ZNF318 gene molecular marker related to pig backfat thickness character and application of ZNF318 gene molecular marker

Abstract

The invention discloses a ZNF318 gene molecular marker related to a pig backfat thickness character and application of the ZNF318 gene molecular marker, and belongs to the technical field of molecular genetics. According to the invention, a mutation site g.38376064 (Ggt; A) significantly associated with the backfat thickness of 100 kg of a pig is screened and identified in a CDS region of the ZNF318 gene. Based on the mutation site g.38376064 (Ggt; a), a ZNF318 gene molecular marker and a detection primer pair related to the pig backfat thickness character are designed, according to the genotype of the ZNF318 gene molecular marker at the SNP site, the 100 kg backfat thickness character of the pig can be accurately identified, a pig individual with the large backfat thickness or a pig individual with the small backfat thickness is selected according to actual needs, and the pig individual with the large backfat thickness or the small backfat thickness is selected according to the actual needs. And beneficial help is provided for pig breeding work.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to a ZNF318 gene molecular marker associated with the backfat thickness trait in pigs and its application. Background Technology

[0002] Fat deposition directly affects the growth and meat production performance of pigs. Pigs contain various types of adipose tissue, primarily including subcutaneous fat, mesenteric fat, intestinal fat, intramuscular fat, and visceral fat. Backfat is subcutaneous adipose tissue, mainly deposited below the dermis and above the longissimus dorsi muscle on the back of the pig, and is composed of triglycerides. Backfat thickness is an important indicator for evaluating carcass lean meat percentage, fattening effect, and reproductive performance. Increased backfat thickness in fattening pigs can improve the intramuscular fat content, flavor, and juiciness of the longissimus dorsi muscle, thus affecting pork quality. Maintaining backfat thickness during the reproductive cycle can increase the number of live births and 48-hour live piglets in sows, shorten the weaning-to-estrus interval, and improve sow reproductive efficiency. However, excessive backfat thickness can reduce lean meat percentage and feed conversion efficiency, leading to increased breeding costs. Therefore, precise control of pig backfat thickness is of great significance for improving the meat production performance, production performance, and reproductive efficiency of pigs.

[0003] Molecular marker-assisted selection (MMR) breeding selects for target traits at the molecular level, unaffected by environmental influences. It leverages genetic background selection, reducing linkage redundancy and accelerating the breeding process with increased precision. ZNF318, by binding to DNA-binding proteins, can enhance the expression levels of certain genes, thereby affecting an organism's growth, development, and metabolic regulation. Gene expression is the result of multi-level regulation, encompassing processes from gene transcription activation to protein translation. Therefore, research on pigs... ZNF318 SNPs in the CDS region of a gene can help identify meaningful molecular markers, providing a favorable theoretical basis for marker-assisted selection breeding in pigs. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a ZNF318 gene molecular marker related to the backfat thickness trait in pigs and its application.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a ZNF318 gene molecular marker associated with the backfat thickness trait in pigs, the nucleotide sequence of which is shown in SEQ ID NO.1; the 117th base of the sequence shown in SEQ ID NO.1 is an SNP site, and its base is G or A. Specifically: TCCCTACCCTCTTCAGCTCCAGCCGTAAAGCTAGAATCAATAGAAGAGACCAATCCAGAATATGCCAAGATTCATGATTTGCTCAAGACCATAGGGCTGGATATTGGAGTAGCAGA[G / A]ATTAGTAAACTGGCTGCACGAACCCAGGAACGACTTCA.

[0006] Note: "[G / A]" in the sequence represents an SNP site, which is indicated by "n" in the sequence listing.

[0007] In a second aspect, the present invention provides the application of the above-mentioned ZNF318 gene molecular marker in either (1) or (2) below: (1) Identify the back fat thickness of pigs; (2) Pig genetics and breeding.

[0008] In the above applications, individuals with the ZNF318 gene molecular marker having the genotype AA at the SNP site have a corrected backfat thickness of 100kg that is higher than that of individuals with the genotype GA or GG at the SNP site.

