
Patent Information
- Application Number
- CN202511905260.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-17
- Publication Date
- 2026-02-24
AI Technical Summary
The resistance of soybeans to cadmium pollution is unknown in current technologies, and cadmium pollution affects the safe production of soybeans. There is a lack of effective gene regulation methods to improve the Cd resistance of soybeans.
By knocking out or overexpressing the soybean GmSIK1a gene using CRISPR-Cas9 editing technology, soybean root development can be regulated to enhance or reduce its resistance to cadmium. Specifically, this is achieved by performing base deletion or insertion operations at specific locations in the GmSIK1a gene to alter its function.
This study enabled the regulation of soybean root development, enhancing or reducing its resistance to cadmium, providing new gene targets for Cd resistance genetic breeding, and improving soybean growth in cadmium-contaminated soil.
Smart Images

Figure CN121555554A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and specifically relates to... GmSIK1a Application of genes and their encoded proteins in regulating soybean root development and Cd resistance. Background Technology
[0002] Soybeans Glycine max Soybeans (L.) Merr. provide humans with plant-based protein and oils, and also provide concentrated feed for animals, making them an important grain and oil crop. Therefore, soybean industry safety is a crucial factor affecting feed supply and food security in the livestock industry. Currently, soybean production can be increased by improving yield per unit area and expanding soybean planting area; however, soil in some regions faces Cd contamination, affecting safe soybean production. Therefore, breeding soybean varieties that can grow normally in Cd-contaminated soil (Cd-resistant) is a requirement for sustainable development.
[0003] To address soil cadmium (Cd) pollution, plants have developed multiple mechanisms to counteract its toxicity. These mechanisms primarily include: binding cadmium through chelation, isolating it in vacuoles, regulating cadmium uptake by transport proteins, and enhancing antioxidant mechanisms. Cadmium exposure triggers complex signaling mechanisms within plants, activating stress-related proteins and molecules. This activation initiates a series of responses to counteract the negative effects of cadmium stress. 2+ Induced signal transduction dysregulation manifests as permanent damage to the transduction module, leading to persistently low or high levels of second messengers that overwhelm signal transduction regulatory mechanisms. This interferes with cellular physiological functions, gene transcription, and regulation, potentially resulting in cell death and / or stress-induced adaptation and survival. Key signaling pathways include reactive oxygen species (ROS), MAPK (mitogen-activated protein kinase), calcium-calmodulin (Ca-CaM), and nitric oxide (NO) signaling pathways. These pathways work synergistically to regulate gene transcription, thereby enhancing plant detoxification and tolerance to cadmium (NO). et al. 2024 ).
[0004] MAP4Ks, or STE20 family kinases, function as core components of the Hippo signaling pathway, playing a crucial role in regulating various cellular processes, including organ size, cell proliferation, cell death, and stem cell self-renewal (Hergovich et al., 2006). Serine / threonine kinase 1 (SIK1), whose kinase domain is homologous to Hippo and MST1 / 2, regulates organ size through interaction with MOB1A. In Arabidopsis, SIK1 is a single-copy gene encoding a Ste20 family serine / threonine protein kinase with autophosphorylation activity. SIK1 is involved in the establishment of polarity in Arabidopsis thaliana, such as phyllotaxis and root gravitropism (Zhang P).et al .2021). SIK1 plays an active role in extracellular reactive oxygen species bursts and pathogenic immune responses (Zhang et al (2018), and suggested that it is involved in the jasmonic acid-induced gene expression process (Guo et al (2020).
[0005] To date, serine / threonine kinase 1 (SIK1) in the soybean genome has not been identified, and its function in soybean Cd resistance and accumulation remains unknown. Therefore, investigating the role of soybean serine / threonine kinase 1 (SIK1) in development and Cd resistance is of great significance. Summary of the Invention
[0006] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and provide soybean... GmSIK1a Application of genes or related biological materials in regulating soybean root development and Cd resistance.
[0007] Another objective of this invention is to provide a method for regulating soybean root development and Cd resistance.
[0008] Another object of the present invention is to provide a soybean GmSIK1a Gene mutants.
[0009] Another object of the present invention is to provide the soybean. GmSIK1a Application of gene mutants.
[0010] The objective of this invention is achieved through the following technical solution: soybeans GmSIK1a The application of genes or related biological materials in regulating soybean root development and Cd resistance, wherein the soybean... GmSIK1a The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.
