SNP molecular marker related to southern rust resistance gene RPPM and application
By developing T/C base polymorphism SNP molecular markers and primers on the short arm of maize chromosome 10, the problem of difficulty in identifying maize resistance to southern rust in existing technologies has been solved, enabling efficient and accurate selection of breeding materials and improving the accuracy and efficiency of the breeding process.
Patent Information
- Application Number
- CN202511945257.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-22
- Publication Date
- 2026-02-24
AI Technical Summary
Existing technologies are insufficient to efficiently and accurately identify the maize southern rust resistance gene RPPM, resulting in poor material selection during breeding. Furthermore, molecular marker-assisted selection is limited by specific materials and variations in gene diversity.
A SNP molecular marker located on the short arm of chromosome 10 of maize was developed with a base polymorphism of T/C. Specific primers were designed for PCR amplification and KASP (competitive allele-specific PCR) typing. Combined with genotype, the resistance or susceptibility of maize materials was determined.
It enables highly accurate and efficient identification of maize materials resistant to southern rust, and features high throughput, low cost, and ease of automation, thus improving the accuracy and efficiency of breeding.
Smart Images

Figure CN121555680A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to SNP molecular markers related to the southern rust resistance gene RPPM and their applications. Background Technology
[0002] Maize (Zea mays L.), the world's most widely planted crop used for industrial raw materials, feed, food, and energy, is susceptible to various biological stresses that can lead to yield losses. Southern rust is a parasitic fungal disease caused by Puccinia polysora. With the increasing frequency of extreme weather events in recent years, high temperatures and humidity, which are conducive to the survival of pathogen spores, coupled with summer typhoons and other weather conditions that facilitate the rapid long-distance spread of pathogen spores, yield losses in maize due to southern rust infection have become a significant phenotype. Therefore, breeding maize varieties resistant to southern rust is one of the breeding goals pursued by contemporary breeders.
[0003] In modern conventional maize breeding, disease resistance is a crucial factor in determining the value of breeding materials. With the development of molecular-assisted breeding technology, disease resistance evaluation has evolved from directly using pathogens to assess infection to using molecular markers for assisted selection. However, due to the variations in physiological races of the southern rust pathogen, molecular marker-assisted selection is limited to specific materials or inbred lines. Furthermore, as a phenotype regulated by multiple genes, with the discovery and cloning of southern rust resistance genes, a single molecular marker is insufficient to comprehensively evaluate the entire breeding system. Therefore, it is necessary to develop appropriate molecular detection methods for different resistant materials, utilizing relevant resistance genes.
[0004] To date, several genes for resistance to southern rust in corn have been cloned or located, including Rpp1, Rpp11 , RppM, RppK RppD, RppS, RppQ, RppC While genes can be identified, the limited effectiveness of molecular detection methods for certain material populations leads to significant discrepancies with actual phenotypes, rendering the work ineffective. RppM This gene is one of the key genes for maize resistance to southern rust and was successfully cloned in 2020. It is located on the short arm of chromosome 10 in maize. Related research indicates that... RppM It exhibits broad-spectrum and durable resistance to multiple physiological races of *Russula multiflora*. Due to... RppM Genes show high similarity in resistant and susceptible materials. Although there are a large number of SNP sites, very few sites can be identified efficiently and accurately in natural populations because most of the SNP sites are invalid or have minimal differences. Therefore, the development of efficient and accurate molecular markers and their detection methods has great economic value in breeding services. Summary of the Invention
[0005] To solve the above-mentioned technical problems, firstly, the present invention provides a gene related to resistance to southern rust. RPPM The relevant SNP molecular marker is located at position 522 of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphism of T / C.
[0006] SEQ ID NO.1: When the genotype of the SNP molecular marker is T / T homozygous or T / C heterozygous, the maize material is a disease-resistant gene type; when the genotype of the SNP molecular marker is C / C homozygous, the maize material is a susceptible gene type.
[0007] Secondly, the present invention provides primers for amplifying the SNP molecular marker.
[0008] Preferably, the forward primer is shown in SEQ ID NO.2 or SEQ ID NO.3, and the reverse primer is shown in SEQ ID NO.4.
[0009] Thirdly, this invention provides a southern rust gene. RPPM The genotyping kit contains the primers described above.
[0010] Fourthly, the present invention provides the use of the SNP molecular marker, the primer, or the kit in at least one of the following aspects: (1) Genes that resist southern rust RPPM Genotyping; (2) Detection of southern rust resistance genes in maize materials RPPM ; (3) Marker-assisted breeding of maize; (4) Maize breeding resistant to southern rust.
