Enzyme substrates for detecting shiga toxins
By using an oligonucleotide-based enzyme activity assay and utilizing the ricin-guarbitril ring (SRL) sequence of the eukaryotic 60S ribosomal subunit, a rapid, simple, and efficient Shiga toxin detection technology was developed. This technology solves the problems of complex and costly STEC detection in existing technologies, and enables efficient detection and diagnosis of STEC.
Patent Information
- Application Number
- CN202480041247.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-05-05
- Filing Date
- 2024-05-03
- Publication Date
- 2026-02-24
AI Technical Summary
Existing technologies are not readily available, convenient, and efficient for the rapid, simple, and efficient detection of Shiga toxin (Stx), especially in human, food, and animal samples. Diagnosing STEC infection is complex and costly, and existing methods do not provide information on enzyme activity.
An oligonucleotide-based detection method was developed, utilizing the ricin-toxin ring (SRL) sequence of the eukaryotic 60S ribosomal subunit as a target. The enzyme activity of Shiga toxin was detected by cleavage-dependent fluorescent labeling, simplifying the detection to an enzyme activity assay. The reaction conditions were optimized to achieve rapid and sensitive detection.
It enables rapid, simple, and efficient detection of STEC, achieving robust and specific Stx detection within 30 to 60 minutes, reducing detection costs, simplifying the diagnostic process, and is suitable for monitoring and research of zoonotic diseases and the same health field.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biochemistry, molecular diagnostics, and bacterial toxin assays.
[0002] This invention relates to an oligonucleotide comprising: a) a nucleotide sequence of a ricin ring (SRL) of a eukaryotic / mammalian 60S ribosomal subunit, wherein the SRL nucleotide sequence comprises at least one adenine; and b) at least one cleavage-dependent marker; wherein the oligonucleotide is single-stranded. Preferably, the oligonucleotide constitutes at least one loop structure or stem-loop structure.
[0003] In another aspect, the present invention relates to a method for detecting active Shiga toxin in a sample, comprising the following steps: a) providing at least one oligonucleotide according to the present invention; b) providing a sample to be tested for Shiga toxin; c) incubating the sample with at least one single-stranded oligonucleotide; d) detecting a signal from a label, wherein the signal indicates the presence of Shiga toxin in the sample.
[0004] The present invention also includes a kit comprising at least one oligonucleotide according to the present invention, and the necessary reagents for toxin detection described herein. Background Technology
[0005] species Escherichia coli ( Escherichia coli It has been documented that *Escherichia coli* is both a component of the gut microbiota and a pathogen. This pathogen includes Shiga toxin-producing *Escherichia coli* (…). E. coli The two pathogenic strains are *S. tetanus* (STEC) and enterohemorrhagic *Escherichia coli* (EHEC). In the following text, the collective term "STEC" will be used, which also includes EHEC. These bacteria possess multiple virulence factors, particularly the Shiga toxin Stx, and can therefore cause diarrhea, hemorrhagic diarrhea, or other extremely serious illnesses such as hemolytic uremic syndrome (HUS). In Germany, the number of cases has been increasing in recent years: approximately 2,000 cases of STEC infection and approximately 100 cases of life-threatening hemolytic uremic syndrome (HUS) were reported in 2017. Children under the age of five are particularly vulnerable to these infections (RKI 2016, 2017; Kaper et al., 2004; Croxen et al., 2013).
[0006] STECs are important zoonotic pathogens, primarily associated with animals (especially ruminants) and related food products such as meat and dairy, but have also been found in plant-based products (Croxen et al., 2013; Persad and Lejeune, 2014; Garcia et al., 2010). STECs have caused extremely high socioeconomic and economic costs by triggering large-scale outbreaks, such as in 2011, and by contaminating food and leading to subsequent market recalls (Frank et al., 2011; Karch et al. 2010; COMMISSION Staff Working Document, 2011). Therefore, timely and high-quality detection of these pathogens in humans, food, and animals is of great importance. However, increasingly, molecular biology methods (such as PCR) are used, and subsequent isolation of the pathogens is no longer performed. However, in order to distinguish STEC from other Escherichia coli strains (including Escherichia coli strains in the gut microbiota), and to clearly attribute virulence markers such as Stx to the corresponding Escherichia coli clones, while also ensuring that further phylogenetic analysis is used for disease aggregation and source identification, isolates extracted from fecal or food matrices play a crucial role (Flieger et al., 2013).
[0007] However, isolate extraction is becoming an increasingly prominent issue because: it is often not required for diagnosis in primary diagnostic laboratories in medical practice; and molecular biology methods are increasingly being applied directly to raw samples (feces, food) without the need for subsequent pathogen isolation (Flieger et al., 2013; Fruth et al., 2016; FDA, 1995). Another problem is that current methods for pathogen isolation (including in human, food, and veterinary reference laboratories) are extremely complex: after enrichment culture and single-colony plate inoculation, PCR or dot blot analysis of dozens of colonies for stx gene detection is required. Alternative methods include the equally complex Stx immunoassay (colony immunoblotting, commercially discontinued in 2015) or Vero cell culture assays (Hull et al., 1993, Wang et al., 2016), and detection of O157 serogroup Escherichia coli based on metabolic characteristics (lack of sorbitol fermentation capacity and β-glucuronidase activity). However, only about 10% of STEC infections are caused by this serogroup (Fruth et al., 2015; RKI 2016, 2017). Even newer agar media (CHROM(c)STEC, etc.) cannot fully detect STEC because these media are based on, for example, the tellurite resistance of the pathogen—a characteristic possessed by only about 40% of pathogens (Kase et al., 2015). Although other detection methods have been published, these methods have not yet achieved a technological breakthrough because they rely on the use of extremely complex analytical techniques (e.g., proteomics analysis via matrix-assisted laser desorption / ionization (MALDI)-time-of-flight tandem mass spectrometry) and require expensive analytical equipment, which is only available in a few specialized laboratories (e.g., Fagerquist et al., 2014).
[0008] Therefore, STECs are important zoonotic pathogens associated with animals and food. Furthermore, these pathogens can cause large-scale outbreaks and significant economic losses through food contamination and subsequent product recalls. Thus, timely and high-quality detection of these pathogens in humans, food, and animals is of paramount importance.
[0009] Pathogen isolation is crucial for further analysis of pathogens, especially in clarifying infection chains and sources. However, pathogen isolation is increasingly proving challenging because current methods are extremely complex and costly, requiring sophisticated equipment such as mass spectrometry (Basu et al., 2015; Brigotti et al., 2007; Li et al., 2017). Furthermore, the diversity of STECs (serogroups, metabolic characteristics, resistance) necessitates the combination of different diagnostic methods; and relying on single-detection procedures based on markers not consistently present in all STECs often fails to yield definitive conclusions. Stx, however, is present in all STECs and can be detected using the stx gene via PCR or directly via ELISA. A limitation of current diagnostic methods is that these assays do not provide information about the actual enzymatic activity of Stx, which largely determines its harmful nature.
[0010] Brigotti et al., 2001, found that Shiga toxin 1 (Stx1) can damage single-stranded DNA through depurination by measuring released adenine. Roday et al., 2007 studied the activity of ricin and reported the catalytic properties of ricin toxin A chain (RTA) to generate a base-free site in 14-mer stem-tetracyclic RNA. EP1241267A3 describes a multi-step assay for the ribosomal inactivation protein (RIP) mistellectin using a DNA-RNA hybridization construct. Wang et al., 2016 describes an antibody-based LFIA immunoassay for the detection of Escherichia coli O157:H7 strain. None of the above literature describes the methods, oligonucleotides, or their sequences described in this invention.
[0011] Therefore, obtaining a simple, low-cost, sensitive, and reliable method for detecting Shiga toxins and / or STEC would be a major advancement in the human, food, and veterinary fields. Summary of the Invention
[0012] The objective according to the invention is achieved through the features of the independent claims. Advantageous embodiments of the invention are described in the dependent claims.
[0013] In a preferred embodiment, the present invention relates to an oligonucleotide comprising: a) A nucleotide sequence of the ricin-toxin ring (SRL) of the eukaryotic / mammalian 60S ribosomal subunit, wherein the SRL nucleotide sequence comprises at least one adenine; and b) At least one cut-dependent tag, The oligonucleotides therein are single-stranded.
[0014] Preferably, the oligonucleotides constitute at least one ring structure or stem-loop structure.
[0015] In another preferred embodiment, the present invention relates to a method for detecting active Shiga toxin in a sample, comprising the following steps: a) Provide at least one single-stranded oligonucleotide according to the present invention; b) Provide a sample for testing for Shiga toxin; c) Incubate the sample with the at least one single-stranded oligonucleotide; d) Detect the signal from the label, wherein the signal indicates the presence of Shiga toxin (and optionally, Shiga toxin-producing pathogen) in the sample.
[0016] In an implementation, step d) includes detecting a signal (e.g., a fluorescent signal) from a label, wherein the signal (e.g., a fluorescent signal) indicates the presence of Shiga toxin (and optionally, a Shiga toxin-producing pathogen) in the sample.
[0017] Unless explicitly excluded or otherwise clearly stated, all embodiments, advantages, and features described below relate to the oligonucleotides described in the invention, their uses, the kits described in the invention, and the methods described in the invention.
