Tetrodotoxin detection method based on magnetic control micro-fluidic chip

Abstract

The invention discloses a tetrodotoxin detection method based on a magnetic control micro-fluidic chip. The tetrodotoxin detection method comprises the following steps: preparing the magnetic control micro-fluidic chip; constructing a TTX specific capture probe; preparing a signal probe with catalytic activity; the method comprises the following steps: adding a sample to be detected and a capture probe into a chip capture cavity, and fully incubating magnetic microspheres and the sample through magnetic control driving to form a magnetic microsphere-TTX compound; washing and carrying out sandwich reaction to form an aptamer-TTX-antibody-APMS nano enzyme sandwich compound; the sandwich compound reacts with a TMB-H2O2 chromogenic substrate, and quantitative or qualitative analysis of TTX is realized by detecting a chromogenic signal. According to the present invention, the novel tetrodotoxin rapid detection technology based on the aptamer and antibody sandwich immunoassay, the noble metal nano-enzyme signal amplification and the magnetic control microfluidic chip is provided, and the requirements of high sensitivity, simplicity and convenience of the on-site food safety in-situ detection are met.

Description

Technical Field

[0001] This invention relates to the field of tetrodotoxin detection, and more specifically to a method for tetrodotoxin detection based on a magnetically controlled microfluidic chip. Background Technology

[0002] Tetrodotoxin (TTX) is a highly toxic small molecule substance widely found in seafood such as pufferfish. The TTX molecule has a unique cage-like structure, consisting of multiple heterocyclic rings tightly linked by bridging bonds to form a three-dimensional polycyclic bridging molecule. It contains multiple hydroxyl and amino functional groups, giving it significant hydrophilicity and structural stability. This three-dimensional cage-like configuration not only endows TTX with extremely strong neurotoxicity but also poses challenges to molecular recognition and detection. TTX has a long half-life in the human body and is difficult to break down; ingestion can cause severe neurotoxic reactions and even endanger life. Long-term or accidental ingestion of food containing TTX poses significant health risks to humans and animals; therefore, its detection and limit management are very strict both domestically and internationally. Relevant Chinese standards stipulate residue limits for TTX in aquatic products and require rapid, highly sensitive, and specific on-site detection. Traditional TTX analytical methods, including high-performance liquid chromatography, immunoassay, electrochemical detection, and fluorescence methods, while possessing high sensitivity and accuracy, still suffer from problems such as cumbersome sample pretreatment, long detection time, high reagent consumption, and expensive equipment.

[0003] Immunoassay has become an important rapid analytical method for TTX detection. However, because tetrodotoxin is a small molecule compound with a unique structure and low molecular weight, it cannot be detected using conventional antibody sandwich methods; only competitive methods are typically employed. Competitive methods, however, suffer from limitations in sensitivity and operational complexity. Therefore, this invention innovatively proposes a sandwich method combining aptamers and antibodies for on-slide immunoassay of tetrodotoxin, achieving highly sensitive immunoassay detection of this small molecule toxin. Aptamers are single-stranded nucleic acid molecules that can specifically recognize TTX and possess advantages such as ease of synthesis, flexible modification, and structural stability. Utilizing aptamers and antibodies to establish a sandwich immunoassay can effectively improve the sensitivity and specificity of TTX detection.

[0004] Further utilizing functional nanostructures, noble metal nanozymes can be combined with antibodies to form catalytically active antibody-enzyme complexes, achieving sensitive conversion of target signals. However, during the preparation of nanoprobes, aggregation or non-specific adsorption due to surface and interface effects is common, leading to high background signals in the detection system and affecting accuracy. Therefore, developing a novel, rapid, simple, sensitive detection strategy with low background is extremely important.

[0005] Microfluidic chip technology, hailed as the "lab-on-a-chip" due to its unique advantages in fluid manipulation, quantitative reagent transfer, and rapid mixing, has shown great application potential in food safety detection, particularly for substances like tetrodotoxin. However, current common microfluidic chip devices require external pumps and connecting tubing, impacting overall portability and field application efficiency. Recent research has proposed several pump-free fluid control technologies, including capillary action, finger actuation, and magnetic control. Among these, magnetically controlled microfluidic chips, with their ease of operation, high miniaturization, and low background signal, have become an ideal platform for on-site food safety testing. Magnetic control enables precise automatic transfer and mixing of fluids and reagents within the chip, significantly improving detection efficiency and sensitivity.

