Sequence and method for quantitatively detecting wild type of transgenic maize
By using specifically designed nucleic acid sequences and real-time quantitative PCR amplification, the problem of rapid and accurate detection of wild-type transgenic maize in existing technologies has been solved, realizing an efficient and low-cost detection method suitable for large-scale sample processing.
Patent Information
- Application Number
- CN202511914835.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-18
- Publication Date
- 2026-02-24
AI Technical Summary
Existing technologies are insufficient for rapidly, sensitively, and specifically identifying wild-type individuals in genetically modified maize populations in seed purity testing, field isolation inspections, and product composition monitoring.
A specially designed combination of nucleic acid sequences was used, combined with real-time quantitative PCR amplification, and primer pairs and probes were used for detection. Genomic DNA was extracted using the magnetic bead method, and the presence of wild-type maize was determined based on the Ct value.
It achieves detection with high sensitivity, low false positive and false negative risks, reduces operational complexity and cost, is suitable for rapid processing of large-scale samples, and supports high-throughput screening.
Smart Images

Figure CN121555679A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant biotechnology detection technology, and in particular to a method for quantitatively detecting the sequence of wild-type transgenic maize. Background Technology
[0002] Maize (Zea mays L.) is one of the world's most important food crops, feed sources, and industrial raw materials, and its yield is directly related to global food security and the stable development of the agricultural economy. With population growth and consumption upgrades, higher demands are being placed on maize yield, quality, and stress resistance. Traditional breeding techniques are insufficient to meet these rapidly growing needs, while modern biotechnology, especially transgenic technology, provides a powerful tool for maize genetic improvement. By introducing specific exogenous genes, maize can be significantly endowed with excellent agronomic traits such as insect resistance, herbicide resistance, stress resistance, and improved nutritional quality. This is of paramount strategic importance for reducing production costs, minimizing pesticide use, protecting the ecological environment, and ensuring food security.
[0003] Currently, several transgenic maize transformants have been approved for commercial planting and application globally, each with its own advantages and playing an important role in global maize production. For example: 1. MON810: Developed by Monsanto (now part of Bayer), it is one of the first and most widely used transgenic transformants commercially. By introducing the Cry1Ab gene from Bacillus thuringiensis (Bt), it enables maize to specifically resist lepidopteran pests (such as the European corn borer), effectively reducing yield loss and pesticide use. 2. NK603: Developed by Monsanto, it is a representative transformant of herbicide-resistant maize. By introducing a modified cp4 epsps gene, it exhibits high tolerance to glyphosate herbicides, allowing for effective weed control during the growing season, thereby simplifying cultivation, protecting soil, and increasing yield. 3. Bt11 + GA21: A transformant developed by Syngenta. Bt11 possesses both insect resistance (Cry1Ab) and herbicide resistance (pat gene, resistance to glyphosate). GA21, through the introduction of a modified mepsps gene, confers high levels of resistance to glyphosate. 4. MIR162: Developed by Syngenta, focusing on pest control. It carries the Vip3Aa20 gene, producing the Vip3 protein, effectively controlling various lepidopteran pests, including the fall armyworm. Its mechanism of action differs from the Cry protein, aiding in pest resistance management. 5. DBN9936: A domestically developed innovative transformant by Beijing Dabeinong Biotechnology Co., Ltd. This transformant also combines insect resistance and herbicide resistance. Through the introduction of the Cry1Ab and epsps genes, it enables corn to effectively control lepidopteran pests while also exhibiting tolerance to glyphosate herbicides.
[0004] With the widespread planting of genetically modified maize with these combined traits (such as insect resistance and herbicide resistance), they often exist in the field in the form of "colony". In order to ensure biosafety, meet the labeling management system, and carry out precise offspring selection, it is urgent to develop a technology that can accurately distinguish and identify whether non-genetically modified (wild-type) maize individuals are mixed in their population.
[0005] DBN9936 is an important variety in the commercialization of genetically modified maize in my country. Although existing detection methods exist for DBN9936 genetically modified maize, they mostly target exogenous inserted sequences, making it difficult to rapidly, sensitively, and specifically identify wild-type individuals in a genetically modified background in applications such as seed purity testing, field isolation inspections, and product composition monitoring. Therefore, this paper proposes a sequence and method for quantitative detection of wild-type genetically modified maize. Summary of the Invention
[0006] To address the technical problems existing in the prior art, this invention provides a method for quantitatively detecting the sequence of wild-type transgenic maize.