[0018] The term "STEC" will be used hereinafter, and this term also includes EHEC. STECs are important pathogens that cause diseases in humans ranging from diarrhea to severe hemolytic uremic syndrome (HUS). STECs are present in animals and food and can cause large-scale disease outbreaks in humans, associated with high economic costs. Timely and high-quality detection of STECs, including the extraction of isolates from patients, animals, and food, has always been important, but it is also challenging and labor-intensive. In this case, one of the inventors' goals was to address this problem and develop a detection method for STECs. This method is preferably based on the in vitro detection of Shiga toxin (Stx) enzyme activity. In addition to being easy to use and inexpensive, the detection method should also be sensitive and reliable in detecting STECs. To this end, the inventors improved the standard culture of STEC samples used in diagnostics and research. Based on these samples, the SRL substrate and reaction conditions were optimized by utilizing the measured Stx activity of the culture supernatant to achieve higher reaction specificity and stronger fluorescence signals, thereby progressively improving the detection method.
[0019] Therefore, obtaining a reliable detection method for identifying STECs, such as the method according to the present invention, is a significant advancement.
[0020] STECs are a heterogeneous population with highly variable marker genes, but all STECs contain Shiga toxin (STX; Stx). Stx possesses RNA N-glycosidase activity, which attacks ribosomes (Bergan et al., 2012). Ribosomes consist of two subunits (60S and 40S), primarily composed of ribosomal RNA (rRNA). The 60S subunit contains a special structure called the ricin ring (SRL). The SRL of Stx is recognized by a recognition sequence and cleaved by the enzymatic activity of Shiga toxin, depurinating a specific base (adenine) (Menge, 2020).
[0021] For this reason, the inventors developed a method for detecting the catalytic activity of Shiga toxin (Stx).
[0022] For the reasons stated above, a simple method is proposed and can potentially be used as an agar-based method for identification. stx Positive Escherichia coli colonies represent a significant advancement, as this method can greatly improve the analysis of STEC in both human medicine and food / veterinary medicine.
[0023] Therefore, this invention provides a novel enzyme-based assay, which can also be based on agar, significantly simplifying the complex initial detection of Stx-positive Escherichia coli currently used in the human, food, and veterinary fields. This new assay allows for more efficient implementation of screening programs, thereby significantly simplifying and expanding surveillance and research tasks in zoonotic diseases and the One Health field (e.g., gaining a deeper understanding of infection / colonization in animals and humans, including transmission and contamination issues in various food products)—work that typically relies on pathogen isolation and subsequent characterization. Furthermore, in embodiments, the method described according to this invention offers significant advantages for the simplified isolation / detection of pathogens, serving as the basis for this work.
[0024] The invention described herein can fundamentally improve STEC detection in all areas of zoonotic diseases and the same health research.
[0025] For this purpose, a variety of clinical STEC strains were analyzed, and the functionality of the method according to the present invention in detecting these strains was verified. Several fluorescently labeled Stx oligonucleotide substrates were developed, the reaction conditions of the method according to the present invention were optimized, and their specificity was verified.
[0026] Figure 4 and Figure 5 The principles of an exemplary embodiment of the detection method according to the present invention for determining the Stx activity of STEC samples are explained.
[0027] In the development process, STEC strains were first cultured in liquid culture medium, and then a culture supernatant containing Stx produced by STEC was obtained. Stx activity was detected based on the enzyme activity of Shiga toxin. The natural substrate of Stx (SRL) is located within the ribosome. Stx depurinates the SRL within the ribosome, thereby blocking the translation process. However, using ribosomes to detect Stx activity in vitro would complicate the assay; therefore, a DNA-based synthetic SRL substrate was designed. To measure Stx activity, in a first embodiment, the SRL substrate was coupled with a fluorophore / quencher as a label. Diluted in the reaction mixture and mixed with the culture supernatant used for detection, this embodiment can produce two possible results: a fluorescent signal is detected in the detection device, or no fluorescent signal is detected. If Stx is absent in the culture supernatant, the SRL remains intact, and the fluorophore and quencher are in close proximity. The fluorescent signal of the fluorophore is absorbed by the quencher, and therefore no signal can be detected. If active Stx is present, the SRL undergoes depurination at a specific adenine adenine site. Furthermore, Stx-induced chain breakage preferably occurs, forming two halves of the SRL. As a result, the fluorophore in the liquid separates from the quencher, and the fluorescence of the fluorophore can be detected. In embodiments, in the detection method according to the present invention, in addition to culturing STEC strains to determine Stx activity, for example, the SRL substrate, reaction mixture, and reaction temperature and / or Shiga toxin may also be relevant.
[0028] Stx is an enzymatically active AB5 toxin that depurinates specific adenines in SRL within the 60S ribosomal subunit and blocks translation (Beddoe et al., 2010). A detection method according to the present invention, based on the detection of Stx's enzymatic activity, is being developed for STEC assays, preferably utilizing the effect of Stx on SRL. The ricin-stearin ring forms a loop structure within the 28S rRNA of the 60S ribosomal subunit.
[0029] In the embodiments disclosed herein, the inventors tested 94 bacterial strains, including 65 STEC strains and 11 Shigella strains. Shigella ) strains, and 18 non-Shiga toxin-producing enteropathogenic strains (Salmonella) Salmonella ), EAEC, EPEC, EIEC, Yersinia ( YersiniaUsing established but complex and time-consuming detection methods, including Western blotting of Stx and Vero cell cytotoxicity assays, Stx production was detected in 59 of 65 STEC strains and 6 of 11 Shigella strains. This means that, in both the reference method used and the assay newly described herein, 6 of the 65 STEC strains, 5 of the 11 Shigella strains, and all 18 enteropathogenic pathogen strains were Stx-negative. Subsequently, all tested pure cultures were correctly Stx-positive or correctly Stx-negative in a simple and efficient manner using the method described herein. Examples show that, after analysis with various fluorescently labeled oligonucleotide enzyme substrates, robust and specific Stx detection can be achieved for reference strains within 30 to 60 minutes, depending on the amount and subtype of Stx. In summary, the inventors have developed a rapid detection assay for STEC based on the enzymatic activity of Stx (as a major virulence factor).
[0030] In a particular embodiment, this method can be based on the enzymatic activity of Shiga toxin for a simple agar-based STEC assay. Without being limited to existing theories, the potential mechanism of this assay depends on the embodiments of the invention; specifically, active Shiga toxin has RNA... N - Glycosidase activity, which depurinates specific adenines in the ricin-fucoidin ring (SRL) of 28S ribosomal RNA, thereby inhibiting protein synthesis in eukaryotic cells (Chan et al., 2016). This enzyme activity preferably elicits a color or fluorescence reading on specially modified substrates, which can be read visually or using simple instruments. For example... Figure 1 and Figure 4 An exemplary implementation is shown in the figure.
[0031] SRL is crucial for the GTP-catalyzed steps in translation. Within SRL, Stx depurinates a specific adenine in the detection sequence GAGA, thereby completely blocking the translation process (Endo et al., 1988; Tesh et al., 1993).
[0032] In a preferred embodiment of the method according to the invention, the oligonucleotides according to the invention undergo depurination or cleavage by the enzymatic activity of Shiga toxin, and preferably not by lyases such as apurinol / pyrimidine (AP) lyases or other cleavage reactions (e.g., by chemicals).
[0033] In other words, in a preferred embodiment of the method according to the invention, the oligonucleotides according to the invention are not cleaved by lyases such as apurinol / pyrimidine (AP) lyases, and / or are not cleaved by other cleavage reactions (e.g., by chemicals).
[0034] In a preferred embodiment, this method also eliminates the need for additional substances such as trypsin, DTT, urea, and / or TCEP to activate Stx and detect Stx activity. Preferably, this method also eliminates the need for rebuffering and / or the use of (expensive) additional substances for enzyme-coupled adenine detection.
[0035] In the method according to the invention, the presence of active Stx is manifested by the depurination of the target sequence (which is SRL in the embodiment) in the oligonucleotide according to the invention at a specific adenine site. Furthermore, it is preferable that Stx-induced chain break occurs, thereby cleaving the oligonucleotide into two halves.
[0036] In the embodiments described herein, the method according to the invention is also referred to as an enzyme activity assay, an enzyme assay, or an agar-based detection method.
[0037] Therefore, the methods and / or reaction buffers and / or samples according to the invention preferably do not include / use lyases or other nucleases other than one or more Shiga toxins. Accordingly, the reaction buffers described herein preferably do not include lyases or other nucleases. In some embodiments, the reaction buffers described herein do not include ricin. In some embodiments, the reaction buffers and / or enzyme assays include ricin.
[0038] The presence of one or more Shiga toxins in a sample preferably indicates the presence of a Shiga toxin-producing pathogen in the sample. Therefore, in embodiments, the method according to the invention includes, if analyzing a patient sample, a diagnosis of infection by a Shiga toxin-producing pathogen (e.g., *Escherichia coli*, *Acinetobacter*, or *Shigella*); or, if, for example, testing food, a determination of contamination.
[0039] In an embodiment, the oligonucleotide is present in a detection solution, a reaction solution, or a buffer solution (e.g., a detection buffer, such as an acetate buffer).
[0040] In an embodiment, before or during steps c) and / or d) of the method according to the invention, a detection solution or reaction solution (detection buffer; depurinating buffer) is added (to the sample).