[0006] Therefore, there is an urgent need to develop a novel rapid detection technology for tetrodotoxin based on microfluidic chip technology to meet the requirements of high sensitivity and simplicity for on-site food safety detection. Summary of the Invention

[0007] The purpose of this invention is to provide a method for detecting tetrodotoxin based on a magnetically controlled microfluidic chip, thereby solving the problems in the existing technology of tetrodotoxin detection, such as difficulty in specific identification of small molecules, weak detection signal and high background, cumbersome on-site detection process, low portability and automation, and dependence on complex equipment.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0009] A method for detecting tetrodotoxin based on a magnetically controlled microfluidic chip is provided, comprising the following steps:

[0010] S1, Fabrication of a magnetically controlled microfluidic chip: The magnetically controlled microfluidic chip is constructed by placing a microfluidic chip on an array frame embedded with magnets. The microfluidic chip includes an upper PDMS microfluidic layer and a lower glass substrate. The PDMS microfluidic layer is provided with parallel microchannels. Six chambers are arranged sequentially in each microchannel, namely: a capture chamber, a first washing chamber, a reaction chamber, a second washing chamber, a third washing chamber, and a detection chamber. Adjacent chambers are connected by interconnecting channels. Mineral oil is pre-added to each chamber and microchannel to form an oil phase isolation.

[0011] S2, Constructing the capture probe: An aptamer with high affinity and specificity for tetrodotoxin is modified onto the surface of magnetic microspheres to form a TTX-specific capture probe;

[0012] S3, Preparation of signal probe: Anti-TTX monoclonal antibody is coupled with APMS nanozyme, and after blocking treatment, a signal probe with catalytic activity is formed. The APMS nanozyme is a gold-platinum-mesoporous silica nanocomposite.

[0013] S4, Sample loading and capture: The sample to be detected and the capture probe are added to the chip capture cavity. The magnetic microspheres and the sample are fully incubated by magnetic control to form a magnetic microsphere-TTX complex.

[0014] S5, Washing and Sandwich Reaction: The above complex is sequentially transferred to the first washing chamber to remove unbound impurities under magnetic field control, and then transferred to the reaction chamber to incubate with the signal probe to form an aptamer-TTX-antibody-APMS nanozyme sandwich complex.

[0015] S6, Signal Detection: The sandwich complex is sequentially transferred to the second washing chamber and the third washing chamber for washing, and then transferred to the detection chamber to react with the TMB-H2O2 chromogenic substrate. The quantitative or qualitative analysis of TTX is achieved by detecting the chromogenic signal.

[0016] Preferably, the nucleotide sequence of the aptamer in step S2, from the 5'-3' end, is as follows:

[0017] ATACCAGCTTATTCAATTTAATGCGGGGTGAGGCTCAATCAAGGAAAGATATAAGTAAGCAAAAAGGTCAAACAAGGGCGAGATAGTAAGTGCAATCT.

[0018] Preferably, the magnetic microspheres in step S2 are streptavidin-modified magnetic beads with a particle size of 1-20 μm. The aptamer is modified onto the surface of the magnetic beads through biotin-streptavidin specific binding, and the modification conditions are room temperature or 37°C incubation for 0.5-3 h.

[0019] Preferably, the coupling conditions between the APMS nanozyme and the antibody in step S3 are as follows: 1 nMAu@Pt@m-SiO2 nanoparticles are dispersed in 10 mM Tris-HCl buffer at pH 9, 1 mg / mL anti-TTX monoclonal antibody is added, the blocking treatment is performed with 2.5 w / v % BSA solution, and the concentration of the signal probe after coupling is 2-5 nM.

[0020] Preferably, the mineral oil in step S1 is a system of Triton, EM 90 and mineral oil mixed in a ratio of 1:10:1000, with 8-10 μL pre-added to each chamber; the width of the interconnecting channel is 600-800 μm and the height is 150-250 μm. It should be understood that the size of the microfluidic channel affects the transfer efficiency of the magnetic beads and the droplet stability to a certain extent.

[0021] Preferably, the incubation time in step S4 is 10-30 min, and the incubation time for the sandwich reaction in step S5 is at least 30 min, preferably 30-60 min, both at room temperature; the washing step uses 0.5% BSA-PBST buffer and is performed at least three times.

[0022] Preferably, the chromogenic substrate in step S6 comprises 1-2 mM TMB, 0.01-5 M H2O2 and 100 mM pH 4.5 sodium acetate buffer, the chromogenic reaction time is 5-10 min, and the reaction is terminated by transferring the magnetic microspheres to a chamber outside the detection chamber.

[0023] Preferably, the detection method has a limit of detection of 0.15 ng / mL and a linear detection range of 0.2-20 ng / mL.

[0024] Preferably, the samples to be tested include aquatic product extracts, drinking water, or other food samples that may contain TTX. The samples are loaded directly after centrifugation and dilution pretreatment, without the need for complex purification steps.

[0025] Preferably, the magnetic microfluidic chip described in step S1 has a magnetic array located beneath its glass substrate. The magnetic microspheres are transferred between chambers by moving the chip or the magnetic array, and the entire detection process can be completed in as little as 45 minutes.