[0011] Fifthly, this invention provides a southern rust gene. RPPM The genotyping method includes: using the genomic DNA of the maize material to be tested as a template, performing a PCR amplification reaction using the primers described above, and identifying the southern rust gene based on the SNP molecular markers described above. RPPM Genotyping was performed to determine whether the maize material under test had resistance to southern rust.
[0012] When the genotype of the SNP molecular marker is T / T homozygous or T / C heterozygous, the maize material is a disease-resistant gene type; when the genotype of the SNP molecular marker is C / C homozygous, the maize material is a susceptible gene type.
[0013] Preferably, the reaction conditions for the PCR amplification reaction are as follows: Pre-denaturation at 94℃ for 15 minutes; First step amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 67℃-61℃ for 60 seconds, 10 Touch Down cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; Second step amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 61℃ for 60 seconds, 26 cycles; If the genotyping effect is poor due to DNA problems, add 3 more cycles, with the reaction program being denaturation at 94℃ for 20 seconds, annealing and extension at 60℃ for 60 seconds, but the additional cycle step should not be performed more than 3 times.
[0014] Preferably, the PCR reaction system contains Taq polymerase and Mg 2+ , buffer material, dNTPs, DNA template and said primers.
[0015] Sixthly, the present invention provides a maize breeding method, comprising: selecting maize with resistance to southern rust according to the genotyping method for subsequent breeding.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention has successfully developed a gene that can combat southern rust. RPPM The SNP sites, primers, and detection methods of this invention enable the identification of maize materials resistant to southern rust with high accuracy and efficiency. SNP molecular markers have the characteristics of high throughput, low average cost, high genetic stability, accurate and reliable genotyping data, and easy automation, and have extremely high value in commercial breeding. Attached Figure Description
[0017] Figure 1 These are the PCR band phenotypes of 8 representative materials and controls in sequencing primers.
[0018] Figure 2 The genotypes of eight representative materials and controls were sequenced using sequencing primers.
[0019] Figure 3 This shows the genotyping effect of KASP primer RPPM-1 in 190 materials (including 2 controls); each dot represents the genotype of a maize material, with blue indicating TT homozygous resistant type, red indicating CC homozygous sensitive type, green indicating TC heterozygous resistant type, and black indicating water control.
[0020] Figure 4 This shows the genotyping effect of KASP primer RPPM-9 in 190 materials (including 2 controls); each bright spot represents the genotype of a maize material, blue represents the CC homozygous resistant type, red represents the GG homozygous sensitive type, green represents the CG heterozygous resistant type, and black represents the water control.
[0021] Figure 5 This shows the genotyping effect of KASP primer RPPM-10 in 190 materials (including 2 controls). Each dot represents the genotype of a maize material. Blue indicates TT homozygous resistant type, red indicates CC homozygous sensitive type, green indicates TC heterozygous resistant type, and black indicates water control.
[0022] Figure 6 This shows the genotyping effect of KASP primer RPPM-11 in 190 materials (including 2 controls). Each dot represents the genotype of a maize material. Blue indicates AA homozygous resistant type, red indicates CC homozygous sensitive type, green indicates AC heterozygous resistant type, and black indicates water control. Detailed Implementation
[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. In the embodiments provided in this specification, where specific techniques or conditions are not specified, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels. All corn materials used in this invention are available to the public, but are only used to verify this invention and cannot be used for other purposes. Those skilled in the art can also use other corn materials for verification experiments; the following embodiments are merely examples.
[0024] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art may conduct corresponding experiments under the guidance of the operating manuals accompanying various commercially available kits or entrust them to specialized companies, such as gene sequencing.
[0025] Example 1. A natural population (hereinafter referred to as the population) was constructed using 190 materials from our company's maize germplasm resource bank (including the original positioning materials: Jing 2416K, which is highly resistant to southern rust, and Jing 2416, which is highly susceptible to southern rust). DNA was extracted from fresh seedling leaves using the CTAB method to construct a DNA library.
[0026] 2. Using the public databases MaizeGDB and NCBI, the reference RPPM genomes of B73 and the highly resistant southern rust material Jing2416K were queried. Regions with enriched SNP positions were identified, and primers were designed as shown in SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20 and SEQ ID NO.21.