[0009] A third aspect of the present invention provides primer pairs for detecting the ZNF318 gene molecular marker described above, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively. Specifically: P-ZNF318-F: TCCCTACCCTCTTCAGCTCC; (SEQ ID NO.2) P-ZNF318-R:TGAAGTCGTTCCTGGGTTCG. (SEQ ID NO.3) In a fourth aspect, the present invention provides a kit for detecting the ZNF318 gene molecular marker described above, the kit comprising the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3.

[0010] A fifth aspect of the invention provides the use of the above primer pairs and / or kits in the following (1) or (2): (1) Identify the back fat thickness of pigs; (2) Pig genetics and breeding.

[0011] A sixth aspect of the present invention provides a method for identifying the backfat thickness trait of pigs at a corrected weight of 100 kg, comprising the following steps: Using the genomic DNA of the pigs to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the corrected 100kg backfat thickness trait of the pigs was identified based on the sequencing results.

[0012] Specifically, if the sequencing result corresponds to an individual with the AA genotype at position 117 of the sequence shown in SEQ ID NO.1, its corrected backfat thickness at 100kg is higher than that of an individual with the GA or GG genotype at position 117 of the sequence shown in SEQ ID NO.1.

[0013] The beneficial effects of this invention are: This invention identified a mutation site g.38376064 (G>A) in the CDS region of the ZNF318 gene that is significantly associated with backfat thickness at 100 kg in pigs. Based on this mutation site g.38376064 (G>A), this invention designed a molecular marker and detection primer pair for the ZNF318 gene associated with the backfat thickness trait in pigs. According to the genotype of the ZNF318 gene molecular marker at the SNP site, the backfat thickness trait at 100 kg in pigs can be accurately identified. Pigs with large or small backfat thickness can be selected according to actual needs, providing beneficial assistance to pig breeding work. Detailed Implementation

[0014] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0015] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0016] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein: Correcting the backfat thickness at 100kg: "Backfat thickness" is one of the indicators for evaluating pork quality traits. When the experimental pigs reached a weight of about 100kg, the backfat thickness was measured using an ultrasonic backfat measuring instrument at the point between the 3rd and 4th ribs from the bottom, 6-8 cm from the midline of the back. This is the actual measured backfat thickness.

[0017] The calculation method for "correcting back fat thickness for 100kg" is as follows: Corrected back fat thickness (mm) for 100kg = Measured back fat thickness (mm) + [100 − Measured weight (kg)] × b; b: Correction coefficient for backfat thickness of Large White pigs, with a value of 0.114.

[0018] Example 1: Screening and identification of ZNF318 gene mutation sites associated with backfat thickness in pigs 1. Test materials: The experimental material used in this study consisted of 2061 Large White pigs, which were raised under identical standard conditions, showed no open wounds or other signs of disease or injury, and exhibited no abnormal behavior. Blood samples were collected using the anterior vena cava method, with sodium citrate (ACD) as anticoagulant at a ratio of 6:1. After cryopreservation, the samples were brought back to the laboratory for genomic DNA extraction.

[0019] 2. Test methods: (1) Extraction and detection of porcine genomic DNA: ① Take 500 μL of frozen blood, thaw it at room temperature, add the same volume of buffer solution, and mix well.

[0020] ②Place the mixture in a centrifuge and centrifuge at 4℃ and 12000rpm for 10 minutes.

[0021] ③ Remove the upper plasma layer, add 500 μL of DNA extraction solution, and agitate the mixture until there is no precipitate. Then, place the mixture in a water bath at 37°C for 1 hour.

[0022] ④ After heating, remove the solution and cool it to room temperature. Then add an equal volume of Tris-saturated phenol and gently shake the centrifuge tube to promote mixing. Continue this process for ten minutes until the mixture becomes homogeneous and emulsion-like.

[0023] ⑤ Place the above mixture in a centrifuge and centrifuge at 4°C and 12,000 rpm for 10 minutes.