[0011] The soybeans mentioned GmSIK1a Gene-related biological materials are any one or more combinations of the following biological materials: (1) Contains the above-mentioned soybeans GmSIK1a Gene expression cassettes; (2) Contains the above-mentioned soybeans GmSIK1a Recombinant gene expression vectors; (3) A recombinant expression vector containing the expression cassette described in (1); (4) Contains the above-mentioned soybeans GmSIK1a Recombinant bacteria; (5) Recombinant bacteria containing the expression cassette described in (1); (6) Recombinant bacteria containing the recombinant expression vector described in (2) or (3).
[0012] The soybeans mentioned GmSIK1a The gene annotation number in the phytozome database (https: / / phytozome-next.jgi.doe.gov / ) is: Glyma.01G061500 The nucleotide sequence of [ ] is shown in SEQ ID NO.1.
[0013] The regulation of soybean root development and Cd resistance is achieved through the following methods: (A) Knockout soybeans GmSIK1a Gene( GmSIK1a Gene mutations shorten the length of the primary root, reduce the number of lateral roots, and decrease the soybean's resistance to Cd. (B) Overexpression of soybean GmSIK1a Genes that increase the length of the primary root and the number of lateral roots enhance soybean's resistance to Cd.
[0014] (A) describes the knockout soybeans GmSIK1a Gene editing was achieved using CRISPR-Cas9 technology: Soybean genes were constructed using CRISPR-Cas9 editing technology. GmSIK1a Gene knockout vectors enable soybeans GmSIK1a Loss of gene function impairs root development in soybean plants and reduces soybean resistance to Cd.
[0015] The aforementioned knockout soybean GmSIK1a Gene selection is achieved through the following methods: (a) In soybeans GmSIK1a The gene (SEQ ID NO.1) has a 20-base deletion from position 296 to position 315 in its coding region: “TCGGCGCCGAGGATGACGGC”. (b) In soybeans GmSIK1a The gene (SEQ ID NO.1) has a deletion of 5 bases "CGTCT" from position 242 to position 246 in its coding region, and an insertion of 1 base "T" between positions 301 and 302.
[0016] This invention also provides soybeans GmSIK1a Application of genes or related biological materials in soybean genetic breeding (preparation of transgenic soybeans, improvement of soybean varieties).
[0017] A method for regulating soybean root development and Cd resistance, achieved through any of the following means: (i) By knocking out soybeans GmSIK1a Genes, reducing soybean GmSIK1a The biological function of the gene or its encoded protein can shorten the length of the primary root, reduce the number of lateral roots, and decrease the resistance of soybean to Cd. (ii) By using soybeans GmSIK1a The gene is integrated into the soybean genome, making the soybean GmSIK1a The gene is expressed in soybeans, increasing the length of the primary root, increasing the number of lateral roots, and improving soybeans' resistance to Cd.
[0018] A type of soybean GmSIK1a A gene mutant is any one of the following: (a) In soybeans GmSIK1a The gene (SEQ ID NO.1) has a 20-base deletion from position 296 to position 315 in its coding region: “TCGGCGCCGAGGATGACGGC”. (b) In soybeans GmSIK1a The gene (SEQ ID NO.1) has a deletion of 5 bases "CGTCT" from position 242 to position 246 in its coding region, and an insertion of 1 base "T" between positions 301 and 302.
[0019] Contains the soybean GmSIK1a Expression cassettes of gene mutants, recombinant expression vectors, or recombinant bacteria.
[0020] The soybeans mentioned GmSIK1a Gene mutants, through GmSIK1a Gene mutation (knockout) GmSIK1a In a genetic manner, the main root of soybean plants becomes shorter, the number of lateral roots decreases, the total root length becomes shorter, Cd poisoning is aggravated, and the soybean's resistance to Cd is reduced.
[0021] The soybeans mentioned GmSIK1a Gene mutants and / or soybeans containing the above GmSIK1a Applications of gene mutant expression cassettes, recombinant expression vectors, or recombinant bacteria in regulating soybean Cd resistance, soybean root development, or soybean genetic breeding.
[0022] The preferred soybean variety is Huachun 6 (HC6).
[0023] The present invention has the following advantages and effects compared with the prior art: This invention discovers through experiments that soybeans GmSIK1a Genes that positively regulate Cd resistance in soybeans: gene editing knockout GmSIK1a A knockout mutant was obtained, which had a shorter taproot length, fewer lateral roots, and a shorter total root length. Under Cd stress, compared with the WT mutant, the mutant plants were stunted, had reddish leaf bases, and exhibited overall leaf curling. Therefore, GmSIK1a The gene is a positive regulator of Cd resistance. Enhancing its expression can improve Cd resistance in soybeans and provide new gene targets for genetic breeding of Cd-resistant soybeans. Attached Figure Description
[0024] Figure 1 As described in the embodiments of the present invention GmSIK1a Target location map of gene knockout mutant lines.