[0007] This invention is achieved using the following technical solution: a sequence for quantitative detection of wild-type transgenic maize, wherein the nucleic acid sequence includes sequence group A or sequence group B or at least one of them; The sequence group A includes a primer pair with sequences SEQ ID NO. 1 and SEQ ID NO. 2 and a probe with sequence SEQ ID NO. 3; The sequence group B includes a primer pair with sequences SEQ ID NO. 4 and SEQ ID NO. 5 and a probe with sequence SEQ ID NO. 6; The nucleic acid sequence was detected using real-time quantitative PCR amplification reaction to detect genomic DNA. The fluorescent reporter group of the probe is FAM, and the fluorescent quencher group of the probe is BHQ1.
[0008] As a further improvement to the above scheme, the PCR amplification reaction system includes reaction reagents and sample DNA. The reaction reagents include QPCRMix, primer pairs, and probes, wherein the component ratio of QPCRMix, primer pairs, and probes is 40-60:1.5-3:1.
[0009] A method for quantitatively detecting the sequence of wild-type transgenic maize includes the following steps: S1. Select the sample to be tested and extract the genomic DNA to be tested from the sample using a magnetic bead method kit; S2. Perform PCR amplification on the extracted genomic DNA using nucleic acid sequences, collect fluorescence signals, and calculate Ct values; S3. Determine whether wild-type maize exists in the DBN9936 population containing transgenic maize based on the calculated Ct value.
[0010] As a further improvement to the above scheme, in step S2, the PCR amplification reaction conditions are: 37℃ for 2 min; 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s; 60℃ extension for 30 s; 45 cycles.
[0011] As a further improvement to the above scheme, in step S3, if Ct≤36, it is determined that there is a wild-type maize DNA sample, indicating that the population containing transgenic maize event DBN9936 is mixed with wild-type maize; if Ct>36, it is determined that there is no wild-type maize DNA sample, indicating that the population containing transgenic maize event DBN9936 is not mixed with wild-type maize.
[0012] Application of a nucleic acid sequence in identifying wild-type maize in the DBN9936 population and in assisted selection breeding.
[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention designs a detection system based on the specific sequences of endogenous genes in maize, which can effectively eliminate interference from non-target sequences and closely related species, resulting in a clear background and significantly reducing the risk of false positives and false negatives, thus ensuring the accuracy of the detection results.
[0014] This invention employs real-time fluorescence PCR technology, which has extremely high detection sensitivity. Furthermore, the technology platform is highly automated and the operation process is standardized, greatly reducing the reliance on the technical skills of operators and making it suitable for rapid and parallel processing of large-scale samples.
[0015] Compared with traditional single-sample detection methods, this invention innovatively establishes a highly efficient mixed-sample detection method. This method can simultaneously screen multiple samples in a single reaction, significantly reducing the amount of reagents and consumables used, experimental operation time, and manpower input. Thus, it provides strong technical support for high-throughput screening of wild-type single plants in the breeding and industrialization process, significantly reduces the cost of single-sample detection, and has important application value and market prospects. Attached Figure Description
[0016] Figure 1 The graph shows the detection curves of fluorescent probe amplification reactions of 14 different wild-type maize materials using two sets of detection primers in Example 2 of this invention. Figure 2 A graph showing the detection results of primer pairs for H6271 and 6ACSS0615 and their backcross progeny transgenic pure lines 2 in Example 3 of the present invention; Figure 3A graph showing the detection results of primer pairs for H9601A and HP2166 and their backcross progeny transgenic pure lines 2 in Example 3 of the present invention; Figure 4 A graph showing the primer detection results of X244-1 and its backcross progeny transgenic pure line 2 in Example 3 of the present invention; Figure 5 A graph showing the sensitivity detection of wild-type concentration in Example 4 of this invention; Figure 6 This is a graph showing the sensitivity detection of wild-type mass fraction in Example 4 of the present invention. Figure 7 The graph shows the primer species specificity detection in Example 5 of this invention. Detailed Implementation
[0017] The present invention will now be further described in conjunction with the accompanying drawings and specific embodiments. It should be noted that, without conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments.