[0024] ⑥ Transfer the supernatant to a new centrifuge tube, add an equal volume of phenol:chloroform:isoamyl alcohol mixture, and gently shake for ten minutes to ensure thorough mixing.

[0025] ⑦ Place the mixture back into the centrifuge and centrifuge at 4°C and 12,000 rpm for 10 minutes.

[0026] ⑧ Remove the supernatant and transfer it to a new centrifuge tube. Add 3M sodium acetate and anhydrous ethanol, rotate the centrifuge tube horizontally, and when white flocculent DNA precipitate appears, freeze it at -80°C for one hour.

[0027] 9. Remove the DNA, thaw it, and transfer it to a new centrifuge tube. Wash it twice with 70% ethanol and allow the remaining ethanol to evaporate completely at room temperature. Dissolve the DNA in an appropriate amount of TE buffer, aliquot the solution, and store for later use.

[0028] DNA concentration was measured using a spectrophotometer. Genomic DNA was extracted from 2061 samples and detected by spectrophotometer and agarose gel electrophoresis. The sample A260 / A280 ratio was 1.7-1.9, and the bands were clear and without tails, meeting the experimental requirements.

[0029] (2) Low-depth sequencing and genotyping: Low-depth whole-genome resequencing was performed on the extracted genomic DNA to initially obtain numerous SNP loci. Using genome annotation information, SNPs located in gene coding regions (CDS regions) and potential regulatory regions (such as promoters, 5′ regulatory regions, and 3′ regulatory regions) were screened. Then, population genetic association analysis was performed to calculate the significance (P-value) of these loci with corrected 100kg backfat thickness. Finally, combined with functional prediction analysis, the focus was on loci located in the CDS region that might affect amino acid coding or protein structure and function.

[0030] The selected research loci were analyzed using MassARRAY SNP genotyping technology (integrating multiplex PCR, MassARRAY iPLEX single base extension, and MALDI-TOF-MS technology).

[0031] 3. Test Results: Based on the above screening, located in ZNF318 The locus g.38376064 (G>A) in the CDS region of gene (Gene ID: 100153069) was selected as the study locus due to its highly significant association with the corrected 100kg backfat thickness trait (P<0.01). (1) ZNF318 Distribution of genotype and allele frequencies of the mutation site g.38376064 (G>A) in the CDS region of the gene in Large White pigs. For those screened and identified in Example 1 ZNF318 The distribution of genotype and allele frequencies of the mutation site g.38376064 (G>A) in the CDS region of the gene was analyzed in a Large White pig population, and the results are shown in Table 1.

[0032] Table 1: Genotype and allele frequencies of the g.38376064 (G>A) polymorphic site The results showed that the dominant allele at the g.38376064 (G>A) locus was G in Large White pigs.

[0033] (2) ZNF318 Association analysis between the mutation site g.38376064 (G>A) in the CDS region of the gene and corrected backfat thickness at 100kg. right ZNF318 The mutation site g.38376064 (G>A) in the CDS region of the gene was correlated with the corrected backfat thickness of 100kg. The results are shown in Table 2.

[0034] Table 2: Polymorphism analysis of site g.38376064 (G>A) and its correlation with corrected 100kg backfat thickness Note: The data in the table are "least square mean ± standard error". Significant differences exist between means marked with different letters in the same column at the same locus. P <0.05).

[0035] . P <0.05. AE is an abbreviation for additive effect, and DE is an abbreviation for dominant effect.

[0036] The results show that: ZNF318 A base mutation exists at locus g.38376064 in the CDS region of the gene; different genotypes at this locus are significantly correlated with the corrected backfat thickness at 100 kg. The corrected backfat thickness at 100 kg in pigs with the AA genotype is 1.36 mm and 1.83 mm thicker than that in pigs with the GA and GG genotypes, respectively. P <0.05). Therefore, intentionally increasing the number of AA-type pigs in a population through this marker method is an effective measure to increase backfat thickness. For groups with low backfat thickness, this measure will increase their backfat thickness. This molecular marker method can achieve early selection.