[0025] Figure 2 As described in the embodiments of the present invention GmSIK1a Sequencing peak diagram for target detection in gene knockout mutant lines.
[0026] Figure 3 As described in the embodiments of the present invention GmSIK1a Gene knockout mutant ( gmsik1a-1, gmsik1a-2 (a) Photographs of plant phenotypes; where a) is the root morphology phenotype of GmSIK1a gene knockout mutant and WT(HC6) under normal hydroponic conditions; b) is the root phenotype of WT(HC6) and knockout mutant after being transferred to Cd(30 μM) solution for one week of hydroponic culture; c) is the leaf phenotype of WT(HC6) and knockout mutant after being transferred to Cd(30 μM) solution for one week of hydroponic culture; d) is the stem phenotype of WT(HC6) and knockout mutant after being transferred to Cd(30 μM) solution for one week of hydroponic culture. Detailed Implementation
[0027] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed according to conventional experimental conditions or experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention are commercially available.
[0028] In one aspect of the invention, soybeans are provided. GmSIK1a Application of genes and their encoded proteins in regulating soybean resistance to low Cd accumulation. (The soybean mentioned...) GmSIK1a The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.2. The regulation is positive, enhancing soybean... GmSIK1 The biological function of the gene or its encoded protein enhances soybean resistance to Cd; by reducing the amount of soybean... GmSIK1 The biological function of the gene or the protein it encodes reduces the resistance of soybeans to Cd.
[0029] soybeans GmSIK1a Gene (SEQ ID NO.1): soybeans GmSIK1a The protein sequence encoded by the gene (SEQ ID NO.2): .
[0030] Example 1 GmSIK1a Construction and functional verification of knockout mutant plants one, GmSIK1a Obtaining homozygous knockout mutant plants 1.1 The knockout mutant in this embodiment is based on the commercially available soybean variety Huachun 6 (HC6), and was knocked out using CRISPR-Cas9 gene editing technology. GmSIK1a The knockout mutant material was outsourced to Wuhan Aidijing Biotechnology Co., Ltd. In the T generation, gene mutations were detected to identify homozygous mutants for seed harvesting. Homozygous T2 generation plants were used for Cd treatment to investigate traits. Homozygous knockout mutants were detected using both polypropylene gel electrophoresis and sequencing. After obtaining T0 generation transgenic seedlings, DNA was extracted from leaves. Primers provided by the company were used to amplify the fragments, which were then sequenced. The mutation type of the transgenic seedlings was analyzed based on the sequencing peak diagram. T0 generation seeds were harvested and labeled with the mutation type. For T1 and T2 generations, primers were designed based on the mutation type identified in the T0 generation to amplify the target fragments. Polypropylene gel electrophoresis was used for detection. Homozygous plants were identified based on the control bands. One or two plants with homozygous bands were selected and sent to the company for sequencing to ensure the correct homozygous plants were selected.
[0031] 1.1.1 Extraction of DNA from soybean leaves using the CTAB method: (1) Preparation of 2% CTAB extract: Weigh 4 g CTAB (hexadecyltrimethylammonium bromide), 16.34 g NaCl, and 1.48 g EDTA. . Add 2Na2H2O to 20 mL of 1 mol / L Tris-HCl solution, and then dilute to 200 mL with distilled water.
[0032] (2) Use tweezers to take an appropriate amount of green soybean leaves (which can be taken from any stage of T0, T1 or T2 generation) into a 2 mL centrifuge tube, add grinding beads, grind into powder under liquid nitrogen, add 600 μL 2% CTAB extraction solution, heat in a 65℃ metal bath for 15 min, and mix by inverting for 7.5 min.
[0033] (3) After the sample is taken out and cooled to room temperature, add an equal volume of chloroform / isoamyl alcohol mixture (chloroform:isoamyl alcohol = 24:1, v / v), mix by inverting, and centrifuge at 12000 r / min for 5 min at 4 ℃.
[0034] (4) Prepare a 1.5 mL centrifuge tube, take 450 μL of supernatant, add an equal volume (450 μL) of pre-cooled pure isoamyl alcohol solution, mix by inverting, centrifuge at 12000 r / min for 2 min at 4 ℃, discard the supernatant and keep the precipitate.
[0035] (5) Wash the precipitate 2 to 3 times with 70% ethanol solution, centrifuge at 12000 r / min for 1 min each time, and then invert the centrifuge tube overnight to dry.
[0036] (6) Add 70-100 μL of sterile water to dissolve the DNA, shake at room temperature for use or store at -20 ℃ for a long time.