[0041] In embodiments, the detection solution or reaction solution (reaction buffer and / or detection buffer; depurination buffer) comprises ammonium acetate at concentrations between 10 and 150 mM, or 10-100 mM, 20-150 mM, 30-100 mM, 40-100 mM, 50-100 mM, 60-100 mM, 70-100 mM, 80-100 mM, 90-100 mM, 100-110 mM, 100-120 mM, 100-130 mM, 100-140 mM, 100-150 mM, 50-150 mM, etc. mM, or 10, 20, 30, 40, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 150, 120, 125, 130, 135 mM; or preferably between 10-150 mM, 10-100 mM, 50-100 mM, or 80-110 mM, or 100 nM. In embodiments, the detection solution or reaction solution (reaction buffer and / or detection buffer; depurination buffer) may also include sodium acetate, potassium acetate, and / or potassium citrate as alternatives to ammonium acetate, or may include sodium acetate, potassium acetate, and / or potassium citrate in addition to ammonium acetate. The final concentration of sodium acetate, potassium acetate, potassium citrate, and / or ammonium acetate in the detection solution or reaction solution may be those described above, or may be adjusted according to one or more alternatives or additional reagents.
[0042] In embodiments, the detection limit of Stx activity in samples (e.g., culture supernatant, pathogen colonies, or patient samples) using the method according to the present invention is between 11 and 29 ng / mL, or between 10 and 30 ng / mL, 1 and 50 ng / mL, or 5 and 30 ng / mL; or ≥1 ng / mL, 2.5 ng / mL, 5 ng / mL, 7.5 ng / mL, 10 ng / mL, 11 ng / mL, 12 ng / mL, 13 ng / mL, 14 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL, 29 ng / mL, 30 ng / mL, 35 ng / mL, 40 ng / mL, or 50 ng / mL; preferably at least ≥10 ng / mL, more preferably ≥5 ng / mL.
[0043] In embodiments, the detection solution or reaction solution (detection buffer; depurinating buffer) has a pH between 3 and 4, or between pH 2.5 and 4.5, or pH 3.5-4.5, pH 2-5, pH 3, pH 3.5, pH 4, pH 4.5, pH 5, pH 5.5, pH 6, pH 6.5 or pH 7, or is ≥ pH 2.5, ≥ pH 3, and ≤ pH 5, ≤ pH 4, or preferably between pH 3 and 4.
[0044] In embodiments, steps c) and / or d) of the method according to the invention include a detection temperature, or reaction temperature, or temperature gradient between 30°C and 55°C, between 40°C and 60°C, between 44°C and 57°C, between 37°C and 57°C, between 40°C and 50°C, or 30°C, 35°C, 40°C, 44°C, 45°C, 50°C, 60°C, or ≥30°C, ≥35°C, ≥40°C, ≥44°C, ≥45°C, ≥50°C, or preferably ≥40°C, ≥44°C, or between 30°C and 55°C.
[0045] In some specific embodiments, the detection solution or reaction solution (reaction buffer and / or detection buffer; depurinating buffer) comprises ammonium acetate (preferably 100 mM) at a concentration between 10 and 100 mM, and / or has a pH value between pH 3 and 4.
[0046] In some specific embodiments, the detection temperature, or reaction temperature, or temperature gradient included in steps c) and / or d) of the method according to the invention is between 30°C and 60°C, preferably between 40°C and 60°C.
[0047] In this embodiment, the oligonucleotide is present in a solid, semi-solid, or liquid (bacterial) growth medium (or culture medium), preferably in a growth agar plate (as a growth medium) or a semi-solid or liquid growth medium. In this embodiment, the solid, semi-solid, or liquid growth medium is a (bacterial) growth medium (or culture medium). In this embodiment, the solid, semi-solid, or liquid growth medium is an agar medium (including agar-agar and agarose media).
[0048] In some embodiments, the oligonucleotide is present in a solid or liquid growth medium, preferably in a growth agar plate (as a growth medium) or in a liquid growth medium comprising a detection solution / buffer or a reaction solution / buffer (e.g., a detection buffer, such as acetate buffer). In some embodiments, the oligonucleotide is present in a growth agar plate and / or a detection agar plate. In some embodiments, the oligonucleotide is present in a liquid or solid growth medium and / or a detection medium.
[0049] In embodiments, the oligonucleotide is present in a detection solution / buffer or reaction solution / buffer (e.g., a detection buffer, such as acetate buffer) and / or a bacterial growth medium, preferably a growth agar plate (as a growth medium), or in a mixture thereof.
[0050] In this embodiment, the oligonucleotide is present in the reaction solution, the detection solution, or the (bacterial) growth medium, or in a mixture thereof.
[0051] In this embodiment, the oligonucleotide is present in a reaction solution, a detection solution, or a bacterial growth medium, or in a mixture thereof, wherein the reaction solution, detection solution, or (bacterial) growth medium includes a dye or chromogenic dye for colorimetric detection. Such a (bacterial) growth medium is preferably a chromogenic growth medium and / or a chromogenic medium.
[0052] In one embodiment, the oligonucleotide is immobilized on a solid phase. In another embodiment, the solid phase may be a matrix, column material, beads (e.g., magnetic beads or agarose beads), surface, glass, plastic, resin, reaction vessel, pores of a plate, array, chip, or any other surface known to those skilled in the art suitable for immobilizing oligonucleotides.
[0053] In some embodiments, the oligonucleotides are immobilized on a solid phase, wherein the solid phase is part of a reaction vessel and / or culture vessel. In some embodiments, the reaction vessel and / or culture vessel is filled with or covered with a reaction medium, culture medium, and / or (bacterial) growth medium. In some embodiments, the reaction vessel and / or culture vessel is a pore of a (multi)well plate, or a reaction vessel having multiple pores.
[0054] In the method according to the invention, the presence of active Stx can be detected by the depurination of active Stx at a specific adenine site in the target sequence of the oligonucleotide according to the invention, preferably also by inducing chain breakage, thereby cleaving the oligonucleotide into two halves.
[0055] Therefore, at least one label of the oligonucleotide according to the invention is at least a cleavage-dependent label, which indicates that the oligonucleotide is cleaved by Stx and enables the detection of active Stx (e.g., in a sample). The cleavage-dependent label preferably generates a signal and / or undergoes a signal change when the oligonucleotide according to the invention is cleaved by Stx.
[0056] In an embodiment, the at least one cleavage-dependent marker comprises at least one fluorophore and at least one quencher.
[0057] In one embodiment, the at least one fluorophore and the at least one quencher are arranged such that the at least one quencher quenches the fluorescence of the at least one fluorophore as long as the oligonucleotide is not cleaved.
[0058] In one embodiment, the at least one cut-dependent marker comprises at least one luminescent dye.
[0059] In an embodiment, the at least one cut-dependent marker includes at least one colorimetric dye or a dye for colorimetric detection.
[0060] In embodiments, the chromogenic dye may be contained in a chromogenic growth medium or chromogenic substrate, and / or chromogenic detection may include these. In embodiments, chromogenic detection may be based on or include the detection of increases in color intensity, color changes, and / or color shifts.
[0061] In one embodiment, the at least one cleavage-dependent marker includes at least one marker at the 3' end of the oligonucleotide and / or at least one marker at the 5' end. In another embodiment, the at least one cleavage-dependent marker includes at least one marker at the 3' end of the oligonucleotide sequence and / or at least one marker at the 5' end of the oligonucleotide.
[0062] In one embodiment, the at least one cleavage-dependent marker comprises at least one fluorophore and at least one quencher within the oligonucleotide sequence, at the 3' end and / or 5' end of the oligonucleotide. In another embodiment, the at least one cleavage-dependent marker comprises at least one fluorophore at the 5' end of the oligonucleotide and at least one quencher at the 3' end. In yet another embodiment, the at least one cleavage-dependent marker comprises at least one fluorophore and / or quencher within the oligonucleotide sequence. In yet another embodiment, the at least one cleavage-dependent marker comprises at least one fluorophore and / or quencher at the 3' end and / or 5' end of the oligonucleotide. In another embodiment, the positions of the at least one fluorophore and at least one quencher described herein may be interchanged or different.
[0063] In one embodiment, the oligonucleotide comprises at least one Stx target sequence and / or recognition sequence, wherein the Stx target sequence / recognition sequence preferably comprises at least one adenine. In another embodiment, the at least one Stx target sequence / recognition sequence is one or a portion of a nucleotide sequence of the ricin ring (SRL) of the eukaryotic / mammalian 60S ribosomal subunit, wherein the SRL nucleotide sequence comprises at least one adenine.
[0064] In an embodiment, the oligonucleotide is preferably single-stranded and optionally constitutes at least one loop structure or stem-loop structure.
[0065] In this implementation, the presence of the stem-loop structure enables improved Stx detection. This is a surprising difference from other RIPs, such as ricin, whose activity is independent of the stem-loop (Amukele et al., 2005, Biochemistry). For example, optimal detection of ricin activity is found with a 14-nucleotide RNA substrate (Chen et al., 1998, Biochemistry). Therefore, the catalytic activity of ricin against DNA does not require a stem-loop structure. Similar results have been observed for saporin, a type 1 RIP, which cleaves neither the GAGA sequence motif nor the stem-loop structure, but preferably a tetracyclic structure with an ACG sequence motif at the loop initiation (Hauf et al., 2022, ACS chemical biology). Therefore, different RIPs have distinctly different target sequences and structures, each requiring specific assays.
[0066] Since the need for other RIPs does not necessarily mean that a particular RIP such as Stx has an ideal substrate, it is particularly surprising that the nucleic acid constructs according to the present invention can achieve sensitive and reliable detection of Stx activity.
