A primer set for identifying a brassica oleracea nuclear male sterility gene and application of a molecular marker

By applying primer sets and molecular markers, PCR amplification and polypropylene gel electrophoresis were used to identify the male sterility gene in broccoli cell nuclei, solving the identification problem in existing technologies, achieving efficient and accurate fertility determination, and reducing resource waste.

CN121555671BActive Publication Date: 2026-04-28SHANGHAI ACAD OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI ACAD OF AGRI SCI
Filing Date
2025-11-03
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

In existing technologies, it is difficult to efficiently and accurately identify recessive nuclear male sterile lines of broccoli cell nuclear male sterility genes, resulting in the need to remove 50% of fertile plants during seed production, leading to serious waste of resources.

Method used

A primer set and molecular marker are provided to identify the male sterility gene in broccoli cell nuclei by PCR amplification and polypropylene gel electrophoresis. The genomic DNA of the sample to be tested is amplified using the first and second primer pairs, and fertility is determined based on the number of bands.

Benefits of technology

It enables efficient and accurate identification of broccoli fertility, reduces labor and physical costs, solves the problem of pulling out fertile plants in seed production, and reduces resource waste.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121555671B_ABST
    Figure CN121555671B_ABST
Patent Text Reader

Abstract

The patent discloses a primer group for identifying a broccoli nuclear male sterility gene and application of a molecular marker, and belongs to the technical field of biology. The primer group comprises a first primer pair and a second primer pair, each primer pair comprises a forward primer and a reverse primer, and sequences of the forward primer of the first primer pair, the reverse primer of the first primer pair, the forward primer of the second primer pair and the reverse primer of the second primer pair are sequentially shown as SEQ ID NO:1 to SEQ ID NO:4 in a sequence table. The primer group and the application of the molecular marker can efficiently and accurately identify the fertility of broccoli, solve the problem that 50% of fertile plants need to be pulled out in seed production, and reduce the cost of manpower and material resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to the field of biotechnology, and in particular to a primer set and molecular marker application for identifying male sterility genes in broccoli cell nuclei. Background Technology

[0002] Broccoli (Brassica oleracea L. var. italica Plenck) is a globally popular vegetable belonging to the Brassica genus of the Brassicaceae family. The florets of broccoli are rich in protein, vitamins, and minerals, especially glucosinolates such as sulforaphane and their metabolites, which have anti-cancer properties. Therefore, it is highly favored by consumers worldwide and is known as the "crown of vegetables." Currently, broccoli production bases exist throughout China and are showing a rapid increase in numbers.

[0003] Broccoli exhibits strong heterosis, and male-sterile lines are the primary means of utilizing this heterosis. Male-sterile lines can be divided into two categories: cytoplasmic male-sterile lines (CMS) and nuclear male-sterile lines (GMS). Compared to cytoplasmic male-sterile lines, nuclear male-sterile lines are characterized by stable fertility, no negative effects, ease of conversion, and a wide range of restorers. Nuclear male-sterile lines can be further divided into recessive and dominant nuclear male-sterile lines. The use of recessive nuclear male-sterile lines in seed production faces the challenge of needing to remove 50% of fertile plants. Therefore, molecular markers are commonly used for identification.

[0004] Molecular marker genotyping technology has advantages such as being unaffected by environmental factors, having a short testing cycle, and enabling high-throughput sequencing analysis, and has been widely used in marker-assisted breeding research. However, the number of known recessive nuclear male sterility genes is currently limited, which hinders the identification of molecular markers and makes the seed production process still plagued by the challenge of removing 50% of fertile plants.

[0005] Public content

[0006] To address the problems of existing technologies, this disclosure provides a primer set and molecular marker application for identifying male sterility genes in broccoli cell nuclei. The technical solution is as follows:

[0007] On the one hand, this disclosure provides a primer set for identifying the male sterility gene in broccoli cells. The primer set includes a first primer pair and a second primer pair. Each primer pair includes a forward primer and a reverse primer. The sequences of the forward primer of the first primer pair, the reverse primer of the first primer pair, the forward primer of the second primer pair, and the reverse primer of the second primer pair are shown in SEQ ID NO: 1 to SEQ ID NO: 4 in the sequence listing, respectively.

[0008] On the other hand, this disclosure provides an application of molecular markers for identifying nuclear male sterility genes in broccoli cells, the application including: using the molecular markers to identify nuclear male sterility genes in broccoli cells, the molecular markers including chr5.444812 and chr5.422041, the starting point of the molecular markers being 445461, and the ending point of the molecular markers being 1154905.