[0037] 1.1.2 PCR amplification The PCR amplification system was a GenStar 2× Taq dye premixed PCR system. The PCR reaction volume (10 μL) is shown in Table 1; the PCR reaction program is shown in Table 2.
[0038] There are two target sites for knockout: T1 and T2. The detection primer sequences are as follows: T1F: 5′-CGACAAAGCAGCCCAAAACA-3′ (SEQ ID NO.3); T1R: 5′-TCCACTTCCCTTCCTCTGCT-3′ (SEQ ID NO.4); T2F: 5′-CGTACGCGACAATGGTGTTC-3′ (SEQ ID NO.5); T2R: 5′-AGTTCGTCACAAATCACAACAGT-3′ (SEQ ID NO. 6).
[0039] Table 1
[0040] Reaction procedure: Table 2
[0041] Note: The Tm annealing temperature and time can be adjusted according to the size of the amplified product.
[0042] 1.1.3 Electrophoretic detection The polyacrylamide gel electrophoresis procedure can be performed according to the reference (Bassam, BJ, Caetano-Anolles, G., Gresshoff, PM, 1991. Fast and sensitive silverstaining of DNA in polyacrylamide gels. Anal. Biochem. 196, 80–83. https: / / doi.org / 10.1016 / 0003-2697(91)90120-I). The concentration of polyacrylamide is selected according to the difference in PCR amplification products. Generally, 6% non-denaturing polyacrylamide is used for differences of more than 3 bases, and 10% non-denaturing polyacrylamide gel is used for differences of less than 3 bases.
[0043] The formula for polyacrylamide gel mother liquor is as follows: 6% stock solution (8 L capacity): 1000 g urea, 500 g acrylamide, 26 g N,N-methylenebisacrylamide, 5.952 g EDTA (ethylenediaminetetraacetic acid), 44 g boric acid, 86.4 g Tris (tris(hydroxymethyl)aminomethane), and diluted with pure water to 8 L. 10% stock solution (2 L): 256 g urea, 182.4 g acrylamide, 9.6 g N,N-methylenebisacrylamide, 213.4 mL 10×TBE, diluted to 2 L with pure water; 10×TBE buffer (5 L): 540 g Tris, Na2EDTA . 37.2 g of 2H2O, 275 g of boric acid, and diluted with pure water to a final volume of 5 L.
[0044] 1.1.4 Test Results Two types of homozygous mutant lines were obtained through T2 generation screening and named... gmsik1a-1 and gmsik1a-2 See [link to mutation type and target detection details] Figure 1 , Figure 2 Two homozygous mutants with different mutation types were obtained, both of which were base deletion mutations. Both deletion types resulted in partial deletions and changes in subsequent amino acids. gmsik1a-1 :exist GmSIK1a The T2 target site in the gene coding region (SEQ ID NO.1) has 20 bases deleted from position 296 to position 315: “TCGGCGCCGAGGATGACGGC”.
[0045] gmsik1a-2 :exist GmSIK1a The T1 target site in the gene coding region (SEQ ID NO.1) has a deletion of 5 bases "CGTCT" from position 242 to position 246, and a insertion of 1 base "T" between positions 301 and 302 of the T2 target site.
[0046] II. Validation of Knockout Mutants GmSIK1a Function 2.1 Select plump, insect-free Huachun 6 (HC6) and homozygous knockout mutants ( gmsik1a-1 and gmsik1a-2 Seedlings were cultured in a substrate for one week, and their characteristics were investigated under hydroponic and Cd-contaminated soil conditions. The specific steps are as follows: 2.1.1 Soybean seedlings were raised in a light incubator (12 h light, 12 h dark, 25 ℃, 80% humidity) for one week. Seedlings with uniform growth were selected, and their roots were rinsed clean with tap water. Lateral roots were spread out with tweezers and photographed. ImageJ and Rhizo Vision Explorer software were used to analyze the images to obtain the taproot length and the number of lateral roots. Three replicates were performed for each variety.
[0047] 2.1.2 Transfer soybean seedlings of uniform growth to 6 L gray plastic buckets, and add Hogland's nutrient solution (5 mM Ca(NO3)2, 5 mM KNO3, 1 mM KH2PO4, 1 mM MgSO4, 50 μM H3BO3, 4.5 mM MnCl2, 3.8 μM ZnSO4, 0.3 mM CuSO4, 0.1 mM (NH4)6Mo7O4 at a volume ratio of 1:1000. 24 The cultures were incubated with 50 μM Fe-EDTA and two treatments: a control (CK) and a treatment with Cd (30 μM CdCl2). Each variety was tested in triplicate. Phenotypic results were observed and photographed after 7 days of incubation.