[0067] In some embodiments, the oligonucleotide is single-stranded RNA (ssRNA) or single-stranded DNA (ssDNA). In some embodiments, the oligonucleotide is RNA or DNA. In some embodiments, the oligonucleotide includes RNA and / or DNA.
[0068] In one embodiment, the oligonucleotide comprises DNA. In one embodiment, the oligonucleotide is a DNA molecule. In one embodiment, the oligonucleotide is (partially) single-stranded DNA (ssDNA). In one embodiment, the oligonucleotide comprises a partially single-stranded DNA molecule. In one embodiment, the oligonucleotide is a partially single-stranded DNA molecule.
[0069] In some embodiments, the oligonucleotide includes single-stranded and double-stranded regions. In some embodiments, the single-stranded regions form or include loop structures. In some embodiments, the double-stranded regions form or include stem structures.
[0070] In an embodiment, the oligonucleotide includes at least one cyclic structure or stem-loop structure, and preferably includes at least one single-stranded region and at least one double-stranded region, wherein the single-stranded region preferably includes at least one cyclic structure and the double-stranded region preferably includes at least one stem structure.
[0071] In some of these embodiments, the oligonucleotide includes a stem-loop structure, wherein the loop structure is formed by a single-stranded region and the stem structure is formed by a double-stranded region. In some embodiments, the oligonucleotide specifically includes a stem-loop structure having both a stem structure and a loop structure.
[0072] In some preferred embodiments, at least one stem-loop structure of the oligonucleotide is a ricin ring (SRL) structure, including a ricin ring (SRL) structure, or similar to a ricin ring (SRL) structure.
[0073] In an embodiment, the oligonucleotide comprises a single-ring structure or a stem-ring structure, and preferably comprises fewer than 26 nucleotides.
[0074] In one embodiment, the oligonucleotide further includes at least one adapter sequence between the Stx target sequence / recognition sequence and at least one marker. In another embodiment, the oligonucleotide further includes at least one adapter sequence between the SRL nucleotide sequence and at least one marker.
[0075] In some implementations, the 5' adapter sequence includes the nucleotide sequence ACTT, and / or the 3' adapter sequence includes the nucleotide sequence AGT.
[0076] In an embodiment, the SRL nucleotide sequence of the oligonucleotide includes at least one (nucleotide) sequence GAGAG.
[0077] In one embodiment, the oligonucleotide comprises the sequence GAGAG. In another embodiment, the oligonucleotide comprises the sequence GAGAG or a sequence that is 70%, 80%, 90%, 95%, or 99% identical to it. (nucleotide) sequence G A GA is presumably necessary as the recognition sequence (cutting target sequence) of Stx. This is also relevant for the plant-based toxin ricin (which also possesses RNA). N - Glycosidase activity), and studies have shown that the recognition sequence GAGA is sufficient (Endo et al., 1988; Glück et al., 1992).
[0078] In embodiments, it is preferable to use at least one linker in the oligonucleotide according to the invention, especially in some embodiments where a weak detection signal is generated when a substrate (oligonucleotide) without a linker is used. In such embodiments, the additional use of a linker can lead to an improved detection signal (Noble et al., 2005; Mao et al., 2018). Furthermore, where possible, the natural SRL structure is preferably considered, and the spatial proximity of F / Q is achieved through base pairing.
[0079] For example, see the comparison of substrate 2 (without a linker) and substrate number 4 (with a linker) in the embodiments. However, the length and sequence of the linker may vary, and in embodiments, adjustments can be made for specific Stx variants or target bacterial strains of interest. In this case, the linker sequence may be shortened or include one or more additional nucleotides. In embodiments, the sequence other than the Stx target motif (recognition sequence) may vary in both its nucleotide sequence and length. For example, mass spectrometry has confirmed that for ricin, successful detection can be achieved using a short substrate (e.g., a 14-mer) that includes the GAGA recognition sequence of ricin, where substrate structures and / or nucleotide sequences other than the recognition sequence do not appear to be necessary.
[0080] In one embodiment, the oligonucleotide comprises the sequence GAGAGGAGAG (SEQ ID NO: 1). In another embodiment, the oligonucleotide comprises the sequence GAGAGGAGAG or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0081] In one embodiment, the oligonucleotide comprises the sequence CGAGAGGAGAGG (SEQ ID NO: 2). In another embodiment, the oligonucleotide comprises the sequence CGAGAGGAGAGG or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0082] In some preferred embodiments, the oligonucleotide comprises the sequence AGTACGAGAGGAAC (SEQ ID NO: 3). In embodiments, the oligonucleotide comprises the sequence AGTACGAGAGGAAC or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In embodiments, the SRL nucleotide sequence of the oligonucleotide comprises at least one (nucleotide) sequence AGTACGAGAGGAAC.
[0083] In some preferred embodiments, the oligonucleotide comprises the sequence ACTTAGTACGAGAGGAACAGT (SEQ ID NO: 7). In embodiments, the oligonucleotide comprises the sequence ACTTAGTACGAGAGGAACAGT or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto. In embodiments, the SRL nucleotide sequence of the oligonucleotide comprises at least one (nucleotide) sequence ACTTAGTACGAGAGGAACAGT.
[0084] In an embodiment, the oligonucleotide includes the sequence CTGAACTCAGTACG AGAGGAACCGTTCAG (SEQ ID NO: 4) or a sequence that is 70%, 80%, 90%, 95% or 99% identical to it.
[0085] In an embodiment, the oligonucleotide includes CTGAACTCAGTACG A (F)GAGGAACCGTTCAG(Q) or 70%, 80%, 90%, 95%, or 99% identical nucleotide sequences thereof, wherein F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of at least one fluorophore and at least one quencher may be interchanged.
[0086] In an embodiment, the oligonucleotide includes CTGAACTCAGTACG A (M)GAGGAACCGTTCAG (M) or 70%, 80%, 90%, 95% or 99% identical nucleotide sequences thereof, wherein M is at least one cleavage-dependent marker.
[0087] In an embodiment, the oligonucleotide includes the sequence TCAGTACG. A GAGGAACC (SEQ ID NO: 5) or a sequence that is 70%, 80%, 90%, 95% or 99% identical to it.
[0088] In an embodiment, the oligonucleotide includes (F)-TCAGTACG A GAGGAACC-(Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of at least one fluorophore and at least one quencher may be interchanged.
[0089] In an embodiment, the oligonucleotide includes (M)-TCAGTACG A GAGGAACC-(M) or its nucleotide sequence that is 70%, 80%, 90%, 95% or 99% identical, wherein M is at least one cleavage-dependent marker.
[0090] In an embodiment, the oligonucleotide includes the sequence TCAGTACG. A GAGG A GAGGAACC (SEQ ID NO:6) or a sequence that is 70%, 80%, 90%, 95% or 99% identical to it.
[0091] In an embodiment, the oligonucleotide includes (F)-TCAGTACG A GAGG AGAGGAACC-(Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of at least one fluorophore and at least one quencher may be interchanged.
[0092] In an embodiment, the oligonucleotide includes (M)-TCAGTACG A GAGG A GAGGAACC-(M) or its nucleotide sequence that is 70%, 80%, 90%, 95% or 99% identical, wherein M is at least one cleavage-dependent marker.
[0093] In an embodiment, the oligonucleotide includes a sequence. ACTT AGTACG A GAGGAAC AGT (SEQ ID NO: 7) or a sequence that is 70%, 80%, 90%, 95% or 99% identical to it.
[0094] In some of these implementations, the sequence ACTT at the 5' end and / or the sequence AGT at the 3' end are connector sequences.
[0095] In this embodiment, the oligonucleotide includes (F). -ACTT AGTACG A GAGGAAC AGT- (Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of at least one fluorophore and at least one quencher may be interchanged.
[0096] In a preferred embodiment, this oligonucleotide is number 4 in Table 1.
[0097] In this embodiment, the oligonucleotide includes (M). -ACTT AGTACG A GAGGAAC AGT- (M) or a nucleotide sequence that is 70%, 80%, 90%, 95% or 99% identical to it, wherein M is at least one cleavage-dependent marker.
[0098] In this embodiment, the oligonucleotide includes (M). -ACT GCTTAGTACG A GAGGAACCAT AGT- (M) or a nucleotide sequence that is 70%, 80%, 90%, 95% or 99% identical to it, wherein M is at least one cleavage-dependent marker.
[0099] In this embodiment, the oligonucleotide includes (F). -ACT GCTTAGTACG A GAGGAACCAT AGT- (Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of at least one fluorophore and at least one quencher may be interchanged.
[0100] In an embodiment, the oligonucleotide includes a sequence. ACTT AGTAC(Q)G A GAGGAAC AGT Or a sequence that is 70%, 80%, 90%, 95%, or 99% identical to it.
[0101] In some implementations, the sequence ACTT at the 5' end and / or the sequence AGT at the 3' end are connector sequences.
[0102] In this implementation, the sequence ACT at the 5' end and / or the sequence AGT at the 3' end are the connector sequences.
[0103] In an implementation, the oligonucleotide includes at least one 5' and / or 3' linker sequence.
[0104] In one embodiment, the 5' and / or 3' connector sequence includes the sequences ACT and / or AGT. In another embodiment, the 5' connector sequence includes the sequence ACT. In yet another embodiment, the 3' connector sequence includes the sequence AGT. In yet another embodiment, the 5' connector sequence includes the sequence AGT. In yet another embodiment, the 3' connector sequence includes the sequence ACT.