[0026] Preferably, sample pretreatment includes: centrifuging and diluting the sample, and adding a TTX standard concentration sample to obtain the TTX sample solution to be tested. If a standard solution is being tested, it can be directly diluted to the required concentration using a gradient. According to a preferred embodiment of the present invention, a 10 ng / mL standard sample is used, and the standard sample is serially diluted to different concentrations such as 5, 2.5, and 1 ng / mL using a methanol + 0.1% acetic acid mixture.

[0027] Preferably, the capture step includes: transferring magnetic microspheres into the washing chamber by magnetic force to remove unbound material. A specific magnetic bead solution for capturing TTX is added to the chip sample chamber in equal volumes with sample solutions of different concentrations, resulting in a final volume of 10 µL. The magnetic beads move within the capture chamber for 10–30 min.

[0028] Preferably, the sandwich immune recognition step includes: adding APMS and antibody conjugate, which binds to magnetic beads that have captured TTX to form an aptamer-TTX-antibody sandwich structure. A second magnetic wash is then performed to remove free antibody and non-specific conjugates.

[0029] Preferably, the antibody coating concentration is 5-50 µg / mL, more preferably 10-50 µg / mL. The APMS nanoparticle concentration is 1-5 nM, more preferably 2-5 nM. Before the conjugate is added to the immunoreaction chamber, the surface needs to be blocked at excess sites. Different amounts of BSA are selected for blocking, preferably 2.5% (w / v) of BSA.

[0030] Preferably, the incubation time in the reaction chamber (i.e., the third chamber), i.e., after the magnetic beads are transferred into the droplets in the reaction chamber, is kept moving to promote reagent mixing, and the incubation time affects the progress of the immune response, is at least 30 min.

[0031] Preferably, the colorimetric signal amplification and detection steps include: moving the magnetic bead to the reaction chamber, adding the TMB substrate and an appropriate amount of H2O2. The APMS nanozyme rapidly catalyzes the substrate reaction, producing a blue color. Absorbance / RGB quantitative analysis is performed using a detection system or a smartphone camera module, with visualization and quantitative judgment completed within 10 minutes.

[0032] The sixth chamber is the detection chamber. The colorimetric detection solution is a mixture containing TMB, H2O2, and ammonium acetate buffer. For optimization of the colorimetric solution, 0.1-2 mM TMB substrate is added, preferably 1 mM; 0.01-5 M H2O2 solution is added, preferably 2 M; the buffer solution is a pH 4.5 sodium acetate buffer, preferably 100 mM. The final color development time is selected between 5-10 minutes, with the optimal detection time chosen based on the color intensity. At the corresponding time point, the magnetic beads are transferred from the detection chamber to the adjacent third washing chamber, and the reaction is considered terminated. The color is observed and photographed in the detection chamber for analysis.

[0033] Preferably, the data processing and result output steps include: quantitatively outputting TTX concentration results by comparing with a standard curve, which can screen for trace amounts of toxins as low as 0.15 ng / mL, with a linear detection range of 0.2-20 ng / mL.

[0034] This invention provides a method for detecting tetrodotoxin (TXX) based on a magnetically controlled microfluidic chip. By organically integrating an aptamer-antibody sandwich immunorecognition system, noble metal nanozyme signal amplification technology, and a magnetically controlled microfluidic chip platform, it achieves highly sensitive, rapid, and automated on-site detection of tetrodotoxin (TXX) samples. Its principle includes the following core modules:

[0035] 1. Molecular recognition module:

[0036] Using aptamers with high affinity and specificity for TTX, covalent or non-covalent linkages are employed with magnetic microspheres. After TTX molecules in the sample are adsorbed onto the surface of the magnetic microspheres, they are further specifically recognized by antibodies labeled with noble metal nanozymes (such as gold-platinum-mesoporous silica nanocomposites, APMS), forming a sandwich structure to achieve specific and efficient capture of TTX.

[0037] 2. Signal amplification and detection module:

[0038] Nanozymes possess high catalytic performance similar to peroxidases (such as HRP), and can catalyze colorimetric substrates (such as TMB) to generate visible colors in detection reactions, significantly improving signal intensity and achieving ultra-high sensitivity visual detection.

[0039] 3. Microfluidics and Magnetism Module:

[0040] The microfluidic chip has multiple independent chambers pre-set inside and uses a magnetic field to precisely control the flow of magnetic microspheres to complete automatic separation, washing, reaction and detection steps, reducing manual operation, improving operational consistency and reducing reagent and sample consumption.