[0009] Specifically, the application includes: identifying the male sterility gene in broccoli cells using a primer set, wherein the primer set includes: a first primer pair and a second primer pair, each primer pair including a forward primer and a reverse primer, and the sequences of the forward primer of the first primer pair, the reverse primer of the first primer pair, the forward primer of the second primer pair, and the reverse primer of the second primer pair are shown in sequence as SEQ ID NO: 1 to SEQ ID NO: 4 in the sequence listing.

[0010] Specifically, the applications include:

[0011] The genomic DNA of the sample to be tested was amplified by PCR using the primer set to obtain PCR amplification products;

[0012] The PCR amplification products were subjected to polypropylene gel electrophoresis to obtain the bands of the amplification products;

[0013] If there is one band, the sample is fertile; if there are two bands, the sample is male-sterile.

[0014] Specifically, if there are two bands, then the fertility of the sample to be tested is recessive nuclear male sterile broccoli.

[0015] The beneficial effects of the technical solution provided in this disclosure are as follows: This disclosure provides a primer set and molecular marker application for identifying the male sterility gene in broccoli cells. The primer set can be used to amplify the amplified products obtained by PCR, and the amplified products can be detected by polypropylene gel electrophoresis to obtain the bands of the amplified products. The fertility trait of broccoli can be judged based on the bands of the amplified products: if there is one band, it indicates that the sample to be tested is fertile; if there are two bands, it indicates that the sample to be tested is male sterile. The application of the primer set and molecular marker can efficiently and accurately identify the fertility of broccoli, solve the problem of needing to remove 50% of fertile plants in seed production, reduce manpower and physical costs, and at the same time reduce resource waste. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This is a polypropylene gel electrophoresis image of the amplification of the first primer pair provided in Embodiment 2 of this disclosure;

[0018] Figure 2 This is a polypropylene gel electrophoresis image of the amplification of the second primer pair provided in Embodiment 3 of this disclosure. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below with reference to the accompanying drawings.

[0020] Example 1

[0021] This disclosure provides a primer set for identifying a male sterility gene in broccoli cells. The primer set includes a first primer pair and a second primer pair. Each primer pair includes a forward primer and a reverse primer. The sequences of the forward primer of the first primer pair, the reverse primer of the first primer pair, the forward primer of the second primer pair, and the reverse primer of the second primer pair are shown sequentially as SEQ ID NO: 1 to SEQ ID NO: 4 in the sequence listing. Specifically, the Indel-14 sequence of the forward primer of the first primer pair is: GGTGTTCCTTGTCTTGTTTCTCAG; the Indel-14 sequence of the reverse primer of the first primer pair is: TGTTCCATCTCTCTCTCTCTCTCTCT; the Indel-15 sequence of the forward primer of the second primer pair is: AATTAGAGTGGTCTTTGATACATGA; and the Indel-15 sequence of the reverse primer of the second primer pair is: ATGTAGGTAGAGACTTACAGTCCA.

[0022] Example 2

[0023] This disclosure provides an application of molecular markers for identifying a broccoli nuclear male sterility gene. The application includes using molecular markers to identify the broccoli nuclear male sterility gene. The molecular markers include chr5.444812 and chr5.422041. This broccoli nuclear male sterility gene is located on chromosome C05 within the interval 445461kb-1154905kb. Molecular marker chr5.444812 exhibits G / GAA polymorphism, and molecular marker chr5.422041 exhibits T / TAA polymorphism.

[0024] Specifically, the application includes: identifying the male sterility gene in broccoli cells using the primer set provided in Example 1. The primer set includes: a first primer pair and a second primer pair. Each primer pair includes a forward primer and a reverse primer. The sequences of the forward primer of the first primer pair, the reverse primer of the first primer pair, the forward primer of the second primer pair, and the reverse primer of the second primer pair are shown in SEQ ID NO: 1 to SEQ ID NO: 4 in the sequence listing, respectively.

[0025] Specifically, the application includes: using a first primer pair to perform PCR amplification of the genomic DNA of the sample to be tested, and obtaining PCR amplification products;

[0026] In this embodiment, 21 individual plants from the F2 generation population obtained by crossing Y37S with the normal fertile broccoli inbred line B50 were used as test samples. These test samples were sown, raised as seedlings, and then individually numbered (1-24 in this embodiment). When the plants had two true leaves, leaves were taken from each plant, and genomic DNA was extracted from each sample using the conventional CTAB method. The obtained genomic DNA was stored at -20℃ for later use. The broccoli nuclear male sterile line Y37S provided in this embodiment is a naturally mutated male sterile plant discovered in the inbred line Y37 (preserved at the Shanghai Academy of Agricultural Sciences).

[0027] The concentration of genomic DNA was detected using a micro-volume nucleic acid protein analyzer, and water was added to dilute the concentration of genomic DNA to 5 ng.