[0105] In some embodiments, the 5' connector sequence includes the sequence ACTN, wherein N is preferably A, G, T, or C, particularly preferably T or G. In some embodiments, the 3' connector sequence includes the sequence NAGT, wherein N is preferably A, G, T, or C, particularly preferably A or C. In some embodiments, the 5' connector sequence includes the sequence AN, wherein N is preferably A, G, T, or C, particularly preferably C, A, or T. In some embodiments, the 3' connector sequence includes the sequence NT, wherein N is preferably A, G, T, or C, particularly preferably G, T, or A.
[0106] In some embodiments, the oligonucleotide includes at least one 5' and / or 3' linker sequence, preferably wherein the linker sequence exhibits a length of 1 to 10 nucleotides (nt). In some embodiments, the oligonucleotide includes at least one 5' and 3' linker sequence. In some embodiments, the linker sequence has a length of 1 to 10 nucleotides (nt), or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nt. In some embodiments, the linker sequence has a length of 1 to 5 nt, preferably 2-4, 3-4, or 3 nt.
[0107] In one embodiment, the oligonucleotide includes at least one 5' and 3' linker sequence, wherein the linker sequence preferably includes complementary nucleotide sequences and / or preferably nucleotide sequences capable of hybridizing (at least partially) with each other. In another embodiment, the oligonucleotide includes a complementary nucleotide sequence at each of its 5' and 3' ends, preferably each sequence being 1 to 10 nt in length. In another embodiment, the complementary nucleotide sequences (e.g., linker sequences) hybridize at the 5' and 3' ends of the oligonucleotide and form a double-stranded stem structure (wherein a portion of the oligonucleotide preferably forms a single-stranded loop structure, thus forming a stem-loop structure).
[0108] In this embodiment, the oligonucleotide includes (F). -ACTTAGTAC(Q)G A GAGGAACAGT- (Q) or a nucleotide sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein F is at least one fluorophore and Q is at least one quencher. In embodiments, the positions of at least one fluorophore and at least one quencher may be interchanged.
[0109] In this embodiment, the oligonucleotide includes (M). -ACTTAGTAC(M)G A GAGGAACAGT- (M) or a nucleotide sequence that is 70%, 80%, 90%, 95% or 99% identical to it, wherein M is at least one cleavage-dependent marker.
[0110] In some embodiments, the oligonucleotide has a length of 4-21, 4-25, 4-27, 4-28, 4-29, 4-30, 5-50, 5-30, or 5-20 nucleotides (nt). In other embodiments, the oligonucleotide has a length of, for example, 5-25, 5-20, 5-15, 5-10, 8-30, 8-25, 8-27, 8-20, 8-15, 8-10, 9-30, 9-29, 9-28, 9-27, 9-26, 9-25, 9-24, 9-23, 9-22, 9-21, 9-20, 9-19, 9-18, 9-17, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11, or 9-10 nucleotides. The length of the oligonucleotide can be defined by a range formed by any of the above values. For example, any one value can be combined with another value as the endpoint of the range.
[0111] In some embodiments of the above oligonucleotides, the underlined nucleotides are preferably adenosine nucleotides in the Stx recognition sequence, especially adenine (A); bolded nucleotides indicate (possibly repetitive) recognition sequences; italicized nucleotides indicate linker sequences. In some embodiments, the font of the above oligonucleotides has no specific meaning and only indicates the nucleotide sequence itself.
[0112] In a preferred embodiment, the oligonucleotide comprises the sequence GAGA. In other embodiments, the oligonucleotide comprises the sequence GAG or a sequence that is 70%, 80%, 90%, 95%, or 99% identical to it. In these embodiments, the oligonucleotide comprises at least one GAG sequence because this sequence represents the shortest target sequence (substrate) or the smallest target sequence for STX. In some embodiments, the oligonucleotide (substrate) is or comprises a very long nucleic acid molecule that includes at least one or more target sequences and / or non-target sequences.
[0113] In an embodiment, the oligonucleotide includes the sequence XXXGAGAGXXX, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical to it, wherein XXX represents a nucleotide sequence of any length, preferably a sequence comprising 4-21 nt.
[0114] In an embodiment, the oligonucleotide includes the sequence NNNGAGAGNNN, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical to it, wherein NNN represents a nucleotide sequence of any length including nucleotides A, T, C, and / or G, preferably a sequence including 4-21 nt.
[0115] In an embodiment, the oligonucleotide includes the sequence XXXGXGXGXXX, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical to it, wherein XXX represents a nucleotide sequence of any length, preferably a sequence comprising 4-21 nt.
[0116] In an embodiment, the oligonucleotide includes the sequence NNNGRGRGNNN (SEQ ID NO: 14), or a sequence that is 70%, 80%, 90%, 95% or 99% identical thereto, wherein NNN represents a nucleotide sequence of any length including nucleotides A, T, C and / or G, preferably a sequence including 4 to 21 nt, and R represents nucleotide A or G.
[0117] In an embodiment, the oligonucleotide includes the sequence NNNAGTACGAGAGGAACNNN (SEQ ID NO:12), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein NNN represents a nucleotide sequence of any length including nucleotides A, T, C, and / or G, preferably a sequence including 4 to 21 nt.
[0118] In an embodiment, the oligonucleotide includes the sequence NNNAGTACGRGRGGAACNNN (SEQ ID NO:15), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein NNN represents a nucleotide sequence of any length including nucleotides A, T, C, and / or G, preferably a sequence including 4-21 nt, and R represents nucleotide A or G.
[0119] In an embodiment, the oligonucleotide includes the sequence NNNGTAGRGRGNARNNN (SEQ ID NO: 25), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein NNN represents a nucleotide sequence of any length including nucleotides A, T, C, and / or G, preferably a sequence including 4 to 21 nt, and R represents nucleotide A or G.
[0120] In an embodiment, the oligonucleotide includes the sequence ACTTXXXAGTACGAGAGGAACXXXAGT, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical to it, wherein XXX represents a nucleotide sequence of any length, preferably a sequence comprising 4-21 nt.
[0121] In an embodiment, the oligonucleotide includes the sequence ACTXXXTAGTACGAGAGGAACXXXAGT, or a sequence that is 70%, 80%, 90%, 95%, or 99% identical to it, wherein XXX represents a nucleotide sequence of any length, preferably a sequence comprising 4-21 nt.
[0122] In an embodiment, the oligonucleotide comprises the sequence ACTTNNNAGTACGAGAGGAACNNNAGT (SEQ ID NO: 8), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein NNN represents a nucleotide sequence of any length including nucleotides A, T, C, and / or G, preferably a sequence comprising 4-21 nt.
[0123] In an embodiment, the oligonucleotide includes the sequence ACTNNNAGTACGAGAGGAACNNNAGT (SEQ ID NO: 11), or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto, wherein NNN represents a nucleotide sequence of any length including nucleotides A, T, C, and / or G, preferably a sequence including 4-21 nt.
[0124] In an embodiment, the oligonucleotide includes at least a specific sequence GAGAG within the region of the oligonucleotide, wherein the entire oligonucleotide (including the GAGAG flanking sequence) comprises 70%, 80%, 90%, 95%, or 99% identical to the sequence ACTTAGTACGAGAGGAACAGT (SEQ ID NO: 7). Therefore, in an embodiment, the central target sequence GAGAG can be set as a specific and preferably essential sequence, while the flanking sequences (located outside the GAGAG sequence) can exhibit a degree of sequence variation.
[0125] In an embodiment, the oligonucleotide includes at least the specific sequence GAGAG within a region of the oligonucleotide, wherein the entire oligonucleotide (including GAGAG flanking sequences) comprises 70%, 80%, 90%, 95%, or 99% identical to the sequence ACTGCTTAGTACGAGAGGAACCATAGT (SEQ ID NO: 13). Therefore, in an embodiment, the central target sequence GAGAG can be set as a specific and preferably essential sequence, while the flanking sequences (located outside the GAGAG sequence) can exhibit a degree of sequence variation.
[0126] In an embodiment, the oligonucleotide includes the sequence ACTAGTACGAGAGGAACGT (SEQ ID NO: 16) or a sequence that is 70%, 80%, 90%, 95% or 99% identical thereto.
[0127] In an embodiment, the oligonucleotide includes the sequence AATAGTACGAGAGGAACTT (SEQ ID NO: 17) or a sequence that is 70%, 80%, 90%, 95% or 99% identical thereto.
[0128] In an embodiment, the oligonucleotide includes the sequence ACTTAGTACGAGAGGAAAAGT (SEQ ID NO:18) or a sequence that is 70%, 80%, 90%, 95% or 99% identical to it.
[0129] In an embodiment, the oligonucleotide includes the sequence ACTGAGTACGAGAGGAACAGT (SEQ ID NO:19) or a sequence that is 70%, 80%, 90%, 95% or 99% identical thereto.
[0130] In an embodiment, the oligonucleotide includes the sequence ATTAGTACGAGAGGAACAT (SEQ ID NO: 20) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0131] In an embodiment, the oligonucleotide includes the sequence ACTTAGTACGGGAGGAACAGT (SEQ ID NO:21) or a sequence that is 70%, 80%, 90%, 95% or 99% identical to it.
[0132] In an embodiment, the oligonucleotide includes the sequence ACTTAGTACGAGGGGAACAGT (SEQ ID NO:22) or a sequence that is 70%, 80%, 90%, 95% or 99% identical thereto.