[0037] Example 2: Molecular marker of ZNF318 gene associated with backfat thickness in pigs and its application verification 1. Molecular markers and primer design for the ZNF318 gene associated with backfat thickness in pigs: For the ZNF318 gene CDS region mutation site g.38376064 (G>A) identified in Example 1 as being associated with the backfat thickness trait in pigs, a ZNF318 gene molecular marker containing this mutation site was further designed, and its nucleotide sequence is shown in SEQ ID NO.1. The 117th base in the sequence is an SNP site, and its base is G or A.

[0038] Primer pairs were designed using Primer Premier 5.0 software to detect the ZNF318 gene molecular marker. The primer pair sequences are as follows: P-ZNF318-F: TCCCTACCCTCTTCAGCTCC; (SEQ ID NO.2) P-ZNF318-R:TGAAGTCGTTCCTGGGTTCG. (SEQ ID NO.3) 2. Application Validation: Another 100 Large White pigs with a corrected backfat thickness of 100 kg were selected as experimental animals. Genomic DNA was extracted from these animals and PCR amplification was performed using the primer pairs described above. The PCR reaction system consisted of: 12.5 μL of 2×Phanta Max buffer, 0.5 μL of dNTP Mix (10 mM each), 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 1 μL of DNA template, 1 μL each of primers P-TJAP1-F and P-TJAP1-R, and 8.5 μL of ddH2O, for a total of 25 μL.

[0039] The PCR reaction conditions were as follows: 110℃ top; 95℃ for 3 min; 95℃ for 15 sec, 60℃ for 15 sec, 72℃ for 60 sec (extension program was 60 s / kb) for 35 cycles; 72℃ for 5 min.

[0040] The amplified products were sequenced, and the corrected 100kg backfat thickness trait in pigs was predicted and identified based on the sequencing results. If the sequencing result corresponds to an individual with the AA genotype at position 117 of the sequence shown in SEQ ID NO.1, their corrected backfat thickness at 100kg is higher than that of an individual with the GA or GG genotype at position 117 of the sequence shown in SEQ ID NO.1.

[0041] The predicted identification results were compared with the actual recorded 100kg backfat thickness information. The results showed that the predicted results of correcting the 100kg backfat thickness based on the genotype of the mutation site were consistent with the actual recorded results, indicating that the ZNF318 gene molecular marker related to the growth traits of Large White pigs in this invention is accurate and reliable.

[0042] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A ZNF318 gene molecular marker associated with the backfat thickness trait in pigs, characterized in that, The nucleotide sequence of the ZNF318 gene molecular marker is shown in SEQ ID NO.1; the 117th base of the sequence shown in SEQ ID NO.1 is an SNP site, and its base is G or A.

2. The application of the ZNF318 gene molecular marker according to claim 1 in either (1) or (2) below: (1) Identify the back fat thickness of pigs; (2) Pig genetics and breeding.

3. The application according to claim 2, characterized in that, Individuals with the ZNF318 gene molecular marker having the genotype AA at the SNP locus have a higher backfat thickness per 100 kg than individuals with the genotype GA or GG at the SNP locus.

4. A primer pair for detecting the ZNF318 gene molecular marker as described in claim 1, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

5. A kit for detecting the ZNF318 gene molecular marker as described in claim 1, characterized in that, The kit contains the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.

3.

6. The use of the primer pair of claim 4 and / or the kit of claim 5 in (1) or (2) below: (1) Identify the back fat thickness of pigs; (2) Pig genetics and breeding.

7. A method for identifying the backfat thickness of a 100kg pig, characterized in that, Includes the following steps: Using the genomic DNA of the pig to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the backfat thickness trait of 100kg pigs was identified based on the sequencing results.

8. The method according to claim 7, characterized in that, If the sequencing result corresponds to an individual with the AA genotype at position 117 of the sequence shown in SEQ ID NO.1, their backfat thickness at 100kg is higher than that of an individual with the GA or GG genotype at position 117 of the sequence shown in SEQ ID NO.1.

Images