[0018] Example 1
[0019] This embodiment describes a sequence for quantitative detection of wild-type transgenic maize. Fluorescent quantitative primers are designed using sequences that do not contain the inserted DBN9936 transgenic event in the nucleic acid sequence at positions 8370626–8370743 of chromosome 9. The aim is to accurately screen individual plants without the DBN9936 transgenic event from a maize population containing the DBN9936 transgenic event.
[0020] The nucleic acid sequence includes sequence group A or sequence group B, or at least one of them; Sequence group A includes a primer pair with sequences SEQ ID NO. 1 and SEQ ID NO. 2 and a probe with sequence SEQ ID NO. 3; Sequence group B includes a primer pair with sequences SEQ ID NO. 4 and SEQ ID NO. 5 and a probe with sequence SEQ ID NO. 6; Nucleic acid sequences were detected using real-time quantitative PCR (qPCR) amplification. The PCR amplification reaction system included reaction reagents and sample DNA. The reaction reagents included qPCRMix, primer pairs, and probes, with a component ratio of 40-60:1.5-3:1. The fluorescent reporter group of the probe is FAM, and the fluorescent quencher group of the probe is BHQ1; wherein: SEQ ID NO:1 is: qDBN9936N-L1: GAGCGACGGSAAATGAAAG SEQ ID NO:2 is: qDBN9936N-R1:CGTCTTGTACTACTGTGCTGAG SEQIDNO:3 is: qDBN9936N-P1: FAM-AAATAGGAAACAGGAAAGGAGACCCGC-BHQ1 SEQ ID NO:4 is: qDBN9936N-L9: ACAGACCCGAAGCGACGG SEQ ID NO:5 is: qDBN9936N-R9: CGTCTTGTACTACTGTGCTGAGG SEQ ID NO: 6 is: qDBN9936N-P9: FAM-TGAAAGCGAGGCGAGGCG-BHQ1.
[0021] A method for quantitatively detecting the sequence of wild-type transgenic maize includes the following steps: S1. Select the sample to be tested and extract the genomic DNA to be tested from the sample using a magnetic bead method kit: S2. Perform PCR amplification on the extracted genomic DNA using nucleic acid sequences, collect fluorescence signals, and calculate Ct values; The PCR amplification conditions were: 37℃ for 2 min; 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ extension for 30 s, for 45 cycles. S3. Determine whether wild-type maize exists in the DBN9936 population containing transgenic maize based on the calculated Ct value; if Ct≤36, wild-type maize DNA samples are found, indicating that wild-type maize is mixed in the DBN9936 population containing transgenic maize; if Ct>36, wild-type maize DNA samples are not found, indicating that wild-type maize is not mixed in the DBN9936 population containing transgenic maize.
[0022] Example 2
[0023] Design and screening of primers for qDBN9936N fluorescent probe Nucleic acid sequences from positions 8370382 to 8370763 on chromosome 9 of Zm-B73-REFERENCE-NAM-5.0 were retrieved from MaizeGDB. Compared with the sequences at both ends of the DBN9936 transformant inserted into the maize genome, a deletion exists, with positions 8370572 to 8370650. Specific primers were then designed near the deleted sequence. First, based on probe design principles, highly conserved sequences were selected as probes using BLAST. Then, specific amplification primers were designed based on the designed probes. Finally, two primer sets were designed using NCBI: SEQ ID NO. 1-SEQ ID NO. 3 constituted primer set 1, and SEQ ID NO. 4-SEQ ID NO. 6 constituted primer set 2, as shown in Table 1. Table 1 shows the primer design for quantitative fluorescence.
[0024] Fluorescent probe amplification reactions were performed on 14 different wild-type maize materials using the two sets of detection primers mentioned above. The different wild-type maize materials are shown in Table 2. The reaction system consisted of 7.5 μL of reaction reagent and 2.5 μL of DNA template, with the reaction reagent comprising 5 μL of PCR Mix, 0.2 μL each of F / R primers (10 μM), 0.1 μL of probe (10 μM), and 2 μL of ddH₂O. The amplification program was: 37℃ for 2 min; 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s; 60℃ extension for 30 s; 45 cycles.