[0133] The oligonucleotides described in the embodiments include the sequence ACTTAGTACGGGGGGAACAGT (SEQ ID NO: 23) or 70%, 80%, 90%, 95% or 99% identical to it.
[0134] In an embodiment, the oligonucleotide includes the sequence AGTTTGTACGAGAGCAGGACT (SEQ ID NO:24) or a sequence that is 70%, 80%, 90%, 95%, or 99% identical thereto.
[0135] Table 1: The oligonucleotide embodiments of the present invention can be used as synthetic ssDNA substrates based on the ricin-toxin ring (SRL) sequence for detecting the enzymatic activity of Stx. The SRL substrates investigated in the order of development, along with their corresponding sequences, characteristics, and fluorophores (F), are as follows: Cy5 = Cy5 fluorophore; FAM = 6-FAM fluorophore (fluorescein) and quencher (Q). Sequence color coding: underline = adenine (A) within the Stx recognition sequence; bold = (repeated) recognition sequence; italic = adapter sequence. Oligonucleotide number 4 has been used in some embodiments for Stx activity assays (e.g., at a concentration of 100 µM).
[0136]
[0137] Table 2 The oligonucleotide embodiments of the present invention can be used as synthetic ssDNA substrates based on the ricin-sugar protein loop (SRL) sequence for detecting the enzymatic activity of Stx (see also). Figure 3 The SRL substrates examined, along with their corresponding sequences, characteristics, fluorophores (F), and quenchers (Q), were described. Sequence color coding: underline = adenine (A) within the Stx recognition sequence; bold = (repeated) recognition sequence; italic = linker sequence.
[0138]
[0139] In one embodiment, a method for detecting active Shiga toxin in a sample includes the following steps: a) Provide at least one single-stranded oligonucleotide according to the present invention; b) Provide a sample for testing for Shiga toxin; c) The sample is incubated with at least one single-stranded oligonucleotide, wherein a signal, such as a fluorescent signal, is generated once the oligonucleotide is depurinated at the at least one adenine by Shiga toxin, wherein the oligonucleotide is cleaved. d) Detecting a signal from a label, wherein the signal indicates the presence of Shiga toxin in the sample, and optionally, a Shiga toxin-producing pathogen, and Table 3: Exemplary embodiments of oligonucleotides according to the present invention. The sequences disclosed in this table may include both DNA and RNA sequences (therefore, T (thymine) in this document may also represent U (uracil)). “NNN” represents a nucleotide sequence of any length including nucleic acids A, T, C and / or G, and 'R' represents nucleotide A or G.
[0140]
[0141] In an embodiment of the method according to the invention, in step c), once the olignucleotide is depurinated at at least one adenine by the Shiga toxin, a signal (from at least one label), such as a fluorescent signal, is generated, wherein the olignucleotide is cleaved.
[0142] In an embodiment of the method according to the invention, the Shiga toxin contained in the sample is selected from the group consisting of Stx1 and Stx2 or related Stx types.
[0143] In an embodiment of the method according to the present invention, the shiga toxin contained in the sample is selected from the group consisting of Stx1 and Stx2, Stx1a-d, and Stx2a-g. In an embodiment of the method according to the present invention, the shiga toxin contained in the sample is selected from the group consisting of Stx1 and Stx2, Stx1a-d, and Stx2a-o.
[0144] In embodiments of the method according to the present invention, the pathogens producing Shiga toxin are Shiga toxin-producing Escherichia coli (STEC), Acinetobacter spp., and / or Shigella spp., such as Shigella dysenteriae. Shigella dysenteriae ).
[0145] In an embodiment of the method according to the present invention, the pathogen producing Shiga toxin is Shiga toxin-producing Escherichia coli (STEC).
[0146] In an embodiment of the method according to the present invention, the pathogen producing Shiga toxin is a Shiga toxin-producing bacterium of the genus Shigella, such as Shigella dysenteriae.
[0147] In an embodiment of the method according to the present invention, the pathogen producing Shiga toxin is a Shiga toxin-producing Acinetobacter bacterium.
[0148] In an embodiment of the method according to the present invention, the oligonucleotide in step a) is present in an agar medium, and the sample is applied to the agar medium in step b).
[0149] In an embodiment of the method according to the present invention, the detection in step d) includes signal identification in an agar medium.
[0150] In this embodiment, the agar medium is solid, semi-solid (viscous), or liquid. In this embodiment, the agar medium is solid or semi-solid (viscous) and is present in a culture plate / petal (as “agar plate”).
[0151] In an embodiment of the method according to the invention, the oligonucleotide in step a) is present in an agar medium, and the sample is applied to the agar medium in step b); and / or the detection in step d) includes signal recognition in the agar medium.
[0152] In an embodiment of the method according to the present invention, the oligonucleotides in step a) are immobilized on a solid phase.
[0153] In embodiments, the solid phase may be a matrix, column material, beads (e.g., magnetic beads or agarose beads), surface, glass, plastic, resin, reaction vessel, well plate pores or surfaces therein, array, chip, or any other surface or solid phase known to those skilled in the art suitable for immobilizing oligonucleotides. In some embodiments, the oligonucleotides described in step a) are immobilized on a solid phase, wherein the solid phase is part of a reaction vessel and / or culture vessel. In some embodiments, the reaction vessel and / or culture vessel is filled with or covered with reaction medium, culture medium, and / or (bacterial) growth medium.
[0154] In an embodiment of the method according to the present invention, in step a), the oligonucleotide is present in a liquid reaction solution or a detection solution, and in step b), the sample is introduced into the liquid reaction culture medium.
[0155] In an embodiment, the oligonucleotide in step a) is present in a reaction solution or detection solution or (bacterial) growth medium, or in a mixture thereof, wherein the reaction solution or detection solution or (bacterial) growth medium is present in the wells of a reaction vessel or well plate.
[0156] In some embodiments, the oligonucleotide in step a) is present in a reaction solution, a detection solution, or a (bacterial) growth medium, or in a mixture thereof, wherein the reaction solution, detection solution, or (bacterial) growth medium includes a dye or chromogenic dye for colorimetric detection. Such a (bacterial) growth medium is preferably a chromogenic growth medium and / or a chromogenic medium. In some embodiments, the colorimetric detection further includes fluorescence detection.
[0157] In an embodiment, the oligonucleotide is present in a detection solution or reaction solution or buffer (e.g., a detection buffer, such as an acetate buffer).
[0158] In an embodiment of the method according to the invention, the oligonucleotide in step a) is present in a (liquid, semi-solid or solid) reaction medium or reaction solution, and in step b) the sample is introduced into a liquid reaction medium or onto a (semi-)solid reaction medium.
[0159] In this embodiment, the oligonucleotide is present in a solid or liquid (bacterial) growth medium, preferably in a growth agar plate (as a growth medium).
[0160] In some embodiments, the oligonucleotide is present in a solid or liquid growth medium, preferably in a growth agar plate (as a growth medium) comprising a detection solution or reaction solution / buffer (e.g., a detection buffer, such as acetate buffer). In some embodiments, the oligonucleotide is present in growth and / or detection agar plates. In some embodiments, the oligonucleotide is present in a liquid or solid growth medium and / or detection medium.
[0161] In embodiments, the oligonucleotide is present in a detection solution / buffer or reaction solution / buffer (e.g., a detection buffer, such as acetate buffer) and / or a bacterial growth medium, preferably a growth agar plate (as a growth medium), or in a mixture thereof.
[0162] In one embodiment, the present invention relates to a kit comprising at least [missing information - likely referring to a specific product or service]. a) Oligonucleotides according to the present invention, and b) Optionally at least one reaction buffer, wherein the reaction buffer is preferably a depurinating buffer comprising ammonium acetate.
[0163] In one embodiment, the present invention relates to a kit comprising at least [missing information - likely referring to a specific product or service]. a) Oligonucleotides according to the present invention, and b) Optionally at least one reaction solution and / or detection solution, wherein the reaction solution and / or detection solution is preferably a depurinating buffer comprising ammonium acetate.
[0164] In embodiments, the depurinating buffer may also include sodium acetate, potassium acetate, or potassium citrate instead of ammonium acetate, or may include sodium acetate, potassium acetate, or potassium citrate in addition to ammonium acetate.
[0165] In one embodiment, the present invention relates to a kit for carrying out the method according to the invention, wherein the kit preferably comprises at least one oligonucleotide according to the invention.
[0166] Directly disclosed information also includes kits, packaging, and multi-container units that contain one or more of the kit components or assay components described herein.
[0167] The embodiments and features of the present invention described in relation to the methods, oligonucleotides, and kits are considered to be disclosed in accordance with all other aspects of this disclosure, such that the features of the characterization methods can be used to characterize oligonucleotides or kits, and vice versa. Various aspects of the invention are unified by a common and unexpected discovery: by providing oligonucleotides according to the invention, active Stx can be detected; various aspects of the invention benefit from, are based on, and / or are interconnected by this discovery.
[0168] Detailed Description of the Invention All cited documents in patent and non-patent literature are incorporated herein by reference in their entirety.