[0027] G2-F:5'ATTAGCGGGCAACATTCA 3' (SEQ ID NO.14) G2-R:5' CGTTATCCAGGTCCAAGTC 3' (SEQ ID NO.15) K4-F:5' GGAGTCAAGGGACAAAGT 3' (SEQ ID NO.16) K4-R:5' GATAAGGAGGCAGATCATAG 3' (SEQ ID NO.17) G3-F: 5' CTCCAGGGAGCTTGTGAT 3' (SEQ ID NO.18) G3-R: 5'ATGGGCGTACCTCTTGTC 3' (SEQ ID NO.19) G5-F: 5' CAGACACTGATATTAGACCGTAC 3' (SEQ ID NO.20) G5-R: 5' CGTTATCCAGGTCCAAGTC 3' (SEQ ID NO.21) 3. Using the primers described above, PCR amplification was performed on 6 representative samples selected from the population, plus samples from Jing2416K and Jing2416, for a total of 8 samples. The PCR reaction system was: 0.1 μL Accurate Taq DNA Polymerase (5 U / μL), 1 μL 10×Taq PCR Buffer (Mg2+). 2+(plus), 0.9 μL dNTP Mix (2.5 mM each), 10-20 ng DNA, 0.25 μL 10 μM Primer F, 0.25 μL 10 μM Primer R, add water to 10 μL; PCR program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min 20 s, 35 cycles, 72℃ final extension for 7 min. Electrophoresis detection conditions: After amplification, electrophoresis was performed at 140 V for 40 min in 2% agarose gel electrophoresis. Products meeting expectations were sent to a sequencing company for sequencing to determine the SNP sites that may genotype within the population. The PCR band phenotypes of 8 representative materials and controls in the sequencing primers are as follows: Figure 1 As shown, the genotypes of 8 representative materials and controls were sequenced using sequencing primers as follows: Figure 2 As shown.
[0028] 4. Select four sites to design and synthesize KASP primers. The SNP at site 1 (SNP1) is located at position 522 of the nucleotide sequence shown in SEQ ID NO.1, with a resistant base of T and a resistant base of C. The primer is named RPPM-1, as shown in Table 1. The SNP at site 2 (SNP2) is located at position 1983 of the nucleotide sequence shown in SEQ ID NO.1, with a resistant base of C and a resistant base of G. The primer is named RPPM-9, as shown in Table 2. The SNP at site 3 (SNP3) is located at position 2004 of the nucleotide sequence shown in SEQ ID NO.1, with a resistant base of T and a resistant base of C. The primer is named RPPM-10, as shown in Table 3. The SNP at site 4 (SNP4) is located at position 2360 of the nucleotide sequence shown in SEQ ID NO.1, with a resistant base of A and a resistant base of C. The primer is named RPPM-11, as shown in Table 4.
[0029] Table 1
[0030] Table 2
[0031] Table 3
[0032] Table 4
[0033] 5. PCR amplification was performed on all population materials using the above four sets of KASP primer pairs. Genotyping verification was performed using the LGC SNP line system. The specific steps were as follows: Extracted DNA was uniformly diluted to 10 ng / µl, and 1.5 µl was aliquoted into a 384-well plate. After centrifugation, the plate was dried in a 50°C oven for 5 minutes. The PCR reaction system was then aliquoted and mixed into the 384-well plate using the LGC Meridian3 high-throughput loading platform. The plate was sealed with an LGC Kube membrane and placed in a 384-well PCR instrument for PCR amplification. After amplification, the plate was read and analyzed using an LGC Omega F. The PCR reaction system consisted of: 1.5 µl of dried DNA, 1.5 µl of a mixture of KASP Master mix and KASP Primer mix (100 μM KASP Master mix and 2× KASP Primer mix volume ratio 35:1), where the concentrations of primers Primer_FAM, Primer_HEX, and Primer_common in the KASP Primer mix were 0.16 μM, 0.16 μM, and 0.16 μM, respectively. Add water to 3ul (μM and 0.41μM).
[0034] The PCR reaction program for primer RPPM-1 is as follows: pre-denaturation at 94℃ for 15 minutes; first step amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 67℃-61℃ for 60 seconds, 10 Touch Down cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; second step amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 61℃ for 60 seconds, 26 cycles; if the genotyping effect is poor due to DNA problems, add 3 more cycles, with the reaction program being denaturation at 94℃ for 20 seconds, annealing and extension at 60℃ for 60 seconds, but the additional cycle step should not be performed more than 3 times. The PCR reaction procedures for primers RPPM-2, RPPM-3, and RPPM-4 are as follows: Test Condition 1: Pre-denaturation at 94℃ for 15 minutes; First amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 68℃~62℃ for 60 seconds, 10 Touch Down cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; Second amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 62℃ for 60 seconds, 34 cycles; Test Condition 2: Pre-denaturation at 94℃ for 15 minutes; First amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 65℃~59℃ for 60 seconds, 10 Touch Down cycles. Touch Down cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; the second amplification reaction, denaturation at 94℃ for 20 seconds, annealing and extension at 59℃ for 60 seconds, 34 cycles; test condition 3: pre-denaturation at 94℃ for 15 minutes; the first amplification reaction, denaturation at 94℃ for 20 seconds, annealing and extension at 61℃~55℃ for 60 seconds, 10 Touch Down cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; the second amplification reaction, denaturation at 94℃ for 20 seconds, annealing and extension at 55℃ for 60 seconds, 34 cycles.