[0041] Combination Figure 1 As shown, the detection principle of the method of the present invention is explained as follows: First, utilizing the high specificity of the binding between streptavidin and biotin, a biotinylated aptamer capable of recognizing the target analyte (TTX) is attached to the surface of streptavidin magnetic beads to assemble a magnetic bead-aptamer capture probe. Next, the TTX sample to be detected is mixed with the capture probe, and the aptamer captures TTX in the sample through specific action, forming a "magnetic bead-aptamer-TTX" complex. Subsequently, an anti-TTX antibody conjugated with APMS enzyme is added. This antibody binds to another epitope of TTX, and together with the aptamer, forms a sandwich structure of "magnetic bead-aptamer-TTX-APMS-labeled antibody". Then, the complex is separated and washed using a magnetic field to remove free impurities. Finally, TMB chromogenic solution is added, and the APMS enzyme catalyzes the oxidation of TMB to generate a colored product—if the sample contains TTX, a significant color change will occur, otherwise no change will occur, thus achieving specific detection of TTX.

[0042] It should be understood that the aptamer sequence used in this invention is prior art, and the sequence reference is from the literature (Diaz-Avello, UG, Skouridou, V., Shkembi, X., Reverte, J., Mandalakis, M., Peristeraki, P., Campas, M., O'Sullivan, CK, 2025. Aptamer-antibodysandwich lateral flow test for rapid visual detection of tetrodotoxin inpufferfish. The Science of the total environment 978, 179419. https: / / doi.org / 10.1016 / j.scitotenv.2025.179419).

[0043] It should also be understood that the gold-platinum-mesoporous silica nanocomposite (Au@Pt@m-SiO2 nanoparticles) is also a mature technology already existing in this field and can be purchased.

[0044] The closest detection technique to this invention is lateral flow immunochromatography, with a detection limit as low as 0.3 ng / mL. For details, please refer to the literature (Diaz-Avello, UG, Skouridou, V., Shkembi, X., Reverte, J., Mandalakis, M., Peristeraki, P., Campas, M., O'Sullivan, CK, 2025. Aptamer-antibody sandwich lateral flow test for rapid visual detection of tetrodotoxin in pufferfish. The Science of the total environment 978, 179419. https: / / doi.org / 10.1016 / j.scitotenv.2025.179419). Existing reagent kits, such as those produced by Henan Ounuo Biotechnology, while having a detection limit (below 0.1 ng / mL), involve cumbersome procedures (approximately 3 hours for the entire process). ELISA-based detection technology relies on multiple washing and plate-tapping steps, making it limited by laboratory conditions and unsuitable for on-site testing. Furthermore, while the authorized patent CN 109142710B employs ratiometric fluorescence for rapid detection of tetrodotoxin, even with a detection limit of 0.067 ng / mL, fluorescence spectrophotometers are difficult to use for on-site testing.

[0045] The core technology of this invention lies in the realization of nanozyme signals on a microfluidic chip and the quantitative detection of TTX. It should be noted that the focus of this invention is on the integration of detection technologies, rather than on the improvement of microfluidic chips or the synthesis of nanozymes alone. Microfluidic technology is widely used due to its advantages such as high throughput and facilitating on-site real-time detection. However, detection based on microfluidic chips has always had the technical pain point of low detection sensitivity in terms of signal output. This invention introduces nanozymes to amplify signals on microfluidic chips.

[0046] The inventiveness of this invention lies primarily in the non-simple superposition of three technological breakthroughs: through the synergistic effect of aptamer-antibody sandwich (solving the specificity problem of small molecule detection), nanozyme signal amplification (solving the sensitivity problem), and magnetically controlled microfluidics (solving the automation problem), it simultaneously overcomes three major pain points: difficulty in small molecule detection, cumbersome on-site detection, and weak signal. A detailed explanation follows:

[0047] First, it is well known that small molecules have low immunogenicity, making it difficult to use the sandwich method with double antibodies. Instead, competitive methods are often used. Due to their simple structure and limited epitopes, traditional antibody immunoassays for small molecules often suffer from multiple cross-reactions and insufficient specificity, resulting in high false positive rates and poor accuracy.

[0048] However, this invention employs a dual sandwich recognition strategy of aptamers and antibodies. For small molecules with cage-like structures, it leverages the high affinity of the aptamer and the high specificity of the antibody to jointly construct a sandwich immune complex, significantly improving the specificity and selectivity of recognition. This overcomes the technical bottleneck of achieving high-specificity recognition of small molecules using a single antibody. For the first time, this invention introduces the sandwich combination of aptamers and antibodies into a microfluidic magnetic bead immune system, achieving highly specific capture of difficult-to-detect small molecules.

[0049] Secondly, the concentration of small molecules is usually extremely low, and traditional immunoassay signals have limited amplification, making it difficult to meet the needs of rapid on-site detection. Furthermore, nanozymes generally exhibit non-specific adsorption, resulting in high background signals that affect the signal-to-noise ratio and weaken detection sensitivity.