[0025] Test results as follows Figure 1 As shown in the graphs, the amplification effects of primer sets 1 and 2 are both clear, indicating that the amplification effects of primer sets 1 and 2 meet expectations. Therefore, this invention determines that primer sets 1 and 2 will be used as the primer sets for detecting different experiments in the following embodiments.
[0026] Table 2 shows the detection results of DBN9936N fluorescent probe primers on different parental materials:
[0027]
[0028] Example 3: Different populations of DBN9936 transgenic DNA were detected using qDBN9936N fluorescent quantitative primers. The materials containing the DBN9936 transformant in this embodiment are shown in Table 3. A method for quantitatively detecting the sequence of wild-type transgenic maize specifically includes the following steps: S1. Nucleic acid extraction: After sampling (seeds or leaves), genomic DNA of the maize to be tested was extracted using a self-made magnetic bead method kit; S2. Preparation of the real-time PCR reaction system and amplification: 7.5 μL of reaction reagent and 2.5 μL of DNA template, wherein the reaction reagent is prepared according to the following formula: 5 μL PCRMix, 0.2 μL each of F / R primers (10 μM), 0.1 μL P probe (10 μM), and 2 μL ddH2O. The maize reaction system to be tested is placed in a real-time PCR amplification instrument for amplification. The amplification program is: 37℃ for 2 min; 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s; 60℃ extension for 30 s; 45 cycles. During this period, the PCR instrument collects fluorescence signals and calculates the Ct value. S3. Result Judgment: The principle for valid determination is that if the Ct value of the endogenous gene detection in the sample is ≤32 and a typical exponential amplification curve appears; and the Ct value of the positive control is ≤36 and a typical exponential amplification curve appears, and the negative control and blank control have no Ct value, then the result is determined to be valid; otherwise, the result is determined to be invalid and should be retested.
[0029] The principle for judging the test results is as follows: under the premise of valid judgment, if Ct≤36, it is determined that there is a wild-type maize DNA sample, indicating that the DBN9936 population containing transgenic maize is mixed with wild-type maize; if Ct>36, it is determined that there is no wild-type maize DNA sample, indicating that the DBN9936 population containing transgenic maize is not mixed with wild-type maize.
[0030] Table 3 shows the detection of different populations of DBN9936 transgenic DBN9936 using quantitative fluorescent primers.
[0031]
[0032] Each sample was performed in triplicate. Figures 2-4 It can be seen that the parent lines all showed typical peak amplification curves, while the transgenic inbred lines after backcrossing did not produce obvious amplification curves. The results indicate that the primer combination detection of the present invention can effectively distinguish between wild-type and DBN9936 transgenic populations.
[0033] Example 4
[0034] Sensitivity detection using DBN9936N fluorescent quantitative primers First, prepare wild-type DNA at a concentration of 50 ng / µl, according to the concentration ratios in Table 4 (using ddH2O to dilute the wild-type material). A total of nine concentrations were set: 50, 25, 10, 5, 2, 1, 0.5, 0.2, and 0.1 µl. Each concentration was used in triplicate. Amplification was then detected as follows... Figure 5 As shown.
[0035] Table 4 shows the experimental ratio of concentration sensitivity for DBN9936N fluorescent quantitative primers in detecting wild-type cells.
[0036] The test results showed that both primer pairs could amplify normal curves in the wild-type concentration range of 50 ng / ul to 0.2 ng / ul, and the Ct value was ≤36 at concentrations above 0.2 ng / ul.
[0037] According to the production testing standards, DNA at a concentration of 20 ng / µl was prepared for both wild-type and transgenic materials. The concentrations were prepared according to the concentration ratios in Table 5 (using transgenic materials to dilute wild-type materials). Ten wild-type concentration ratios were set: 100%, 50%, 25%, 10%, 5%, 2%, 1%, 0.5%, 0.2%, and 0.1%. Each concentration ratio was tested in triplicate. The results are as follows: Figure 6 As shown.
[0038] Table 5 shows the sensitivity experimental ratio for detecting the mass fraction of wild-type cells using DBN9936N fluorescent quantitative primers.
[0039]
[0040] The results showed that when the sample concentration was 20 ng / ul, a wild-type concentration of 0.2% or higher was sufficient to determine the presence of the wild-type. When the wild-type concentration was below 0.2%, multiple repeated experiments were required, and the determination was based on a combination of Ct values and amplification curves.