[0035] Test results as follows Figures 3-6 As shown.
[0036] 6. Field phenotypic verification Using 190 natural populations as experimental subjects, they were inoculated with fungi before tasseling. The fungal strain was obtained from rust fungal clusters that broke out in the same year. The inoculation site was the two leaves above and below the ear. The inoculation method was to dissolve the obtained fungal strain in an aqueous solution containing 0.01% Tween-80 and spray it with a sprayer 15 cm away from the leaves. Phenotypic data were recorded from the milk stage to the waxy stage of corn (about 15 days after pollination). The infection status of each material was recorded according to the disease grading standard: Grade 1 (HR): no lesions on the leaves; Grade 3 (R): rust spore masses on the leaves cover less than 25% of the leaf area; Grade 5 (MR): rust spore masses on the leaves cover 26% to 50% of the leaf area; Grade 7 (S): rust spore masses on the leaves cover 51% to 75% of the leaf area; Grade 9 (HS): rust spore masses on the leaves cover 76% to 100% of the leaf area, and the leaves withered.
[0037] Comparing the SNP genotyping results of each material with the field phenotype, the genotype of KASP primer RPPM-1 showed a 100% correlation with the field phenotype trend. Although RPPM-10 could also be successfully genotyped, the correlation with the field phenotype trend was too large. RPPM-9 and RPPM-11 could not be successfully genotyped regardless of the amplification conditions used.
[0038] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A gene associated with resistance to southern rust RPPM The relevant SNP molecular markers are characterized by, The SNP molecular marker is located at position 522 of the nucleotide sequence shown in SEQ ID NO.1, and the base polymorphism is T / C.
2. The SNP molecular marker according to claim 1, characterized in that, When the genotype of the SNP molecular marker is T / T homozygous or T / C heterozygous, the maize material is a disease-resistant gene type; when the genotype of the SNP molecular marker is C / C homozygous, the maize material is a susceptible gene type.
3. Primers for amplifying the SNP molecular marker as described in claim 1 or 2.
4. The primer according to claim 3, characterized in that, The forward primer is shown in SEQ ID NO.2 or SEQ ID NO.3, and the reverse primer is shown in SEQ ID NO.
4.
5. A gene for resistance to southern rust RPPM The genotyping kit is characterized by, It contains the primers described in claim 3 or 4.
6. The use of the SNP molecular marker of claim 1 or 2, the primer of claim 3 or 4, or the kit of claim 5 in at least one of the following aspects: (1) Genes that resist southern rust RPPM Genotyping; (2) Detection of southern rust resistance genes in maize materials RPPM ; (3) Marker-assisted breeding of maize; (4) Maize breeding resistant to southern rust.
7. A gene for resistance to southern rust RPPM Genotyping methods include: Using the genomic DNA of the maize material to be tested as a template, PCR amplification was performed using the primers described in claim 3 or 4, and the southern rust gene was identified based on the SNP molecular markers described above. RPPM Genotyping was performed to determine whether the maize material under test had resistance to southern rust.
8. The method according to claim 7, characterized in that, When the genotype of the SNP molecular marker is T / T homozygous or T / C heterozygous, the maize material is a disease-resistant gene type; when the genotype of the SNP molecular marker is C / C homozygous, the maize material is a susceptible gene type.
9. The method according to claim 7 or 8, characterized in that, The reaction conditions for PCR amplification are as follows: Pre-denaturation at 94℃ for 15 minutes; First step amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 67℃-61℃ for 60 seconds, 10 Touch Down cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; Second step amplification reaction: denaturation at 94℃ for 20 seconds, annealing and extension at 61℃ for 60 seconds, 26 cycles; If the genotyping effect is poor due to DNA problems, add 3 more cycles, with the reaction program being denaturation at 94℃ for 20 seconds, annealing and extension at 60℃ for 60 seconds, but the additional cycle step should not be performed more than 3 times.
10. A method for breeding maize, characterized in that, include: According to any one of claims 7 to 9, select maize with resistance to southern rust for subsequent breeding.