[0050] This invention innovatively employs APMS nanozymes, leveraging their abundant active sites and excellent peroxidase-mimicking properties to achieve potent signal catalysis and enhanced colorimetric signal, while also exhibiting excellent colloidal stability. By systematically screening for the optimal BSA blocking concentration (e.g., w / v%), effective non-specific adsorption inhibition is achieved, reducing background spurious signals. Simultaneously, reagent droplets are precisely separated in each chamber of the chip beforehand, limiting non-specific reactions between the enzyme and non-target components. Compared to the high background signal resulting from the multi-step washing-adsorption operation of traditional ELISA methods, this significantly improves the signal-to-noise ratio. This effectively solves the long-standing problem of high background signal in nanozyme systems, providing a solid guarantee for improved sensitivity.

[0051] Furthermore, traditional immunoassay procedures are complex, manual operation relies on experience, and routine washing and separation steps are prone to cross-contamination, leading to instability and limiting the widespread application of rapid on-site testing.

[0052] This invention utilizes a six-chamber, oil-phase-isolated, magneto-controlled microfluidic platform, combined with a magnetic array at the bottom of the chip, to achieve programmed and automated transfer of magnetically functionalized beads between different chambers, completing an integrated operation encompassing capture, washing, reaction, and detection. This avoids operational errors and contamination associated with traditional centrifugation and centrifuge tube transfer, greatly simplifying on-site testing procedures and improving portability and operational stability.

[0053] Compared with the prior art, the present invention has the following significant advantages:

[0054] 1) Improved detection sensitivity: Nanozymes provide highly efficient catalysis and significantly amplify the signal, resulting in detection sensitivity far exceeding that of traditional immunoassays. The lowest detectable TTX content is 0.15 ng / mL, and it has a wide linear detection range of 0.2-20 ng / mL for micro-analysis.

[0055] 2) Advantages of automation and on-site operation: The magnetic microfluidic platform enables strictly automated sample separation, washing and reaction, significantly reducing manual errors and improving repeatability and data consistency, making it very suitable for rapid screening needs such as on-site food safety and port quarantine.

[0056] 3) Reduced operation and resource consumption: Microfluidic chips and nanozyme catalysis systems reduce reagent and sample requirements, with extremely low single-detection volume, significantly reducing detection costs and environmental impact.

[0057] 4) High specificity and anti-interference: The dual recognition mechanism of aptamer and antibody improves the detection specificity and anti-background interference ability, and can achieve accurate quantification in complex sample matrices without the need for multiple complex sample purification steps.

[0058] 5) High modularity and scalability: The solution is compatible with multi-channel / multi-target chip layouts, supports batch and parallel detection, and is easy to upgrade to multi-toxin detection or a wider range of bioanalysis platforms.

[0059] 6) The readings are intuitive and easy to promote: the significant color changes can be visually observed or collected by mobile phone, which is convenient for non-professionals to operate and interpret on site.

[0060] In summary, this invention provides a novel dual-mode rapid detection technology for tetrodotoxin based on aptamer-antibody sandwich immunoassay, noble metal nanozyme signal amplification, and magnetically controlled microfluidic chip, which meets the requirements of high sensitivity and simplicity for on-site food safety detection. Attached Figure Description

[0061] Figure 1 This is a schematic diagram illustrating the principle of the sandwich-type TTX detection of the present invention;

[0062] Figure 2 An exploded view of a magnetically controlled microfluidic chip provided according to an embodiment of the present invention;

[0063] Figure 3 A detailed diagram (A) and a schematic diagram (B) of the working process of a six-cavity microfluidic chip provided according to an embodiment of the present invention.

[0064] Figure 4 The quantitative curve of TTX determined based on magneto-controlled microfluidics;

[0065] The meanings of the reference numerals in the attached figures are as follows:

[0066] 1: PDMS microfluidic layer; 2: glass substrate; 3: magnet; 4: array frame. Detailed Implementation

[0067] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the techniques used in the embodiments are conventional practices in the art, or experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, the reagents and materials used in the embodiments are commercially available.

[0068] Example 1: Fabrication of a microfluidic chip

[0069] I. Structural Design of Microfluidic Chips

[0070] Combination Figure 2 , Figure 3 As shown, the microfluidic chip used in this embodiment consists of an upper PDMS microfluidic layer 1 and a lower glass substrate 2. The PDMS microfluidic layer 1 (approximately 5 mm thick) has six parallel microchannels etched on it. Each microchannel contains six sequentially arranged circular chambers (approximately 3-5 mm in diameter): a capture chamber, a first washing chamber, a reaction chamber, a second washing chamber, a third washing chamber, and a detection chamber, used for zoned reagent loading. Adjacent chambers are connected by an interconnecting channel at the bottom. This interconnecting channel is approximately 700 μm wide and 200 μm high. This channel allows magnetic nanoparticles (MBs) to pass through while also using oil-water interfacial tension to isolate aqueous droplets, preventing cross-contamination between droplets. The glass substrate 2 is a glass slide with a thickness of approximately 1.5-2.5 mm, serving as the chip's support and imaging substrate.