[0169] A nucleotide is an organic molecule composed of three subunits: a nucleobase, a pentose sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphate groups. A nucleobase is a nitrogen-containing biological compound, also known as a nucleic acid base or simply a base. Therefore, these terms are used interchangeably in this document. Regarding the major or standard nucleobases of DNA, the nucleobases include guanine (G), adenine (A), cytosine (C), and thymine (T); while in RNA, thymine is replaced by uracil (U).In addition to the major or standard nucleobases of DNA and RNA, other synthetic and / or naturally occurring nucleobases and / or (chemically) modified nucleobases may also be used in the context of this invention, such as: hm5C (5-hydroxymethylcytidine), m5C (5-methylcytidine), N4-methylcytosine, m6A (N6-methyladenosine), 5-methylaminomethyl-2-thiouridine (mam5s2u), 1-methyladenosine, 1-methylpseuuridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, N4-methylcytosine, 5-methylcytidine, N6- Methyl adenosine, 7-methylguanosine, 5-methylaminomethyluridine, β-D-mannosyl-queuosine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N6-isopentenyl adenosine, N-((9-β-D-furanoribosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-β-D-furanoribosylpurine-6-yl)N-methyl-carbamoyl)threonineuridine, 5-oxoacetic aciduridine-5-oxoacetic acid, wybutoxosine, pseudouridine, queuosine, 2 -Thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N-((9-β-D-rifuranosylpurine-6-yl)carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridine, huaistin, 3-(3-amino-3-carboxypropyl)uridine, 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methylpseudouridine, 2'-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine 1-Methylpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methylguanosine, 3-methylcytidine, p (pseudouridine), q (queusine), s2c (2-thiocytidine), 5fC (5-formylcytosine), 5caC (5-carboxycytosine), 2'-fluoro, 2'-O-methyl, 2'-fluoroarabinonucleotide, hexitol nucleic acid, 2'-O-methoxyethyl, ribulosinic acid (ribuloNA), (1'-3')-β-L-ribulosinic acid, α-L-threonic acid, 3'-2'-phosphonomethyl-threonic acid, 2'-deoxyxylanic acid.All possible chemical modifications and synthetic and / or naturally occurring nucleobases are well known to those skilled in the art (e.g., McCown et al., 2020, WIREs RNA; Sood et al., 2019, JCheminform; https: / / dnamod.hoffmanlab.org / ).
[0170] In embodiments, each nucleobase of the DNA—guanine (G), adenine (A), cytosine (C), and thymine (T), and uracil (U)—may be chemically modified and / or substituted with one of the aforementioned bases. In embodiments, the "X" in the nucleotide sequence also includes any chemically modified base and / or any of the aforementioned bases.
[0171] As defined in the context of this invention, a “sequence variant” or “variant” of an oligonucleotide or nucleic acid sequence may exhibit a nucleic acid sequence that differs from the original sequence in one or more mutations, such as one or more substitutions, insertions, and / or deletions of nucleotides. In embodiments, the sequence variations described herein may apply to conserved substitutions and / or percentage identity throughout one or more embodiments described herein. As defined herein, a nucleic acid substitution refers to an alteration of the nucleic acid sequence of a nucleic acid molecule in which one or more nucleic acids are replaced by the same number of (different) nucleic acids, thereby changing the nucleic acid sequence. Like addition, substitution can be natural or artificial. A “variant” of an oligonucleotide as defined in the context of this invention may exhibit one or more conserved nucleic acid substitutions compared to its natural (i.e., unmutated) physiological sequence. Such nucleic acid sequences particularly fall within the scope of the term “variant” as defined herein.
[0172] In embodiments of the invention, the oligonucleotide or target sequence may exhibit variations in sequence and / or length compared to the specific sequence described herein. In embodiments, nucleic acid molecules such as oligonucleotides may exhibit the addition or deletion of 0 to 10 nucleotides at the 5' or 3' end of the sequence, relative to the specific sequence described herein. As used herein, the term "addition or deletion of 0 to 10 nucleotides at the 5' and / or 3' end of the sequence" means that the nucleic acid has a) 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotides at its 5' end and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides deleted at its 3' end, or b) 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional nucleotides at its 3' end and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides deleted at its 5' end. c) 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at its 5' end and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at its 3' end, or d) 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides missing at its 5' end and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides missing at its 3' end.
[0173] In embodiments, the methods, kits, or oligonucleotides of the present invention are characterized in that the oligonucleotides and / or one or more Stx target sequences comprise nucleotide sequences having 80% or higher, 85% or higher, or preferably 90% or 95% or higher sequence identity with the sequences provided herein, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% sequence identity. Sequence variants having 80% to 99% sequence identity are preferably functionally similar, i.e., sequences exhibiting different nucleotide sequences, wherein they still exhibit similar specificity for the Stx to be detected, thereby preserving the function of the oligonucleotides and / or one or more Stx target sequences within the scope of the present invention. Those skilled in the art can test functionally similar sequences without inventive steps based on the information provided herein, for example, by testing Stx cleavage and / or depurination properties and preferences within the scope of the methods described herein.
[0174] As used herein, "percentage of sequence identity (%)", "sequence with % identity", "percentage of sequence homology (%)", or "sequence with % homology" for a specific "reference sequence" (e.g., one of the nucleic acid sequences disclosed herein) refers to the percentage of nucleotides in a particular sequence that are identical to those in the reference sequence, and is determined by comparing two best-aligned sequences in a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may contain additions or deletions (i.e., vacancies) to achieve best alignment of two or more sequences. The percentage is calculated to obtain the number of matching positions by determining the number of positions in the two or more sequences where the same nucleic acid base or amino acid residue appears, the number of matching positions is divided by the total number of positions in the comparison window, and the result is multiplied by 100 to obtain the percentage of sequence identity.
[0175] As used herein, “sequence identity,” “identity,” “sequence homology,” or “homology” in relation to two nucleic acid sequences refers to a specific percentage of identical residues in two sequences when compared by a specified comparison window to obtain a maximum match, as measured by a sequence comparison algorithm or visual inspection.
[0176] Insertion and substitution can occur, in particular, at sequence positions that do not alter the three-dimensional structure of the target sequence or only alter its three-dimensional structure to the desired degree.
[0177] According to the present invention, a "cleavage-dependent marker" is a detectable marker that generates a signal, wherein cleavage of an oligonucleotide causes a change in the signal. Therefore, all detectable markers that exhibit a signal change upon cleavage of an oligonucleotide according to the present invention are applicable. Examples of cleavage-dependent markers are described herein, and those skilled in the art can identify or use such markers without excessive effort.
[0178] In the context of this invention, "label" in embodiments may refer to one or more fluorophores and / or one or more quenchers. Accordingly, in the context of this invention, oligonucleotides in embodiments may carry or include one or more fluorophores and / or quenchers. Proximity between the fluorophore and the quencher blocks the detection of its fluorescence; wherein cleavage of the oligonucleotide by Stx disrupts the proximity relationship between the dye (fluorophore) and the quencher, and thus enables unquenched emission of fluorescence, which can be detected, for example, upon laser excitation. In embodiments, the oligonucleotide includes at least one fluorophore and at least one quencher (these are preferably present in "pairs"), wherein the quencher preferably suppresses the fluorophore signal as long as the oligonucleotide is not cleaved; wherein at least one fluorophore and at least one quencher are present relative to each other within the oligonucleotide, and may be located at their respective ends (3' and 5') and / or within the oligonucleotide sequence.
[0179] In embodiments where multiple quencher-fluorophore pairs exist within the oligonucleotide, these pairs may also be located in different positions relative to each other, for example, at at least one end and / or within the sequence of the oligonucleotide. In embodiments, the oligonucleotide may be unlabeled, include one or more labels; for example, it may be unlabeled, or may contain at least 1, 2, 3, 4, or 5 labels, or even up to 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 labels; or it may contain exactly 0, 1, 2, 3, 4, or 5 labels, or even 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 labels. In some embodiments, the oligonucleotide is unlabeled, includes 1, 2, or up to 3 labels. In other embodiments, the oligonucleotide is unlabeled, includes 1, 2, 3, 4, or 5 labels, or even more than 5 labels.
[0180] The term "nucleic acid" refers to nucleic acid molecules, including but not limited to: DNA, ssDNA, dsDNA, RNA, mRNA, tRNA, lncRNA, ncRNA, microRNA, siRNA, rRNA, sgRNA, piRNA, rmRNA, snRNA, snoRNA, scaRNA, gRNA, or viral RNA. The term "nucleic acid sequence" as used herein refers to the sequential arrangement of nucleotides, where nucleotides are represented by their nucleobases: guanine (G), adenine (A), cytosine (C), and thymine (T) in DNA and uracil (U) in RNA. The term "nucleic acid sequence" as used herein may also refer to a sequence of letters or nucleobases (composed of G, A, C, and T or U) representing the actual sequence of nucleic acids in a DNA or RNA chain. This nucleic acid sequence can be identified and characterized biochemically and bioinformatically using DNA or RNA sequencing, or specifically detected by complementary nucleic acid probes (e.g., the mediator probes described herein), for example, in the context of PCR, real-time PCR, or digital PCR detection reactions. Sequence analysis may also include comparing the obtained nucleic acid sequence or its specific detection signal with the detection signals of one or more reference nucleic acid sequences and / or housekeeping genes. The term nucleotide may be abbreviated as "nt". The term base pair (two nucleobases linked together by hydrogen bonds) may be abbreviated as "bp".
[0181] The term "oligonucleotide" as used herein can refer to or include nucleic acid molecules having a specific sequence of nucleotides. In the context of this invention, the terms "oligonucleotide" and "nucleic acid molecule," or in some contexts "oligonucleotide" and "SRL," are used interchangeably. Oligonucleotides are short DNA or RNA molecules (i.e., oligomers). Oligonucleotides are typically characterized by the sequence of nucleotide residues in their constituent molecules. Oligonucleotides can generally form sequence-specific structures and sometimes can form double-stranded or bistranded structures, as well as single-stranded and / or circular structures that extend / form the entire sequence or a portion thereof.