[0028] In the PCR amplification reaction, the PCR amplification reaction system is 10 μL, the sample to be tested is 1 μL (concentration is 5 ng), the PCR enzyme is 5 μL, the ddH2O is 1 μL, and each primer in the primer set is 0.5 μL.

[0029] The PCR amplification reaction conditions were as follows: pre-denaturation at 95℃ for 5 min; followed by 32 cycles, each cycle including: denaturation at 95℃ for 30 s; annealing at 55℃~60℃ (optimal 58℃, 58℃ was used in this example) for 30 s; extension at 72℃ for 30 s; and extension at 72℃ for 5 min.

[0030] The PCR amplification products were subjected to 8% polypropylene gel electrophoresis to obtain the amplification product bands.

[0031] In this embodiment, the 8% polypropylene gel was prepared as follows: 32 mL of 10×TAE buffer, 500 μL of 10% ammonium persulfate (APS) solution, and 100 μL of coagulant were mixed thoroughly and allowed to stand for 30 minutes to allow for complete polymerization. After the polypropylene gel had completely solidified, it was fixed in an electrophoresis tank. The sample volume was 1 μL, and electrophoresis was performed at a constant voltage for 50 minutes.

[0032] After electrophoresis, the polypropylene gel was stained with silver nitrate staining solution for 15 minutes. The silver nitrate staining solution is obtained by dissolving 1.2 g of silver nitrate in 500 mL of double-distilled water. It was then rinsed 2-3 times with deionized water and transferred to a colorimetric solution until the polypropylene gel turned pale yellow. After removing it, it was placed in distilled water to visualize the bands.

[0033] If there is one band, the sample is fertile; if there are two bands, the sample is recessive nuclear male sterile; specifically, if there are two bands, the sample is recessive nuclear male sterile broccoli.

[0034] Combination Figure 1 It can be seen that the test samples numbered 1 to 21 provided in this embodiment are all broccoli nuclear male sterile lines Y37S. Among them, the number of bands in samples numbered 6, 9, 10, 12, 18 and 21 are all one, so they are fertile. The amplification products of the remaining broccoli nuclear male sterile lines Y37S all have two bands, so they are male sterile. The amplification results of the above-mentioned test varieties are consistent with the field traits of the corresponding test materials. It can be seen that the primer set and molecular markers provided in this embodiment can efficiently and accurately identify the fertility of broccoli.

[0035] Example 3

[0036] The difference between this embodiment and Embodiment 2 is that: a backcross population of 10 broccoli nuclear male sterile line Y37S was used as the test sample. The test sample was sown, raised as seedlings, and then divided into individual plants and numbered. In this embodiment, the above materials were numbered sequentially from 1 to 15. When the plant had two true leaves, leaves were taken from each plant. Genomic DNA was extracted from the test sample using the conventional CTAB method. The obtained genomic DNA was stored at -20℃ for later use.

[0037] The genomic DNA of the sample to be tested was amplified by PCR using the second primer to obtain the PCR amplification product. The remaining steps were the same as in Example 2.

[0038] Combination Figure 2 It can be seen that the test samples numbered 1 to 10 provided in this embodiment are all backcross populations of the broccoli nuclear male sterile line Y37S. Among them, the number of bands in samples numbered 1, 2, 4, 5, 8 and 10 are all one, so the fertility is fertile. The amplification products of the other broccoli nuclear male sterile line Y37S backcross populations all have two bands, so the fertility is male sterile. The amplification results of the above-mentioned test varieties are consistent with the field traits of the corresponding test materials. It can be seen that the primer set and molecular markers provided in this embodiment can efficiently and accurately identify the fertility of broccoli.

[0039] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. The application of a primer set for identifying male sterility genes in broccoli cells, characterized in that, The application includes: using the primer set to perform PCR amplification on the genomic DNA of the sample to be tested, and obtaining PCR amplification products. The primer set includes: a first primer pair and a second primer pair. Each primer pair includes a forward primer and a reverse primer. The sequences of the forward primer of the first primer pair, the reverse primer of the first primer pair, the forward primer of the second primer pair, and the reverse primer of the second primer pair are shown in SEQ ID NO: 1 to SEQ ID NO: 4 in the sequence listing, respectively. The PCR amplification products were subjected to polypropylene gel electrophoresis to obtain the bands of the amplification products; If there is one band, the sample to be tested is fertile; if there are two bands, the sample to be tested is nuclear male sterile.

2. The application according to claim 1, characterized in that, If there are two bands, then the fertility of the sample to be tested is recessive nuclear male sterile broccoli.

Citation Information

Patent Citations

  • Universal SSR marker tightly linked with dominant genic male sterility genes in broccoli

    CN105420357A

  • PCR primer and kit for screening brassica oleracea recessive cell nucleus male sterility and application thereof

    CN109609684A