[0071] II. Fabrication of PDMS Microfluidic Layer

[0072] Mix the PDMS prepolymer and curing agent (e.g., Sylgard 184) thoroughly at a mass ratio of 10:1, and place them in a vacuum degassing device to evacuate for about 20–40 minutes to remove air bubbles generated during the mixing process.

[0073] Pour the degassed PDMS mixture into the pre-processed metal mold (material can be aluminum alloy or stainless steel), and use a scraper to make the surface smooth.

[0074] Curing is carried out at a temperature of approximately 70–90 °C for 1.5–3 h; after curing, the PDMS layer is peeled off from the mold.

[0075] On the PDMS layer, corresponding to the center of each chamber and the inlet and outlet positions, use a cutting tool or punch to punch out sampling holes and vent holes with a diameter of about 0.5–1.5 mm.

[0076] III. Pretreatment of the glass substrate

[0077] Place the glass slide in acetone, deionized water and anhydrous ethanol in sequence and ultrasonically clean each for 5–15 min; finally dry with nitrogen or clean air.

[0078] After cleaning, place the glass slide in a plasma cleaner and treat it for 1–3 minutes to enrich the glass surface with active hydroxyl groups, thereby improving its adhesion to PDMS.

[0079] IV. Bonding of PDMS to Glass

[0080] The punched PDMS microfluidic layer 1 and the plasma-activated glass substrate 2 were simultaneously placed in a plasma cleaner and treated again for 0.5-2 min.

[0081] The processed PDMS microfluidic layer 1 and glass substrate 2 are aligned with the microchannel pattern on a clean bench and gently attached to ensure that the upper and lower surfaces are in full contact and spontaneously bonded, thus completing the construction of the microfluidic chip.

[0082] The bonded microfluidic chip is heated at around 80 °C for 1–3 h to enhance the bonding strength of the PDMS-glass interface and ensure sealing.

[0083] It should be understood that the main improvement of this microfluidic chip in immunoassay technology lies in its on-chip process, eliminating the need for external pumps and complex chip structure designs. The main emphasis is that this invention, based on a six-chamber oil-phase isolated magnetically controlled microfluidic platform and combined with a magnetic array at the bottom of the chip, enables programmed and automated transfer of magnetically functionalized beads between different chambers, completing an integrated operation encompassing capture, washing, reaction, and detection.

[0084] Example 2: Detection Process of TTX Immunosensor Based on Magnetically Controlled Microfluidic Chip

[0085] The following examples are based on the six-chamber magnetically controlled microfluidic chip constructed in Example 1, and combine mineral oil isolation, magnetic transfer, and nanozyme-antibody sandwich immunoassay strategies to describe in detail the detection process of the present invention:

[0086] First, according to Figure 2As shown, placing the microfluidic chip on the array frame of the permanent magnet below allows for precise targeting of each chamber. It should be understood that the PDMS microfluidic layer 1 and the glass substrate 2 together constitute the microfluidic chip. When the microfluidic chip is placed on the array frame 4, the magnetically controlled microfluidic chip is constructed. By moving the microfluidic chip, the magnet 3 causes the magnetic bead solution in the first chamber droplet to aggregate into one place. By moving the microfluidic chip in situ, the trajectory of the magnetic beads in the droplet environment is controlled. As time increases, the magnetic beads undergo interfacial biochemical effects such as recognition and coupling in the solution. Then, following the trajectory of the microfluidic channel, they move to the subsequent chambers, completing the overall immunoassay process.

[0087] Chip preprocessing

[0088] 1.1 In each of the six chambers of the microfluidic chip, 8–10 μL of bubble-free mineral oil is injected using a dedicated syringe to isolate the aqueous phase in adjacent chambers and prevent droplets from contacting the outside environment and cross-contamination.

[0089] 1.2 Dispense the pre-prepared reagent solutions sequentially into the inlets of the corresponding chambers on the chip:

[0090] – First chamber (i.e., capture chamber): 10 μL of aptamer-modified magnetic nanoparticles (MNPs) and sample premix containing different concentrations of TTX (0-20 ng / mL); wherein, the specific sequence (5'-3' end) of the aptamer is: ATACCAGCTTATTCAATTTAATGCGGGGTGAGGCTCAATCAAGGAAAGATATAAGTAAGCAAAAAGGTCAAACAAGGGCGAGATAGTAAGTGCAATCT; the magnetic nanoparticles are streptavidin magnetic beads with a particle size of 1µm, which were purchased from Dongna Bio.

[0091] – Second chamber (i.e., first washing chamber): 10 μL 0.5% BSA-PBST (1× PBS, pH 7.4) washing solution;

[0092] – Third chamber (i.e. reaction chamber): 10 μL of anti-TTX antibody-labeled APMS nanozyme (APMS@mAb); wherein, the APMS@mAb is prepared by first synthesizing mesoporous silica-encapsulated gold core platinum shell nanoparticles (APMS) using a hydrothermal method, and then preparing it with an antibody by electrostatic adsorption.