[0041] Example 5
[0042] Specific detection of N-DBN9936 fluorescent quantitative primers Three varieties each of rice (ZH11, Huanghuazhan, Huaxiaxiangsi), soybean (W8Z, Jiyu68, Zhonghuang35), cotton (Siduke, JIN668, Longkadan), and rapeseed (ZS11, H5, ZY50) were sampled. DNA was extracted from each variety and diluted to 20 ng / µl. DNA from the same species was then mixed as a template to prepare a quantitative real-time reaction system. Three replicates were performed, and specificity detection was conducted according to the method described in Example 2. The detection results are as follows: Figure 7 As shown, only maize exhibited a typical peak amplification curve; rice, soybean, rapeseed, and cotton did not produce obvious amplification curves, indicating that the primer combination had good species specificity.
[0043] This invention designs a detection system targeting specific sequences of maize endogenous genes, effectively eliminating interference from non-target sequences and closely related species, resulting in a clear background and significantly reducing the risk of false positives and false negatives, thus ensuring the accuracy of the detection results. It employs quantitative real-time PCR technology, which boasts extremely high detection sensitivity and a highly automated platform with standardized operating procedures, greatly reducing reliance on skilled operators and making it suitable for rapid, parallel processing of large-scale samples. Compared to traditional single-sample detection methods, this invention innovatively establishes a highly efficient pooled-sample detection method. This method allows for simultaneous initial screening of multiple samples in a single reaction, significantly reducing reagent and consumable usage, experimental time, and manpower input. Therefore, it provides strong technical support for high-throughput screening of wild-type single plants in breeding and industrialization processes, significantly reducing the cost of single-sample detection and possessing significant application value and market potential.
[0044] The above embodiments are merely preferred embodiments of the present invention and should not be construed as limiting the scope of protection of the present invention. Any non-substantial changes and substitutions made by those skilled in the art based on the present invention shall fall within the scope of protection claimed by the present invention.
Claims
1. A sequence for quantitative detection of wild-type transgenic maize, characterized in that, The nucleic acid sequence includes sequence group A or sequence group B, or at least one of them; The sequence group A includes a primer pair with sequences SEQ ID NO. 1 and SEQ ID NO. 2 and a probe with sequence SEQ ID NO. 3; The sequence group B includes a primer pair with sequences SEQ ID NO. 4 and SEQ ID NO. 5 and a probe with sequence SEQ ID NO. 6; The nucleic acid sequence was detected using real-time quantitative PCR amplification reaction to detect genomic DNA. The fluorescent reporter group of the probe is FAM, and the fluorescent quencher group of the probe is BHQ1.
2. The sequence for quantitative detection of wild-type transgenic maize as described in claim 1, characterized in that, The PCR amplification reaction system includes reaction reagents and sample DNA. The reaction reagents include QPCRMix, primer pairs, and probes, wherein the component ratio of QPCRMix, primer pairs, and probes is 40-60:1.5-3:
1.
3. The detection method for quantitatively detecting the sequence of wild-type transgenic maize as described in claim 1, characterized in that, Includes the following steps: S1. Select the sample to be tested and extract the genomic DNA to be tested from the sample using a magnetic bead method kit; S2. Perform PCR amplification on the extracted genomic DNA using nucleic acid sequences, collect fluorescence signals, and calculate Ct values; S3. Determine whether wild-type maize exists in the DBN9936 population containing transgenic maize based on the calculated Ct value.
4. The detection method as described in claim 3, characterized in that, In step S2, the PCR amplification reaction conditions are: 37℃ for 2 min; 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s; 60℃ extension for 30 s; 45 cycles.
5. The detection method as described in claim 3, characterized in that, In step S3, if Ct≤36, it is determined that there is a wild-type maize DNA sample, indicating that the DBN9936 population containing transgenic maize is mixed with wild-type maize; if Ct>36, it is determined that there is no wild-type maize DNA sample, indicating that the DBN9936 population containing transgenic maize is not mixed with wild-type maize.
6. The application of the nucleic acid sequence as described in claim 1 in identifying the wild type in the DBN9936 population containing transgenic maize and in assisted selection breeding.