[0048] 2.1.3 Select seedlings with uniform growth and transplant them to Cd-contaminated soil (CdCl2 was added directly to the soil, and the Cd concentration in the soil was 22.025 mg / kg). Plant 3 seedlings per pot, with 3 replicates for each variety. Observe the Cd poisoning phenotype of the plants regularly.
[0049] 2.1.4 Results Compared to wild-type WT, the two soybean mutants gmsik1a-1, gmsik1a-2 The root lengths all become shorter, mainly manifested in shorter taproots and fewer lateral roots, resulting in a shorter total root length. Figure 3 (a in Table 3). Under hydroponic conditions, compared with WT, the mutant plants under Cd stress were dwarfed ( Figure 3 d) Root development damage ( Figure 3 (b) The base of the leaves turns red and the entire plant's leaves curl. Figure 3 (c in the text)
[0050] Table 3 HC6 and GmSIK1a Root phenotypic differences in knockout mutants
[0051] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. Soybeans GmSIK1a The application of genes or related biological materials in regulating soybean root development and Cd resistance, characterized by: The soybeans mentioned GmSIK1a The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; The soybeans mentioned GmSIK1a Gene-related biological materials are any one or more combinations of the following biological materials: (1) Contains the above-mentioned soybeans GmSIK1a Gene expression cassettes; (2) Contains the above-mentioned soybeans GmSIK1a Recombinant gene expression vectors; (3) A recombinant expression vector containing the expression cassette described in (1); (4) Contains the above-mentioned soybeans GmSIK1a Recombinant bacteria; (5) Recombinant bacteria containing the expression cassette described in (1); (6) Recombinant bacteria containing the recombinant expression vector described in (2) or (3).
2. The application according to claim 1, characterized in that: The soybeans mentioned GmSIK1a The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
3. The application according to claim 1, characterized in that, The regulation of soybean root development and Cd resistance is achieved through the following methods: (A) Knockout soybeans GmSIK1a Genes that shorten the main root length, reduce the number of lateral roots, and decrease soybean resistance to Cd; (B) Overexpression of soybean GmSIK1a Genes that increase the length of the primary root, increase the number of lateral roots, and improve soybean resistance to Cd.
4. The application according to claim 3, characterized in that, The aforementioned knockout soybean GmSIK1a Genes are achieved through the following methods: (a) In soybeans as shown in SEQ ID NO.1 GmSIK1a The gene coding region contains a 20-base deletion from position 296 to position 315: "TCGGCGCCGAGGATGACGGC"; (b) In soybeans as shown in SEQ ID NO.1 GmSIK1a Five bases "CGTCT" are deleted from position 242 to position 246 of the gene coding region, and one base "T" is inserted between positions 301 and 302.
5. The soybean as described in claim 1 GmSIK1a Application of genes or related biological materials in soybean genetic breeding.
6. A method for regulating soybean root development and Cd resistance, characterized in that, This can be achieved through any of the following methods: (i) By knocking out soybeans GmSIK1a Genes, reducing soybean GmSIK1a The biological functions of the gene or its encoded protein can shorten the length of the primary root, reduce the number of lateral roots, and decrease the resistance of soybean to Cd. (ii) By using soybeans GmSIK1a Gene integration into the soybean genome enables soybeans GmSIK1a The gene is expressed in soybeans, increasing the length of the taproot, increasing the number of lateral roots, and improving soybeans' resistance to Cd; The soybeans mentioned GmSIK1a The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
7. A type of soybean GmSIK1a Gene mutants, characterized by, It can be any of the following: (a) In soybeans as shown in SEQ ID NO.1 GmSIK1a The gene coding region contains a 20-base deletion from position 296 to position 315: "TCGGCGCCGAGGATGACGGC"; (b) In soybeans as shown in SEQ ID NO.1 GmSIK1a Five bases "CGTCT" are deleted from position 242 to position 246 of the gene coding region, and one base "T" is inserted between positions 301 and 302.
8. Containing the soybean as described in claim 7 GmSIK1a Expression cassettes of gene mutants, recombinant expression vectors, or recombinant bacteria.
9. The soybean according to claim 7 GmSIK1a Gene mutants and / or soybeans containing the characteristics of claim 7 GmSIK1a Applications of gene mutant expression cassettes, recombinant expression vectors, or recombinant bacteria in regulating soybean Cd resistance, soybean root development, or soybean genetic breeding.
10. The application according to claim 9, characterized in that: The soybean variety mentioned is Huachun 6.