[0093] The specific procedure is as follows: Take 50 µL of a 1 mg / mL TTX-specific monoclonal antibody (TTX-mAb) solution and mix it thoroughly with 50 µL of the synthesized APMS solution (approximately 5 nM); add buffer to a 10 mM Tris-HCl buffer at pH 9 to bring the total volume to 1 mL, ensuring a suitable buffer environment for antibody binding to APMS; incubate the mixture at 4°C for 24 hours to fully promote antibody adsorption or chemical binding to the APMS nanoparticle surface, forming an APMS@mAb complex; after incubation, add 2.5% BSA as a blocking and storage agent to block unbound sites on the nanoparticle surface and inhibit non-specific adsorption; gently mix the mixture and store at 4°C.

[0094] – Fourth and fifth chambers (i.e., the second and third washing chambers): each 10 μL of 0.5% BSA-PBST (1×PBS, pH 7.4) for two consecutive washes;

[0095] – Sixth chamber (i.e., detection chamber): 10 μL TMB / H2O2 chromogenic substrate (1 mM TMB, 2 M H2O2, 100 mM acetate buffer, pH 4.5).

[0096] Magnetron transfer and immune capture

[0097] 2.1 The microfluidic chip with the injected reagent is placed on the array frame of the permanent magnet below, which can be precisely applied to the position of each chamber.

[0098] 2.2 Driving MNPs–aptamers (magnetic nanoparticles loaded with TTX-specific aptamers, final concentration 1 mg·mL⁻¹) in the first chamber -1 The TTX sample accumulated at the bottom of the chamber and reacted with TTX samples (stored in methanol + 0.1% acetic acid, with final concentrations of 0, 0.2, 0.5, 1, 2.5, 5, 10, and 20 ng / mL). -1 Incubate thoroughly (room temperature, 15 min) to form the MNP–TTX complex.

[0099] 2.3 The MNP–TTX complex was further drawn into the second chamber for washing using a permanent magnet array; the complex was washed in the second chamber for 1 min to thoroughly remove unbound impurities.

[0100] Sandwich Complex Construction

[0101] 3.1 After washing in the second chamber, the MNP–TTX complex was transferred to the third chamber and reacted with APMS@mAb (noble metal nanozyme-labeled anti-TTX antibody, particle labeling concentration 2 nM) at room temperature for 30 min to form the MNP–TTX–APMS complex.

[0102] 3.2 The complex was washed twice in series in the fourth and fifth chambers, with each wash lasting 1 min under magnetic enrichment, to remove excess unbound APMS@mAb.

[0103] Colorimetric detection

[0104] 4.1 After washing, the purified MNP–TTX–APMS complex was transferred to the sixth chamber.

[0105] 4.2 In the sixth chamber, APMS catalyzes the oxidation and color reaction of TMB with H2O2 (room temperature, 5–10 min), producing a blue product.

[0106] 4.3 After the reaction is complete, the magnetic beads are transferred from the sixth chamber to the fifth chamber. Using the transparent window at the top of the chip, images are acquired through a portable optical detection module or a smartphone camera. The intensity of the red channel is read out using RGB analysis software to achieve quantitative determination of TTX concentration.

[0107] RGB quantitative curve

[0108] The color rendering of the sixth cavity was captured using a smart terminal (such as a smartphone) through a transparent window at the top of the chip. The grayscale value of the red channel was extracted using RGB analysis software, and a TTX standard curve (grayscale value vs. log[TTX]) was plotted. Figure 4 (As shown), then calculate the TTX content in the sample based on the standard curve, LOD ≤ 0.15 ng·mL -1 The entire capture-detection process takes as little as 45 minutes, and it features high specificity, low background, and rapid on-site detection capabilities.

[0109] Example 3: Real Sample Detection

[0110] Take Wahaha drinking water samples, dilute appropriately (e.g., 1:1 to 1:5 ratio), and add TTX standard samples to achieve final spiked concentrations of 0.1, 1, and 10 ng / mL. Following the procedure in Example 2, the water sample containing the standard was introduced into the first chamber, where TTX was captured using TTX-specific aptamer magnetic beads. The magnetic beads were then transferred sequentially, washed in the second chamber, and reacted with APMS@mAb in the third chamber. After washing in the fourth and fifth chambers, the sample was finally transferred to the sixth chamber for TMB color development. The recovery rate was evaluated by color analysis, verifying the accuracy and practicality of the platform. The data are the average of three experimental results, shown in Table 1. The recovery rate was 95.5%–102.3%, further confirming the feasibility of the method of this invention for accurate detection of TTX concentration in real water samples.

[0111] Table 1. Results of TTX determination in drinking water samples

[0112]

[0113] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made in accordance with the claims and description of this application fall within the protection scope of the claims of this patent. All aspects not described in detail in this invention are conventional technical content.

Claims

1. A method for detecting tetrodotoxin based on a magnetically controlled microfluidic chip, characterized in that, Includes the following steps: S1, Fabrication of a magnetically controlled microfluidic chip: The magnetically controlled microfluidic chip is constructed by placing a microfluidic chip on an array frame embedded with magnets. The microfluidic chip includes an upper PDMS microfluidic layer and a lower glass substrate. The PDMS microfluidic layer is provided with parallel microchannels. Six chambers are arranged sequentially in each microchannel, namely: a capture chamber, a first washing chamber, a reaction chamber, a second washing chamber, a third washing chamber, and a detection chamber. Adjacent chambers are connected by interconnecting channels. Mineral oil is pre-added to each chamber and microchannel to form an oil phase isolation. S2, Constructing the capture probe: An aptamer with high affinity and specificity for tetrodotoxin is modified onto the surface of magnetic microspheres to form a TTX-specific capture probe; S3, Preparation of signal probe: Anti-TTX monoclonal antibody is coupled with APMS nanozyme, and after blocking treatment, a signal probe with catalytic activity is formed. The APMS nanozyme is a gold-platinum-mesoporous silica nanocomposite. S4, Sample loading and capture: The sample to be detected and the capture probe are added to the capture cavity of the chip. The magnetic microspheres and the sample are fully incubated by magnetic control to form a magnetic microsphere-TTX complex. S5, Washing and Sandwich Reaction: The above complex is sequentially transferred to the first washing chamber to remove unbound impurities under magnetic field control, and then transferred to the reaction chamber to incubate with the signal probe to form an aptamer-TTX-antibody-APMS nanozyme sandwich complex. S6, Signal Detection: The sandwich complex is sequentially transferred to the second washing chamber and the third washing chamber for washing, and then transferred to the detection chamber to react with the TMB-H2O2 chromogenic substrate. The quantitative or qualitative analysis of TTX is achieved by detecting the chromogenic signal.

2. The detection method according to claim 1, characterized in that, The nucleotide sequence of the aptamer described in step S2, from the 5'-3' end, is as follows: ATACCAGCTTATTCAATTTAATGCGGGGTGAGGCTCAATCAAGGAAAGATATAAGTAAGCAAAAAGGTCAAACAAGGGCGAGATAGTAAGTGCAATCT.

3. The detection method according to claim 1, characterized in that, The magnetic microspheres mentioned in step S2 are streptavidin-modified magnetic beads with a particle size of 1-20 μm. The aptamer is modified on the surface of the magnetic beads by biotin-streptavidin specific binding. The modification conditions are room temperature or 37°C incubation for 0.5-3 h.

4. The detection method according to claim 1, characterized in that, The coupling conditions for APMS nanozyme and antibody in step S3 are as follows: 1 nM Au@Pt@m-SiO2 nanoparticles are dispersed in 10 mM Tris-HCl buffer at pH 9, 1 mg / mL anti-TTX monoclonal antibody is added, and the mixture is incubated at 4°C for 24 h. The blocking treatment is performed using 2-5 w / v % BSA solution, and the concentration of the signal probe after coupling is 2-5 nM.

5. The detection method according to claim 1, characterized in that, The mineral oil mentioned in step S1 is a system of Triton, EM90, and mineral oil mixed in a ratio of 1:10:1000, with 8-10 μL pre-added to each chamber; the width of the interconnecting channel is 600-800 μm and the height is 150-250 μm.

6. The detection method according to claim 1, characterized in that, The incubation time in step S4 is 10-30 min, and the incubation time for the sandwich reaction in step S5 is 30-60 min, both at room temperature; the washing step uses 0.5% BSA-PBST buffer and is performed at least three times.

7. The detection method according to claim 1, characterized in that, The chromogenic substrate in step S6 contains 1-2 mM TMB, 0.01-5 M H2O2 and 100 mM sodium acetate buffer at pH 4.

5. The chromogenic reaction time is 5-10 min. The reaction is terminated by transferring the magnetic microspheres to a chamber outside the detection chamber.

8. The detection method according to claim 1, characterized in that, The detection method has a limit of detection of 0.15 ng / mL and a linear detection range of 0.2-20 ng / mL.

9. The detection method according to claim 1, characterized in that, The samples to be tested include aquatic product extracts, drinking water, or other food samples that may contain TTX. The samples are loaded directly after centrifugation and dilution pretreatment, without the need for complicated purification steps.

10. The detection method according to claim 1, characterized in that, In step S1, a magnetic array is provided under the glass substrate of the magnetically controlled microfluidic chip. The programmed transfer of magnetic microspheres between chambers is achieved by moving the chip or the magnetic array, and the entire detection process takes as little as 45 minutes.

Images