[0182] In the context of this invention, "target sequence" (or recognition sequence) refers to any nucleic acid sequence of interest that can serve as a target sequence for Stx-mediated depurination and / or cleavage in the method or oligonucleotide according to the invention. The target sequence may preferably be a DNA or RNA sequence. The target sequence may represent part or all of the nucleic acid sequence of the target DNA or oligonucleotide.
[0183] In the context of this invention, "signal change" refers to a change or appearance of a detectable signal. In embodiments, this is, for example, a change in fluorescence signal, a change in color, color development, a luminescence signal, or a light signal, or any other detectable signal. The signal change is preferably a significant, distinguishable, and / or characteristic change in a signal that clearly distinguishes itself from or differentiates it from a possible baseline or background signal, or environmental noise or background noise (e.g., a negative control or a buffer / culture medium control). Those skilled in the art will recognize that, in the context of signal detection, under certain detection conditions, nonspecific signals, baseline signals, or environmental noise or background noise may occur due to the presence of fluorophores, dyes, or other markers. Therefore, in the context of this invention, a signal change preferably refers to a significant, distinguishable, and / or characteristic change in a (detectable) signal, rather than a baseline or background signal or environmental noise or background noise. In embodiments, the signal change may mean an increase in fluorescence intensity, in other words, an enhancement of the fluorescence signal. In embodiments, the signal change may mean an increase in luminescence intensity, in other words, an increase in the luminescence signal. In embodiments, the signal change may mean an increase in color intensity or a change in color. In some embodiments, the signal change is a decrease in signal intensity. The increase in signal is preferably attributed to: in the presence of Stx, the oligonucleotides according to the invention are cleaved and / or depurinated by Stx.
[0184] In this embodiment, the resulting increase in the number of cleavage, digestion, and / or labeling separations leads to, for example, at least one fluorophore being released and / or separated from its quencher (i.e., the distance between the quencher and the fluorophore increases, so that the fluorescence signal is no longer quenched by the quencher). Therefore, the increase in the number of released and / or unquenched fluorophores results in an increase in the fluorescence signal, which is specific and indicates the presence of (enzymologically) active Stx.
[0185] A "fluorophore" (or fluorescent pigment, similar to a chromophore) is a fluorescent chemical compound that can re-emit light when excited by light. When constructing the labeled probe of this invention, fluorophores that can be used for labeling include, but are not limited to, rhodamine and its derivatives such as Texas Red, fluorescein and its derivatives such as 5-bromomethylfluorescein, Lucifer Yellow, IAEDANS, 7-Me2N-coumarin-4-acetate, 7-OH-4-CH3-coumarin-3-acetate, monobromobis(dimethylammoniobimane), pyrentrisulfonates such as Cascade Blue and monobromotrimethylammoniobimane, 7-NH2-4CH3-25-coumarin-3-acetate (AMCA), FAM, TET, CAL Fluor Gold 540, JOE, VIC, Quasar 570, CAL Fluor Orange 560, Cy3, NED, Oyster 556, TMR, CAL Fluor Red 590, HEX, ROX, and LC Red. 610, CAL Fluor Red 610, Texas Red, LC Red 610, CAL Fluor Red 610, LC Red 640, CAL Fluor Red 635, Cy5, LC Red 670, Quasar 670, Oyster 645, LC Red 705, Cy5.5, BODIPY FL, Rhodamine Green, Oregon Green 30 488, Oregon Green 514, Cal Gold, BODIPY R6Gj, Yakima Yellow, Cal Orange, BODIPY TMR-X, JOE, HEX, Quasar-570 / Cy3, TAMRA, Rhodamine Red-X, Redmond Red, BODIPY 581 / 591, Cy3.5, Cal Red / Texas Red, BODIPY TR-X, BODIPY 630 / 665-X, Quasar-670 / Cy5, Pulsar-650, Dy490, Atto-488, Atto532, Atto-Rho-6G, Dy590, Atto-Rho101, Cy5, Dy-636, Atto-647N, Cy5.5. Dy682, Atto-680, BMN-488, BMN-505, BMN-536, BMN-562, Rhodamine and its derivatives such as Texas Red, Fluorescein and its derivatives such as 5-bromomethylfluorescein, Fluorescein Yellow, IAEDANS, 7-Me2N-coumarin-4-acetate, 7-OH-4-CH3-coumarin-3-acetate, 7-NH2-4CH3-25-coumarin-3-acetate (AMCA), monobromobis(dimethylammonium)sulfonates such as Cascade Blue and monobromotrimethylammonium(dimethylammonium)sulfonates, FAM, TET, CAL FluorGold 540, HEX, JOE, VIC, CAL Fluor Orange 560, Cy3, NED, Quasar 570, Oyster 556, TMR, CAL Fluor Red 590, ROX, LC Red 610, CAL Fluor Red 610, Texas Red, LC Red 610, CAL FluorRed 610, LC Red 640, CAL Fluor Red 635, Cy5, LC Red 670, Quasar 670, Oyster 645, LC Red 705, Cy5.5, BODIPY FL, Oregon Green 30 488, Rhodamine Green, Oregon Green 514, Cal Gold, BODIPY R6Gj, Yakima Yellow, JOE, HEX, Cal Orange, BODIPY TMR-X, Quasar-570 / Cy3, TAMRA, Rhodamine Red-X, Redmond Red, BODIPY 581 / 591, Cy3.5, Cal Red / Texas Red, BODIPY TR-X, BODIPY 630 / 665-X, Pulsar-650, Quasar-670 / Cy5. .
[0186] "Quenching" refers to any process that reduces the fluorescence intensity of a given substance. Quenching is the basis of Förster resonance energy transfer (FRET) assays, static or contact quenching assays, or a combination of both. FRET is a dynamic quenching mechanism because energy transfer occurs while the donor is in an excited state. Contact quenching requires direct spatial proximity between the donor and the quencher in the form of physical contact. A "quencher" is a molecule that quenches the fluorescence emitted by a fluorophore when the fluorophore is excited by the light source of a PCR cycler or detection device. Quenchers that can be used as markers in the design of the labeled signal oligonucleotides and / or base chains of this invention include, but are not limited to, DDQ-I, Iowa Black, Iowa Black FQ, QSY-9, BHQ-1, QSY-7, BHQ-2, DDQ-II, 22 Eclipse, Iowa Black RQ, QSY-21, BHQ-3, Dabcyl, QSY-35, BHQ-0, ElleQuencher, BMN-Q1, BMN-Q2, BMN-Q60, BMN-Q-535, BMN-Q590, BMN-Q620, and BMN-Q650. Those skilled in the art are familiar with suitable reporter group-quencher pairs and know which pair to choose for a particular application.
[0187] In the context of this invention, "sample" preferably refers to a biological sample, which is preferably obtained or isolated from a patient, subject, tissue, cell, yeast, or bacterial culture, from the environment, or from food, animal, plant, or other biological sources. As used herein, the term "sample" can refer to, for example, a sample of bodily fluids or tissues obtained for the purpose of diagnosis, prognosis, or evaluation of a subject of interest (such as a patient). Preferably, the sample is a bodily fluid sample, such as feces, blood, serum, plasma, cerebrospinal fluid, urine, saliva, sputum, pleural effusion, cells, cell extracts, tissue samples, tissue biopsies, fecal samples, etc. In particular, the sample is blood, plasma, serum, or urine. Alternatively, the sample may be obtained from tissue, cell, yeast, or bacterial cultures, from the environment, or from food or other biological sources.
[0188] Samples may be selected from the following groups: liquid samples, solid samples, biopsies, liquid biopsies, tissue samples, cell culture samples, food samples, environmental samples, or samples derived from exchange. The sample may further include body fluids, whole blood or blood components, plasma, serum, cells, tissues, saliva, sputum, mucus, phlegm, semen, vaginal fluid, cerebrospinal fluid, urine, or pleural effusion.
[0189] Culture medium, also known as growth medium (the two terms are used interchangeably in this document), is used to culture microorganisms, cells, and tissues, and can be classified, for example, as liquid (e.g., broth, nutrient broth, or nutrient solution), semi-liquid (viscous), and gel-like ("solid") media (nutrient media).
[0190] Solid culture media are those that have taken on a gel form due to the addition of a gelling agent (e.g., agar-agar). Solid culture media are primarily used for analytical purposes because they also allow for the quantification of microorganisms. Semi-solid culture media are mainly used in thick-layer forms in test tubes, which are called "thick-layer tubes." This so-called "soft agar" contains agar-agar at a lower concentration than the agar concentration typically found in high-stiffness media. In embodiments, the culture medium may contain nutrients for bacterial or cell growth, or it may include additional substrates, such as oligonucleotides and / or buffer reagents and / or detection reagents as described herein.
[0191] The terms "patient" and "host" are used interchangeably here. A patient or host can be an organism, a cell culture of a patient cell or cell line, an animal, or a cell culture of an animal cell or cell line. A patient preferably refers to the species from which the sample was collected, and / or the species from which the biological material of the sample constitutes the majority of the biological material. Patients can be selected freely from the group consisting of: vertebrates, animals, farm animals, mammals, and humans, preferably mammals or humans.
[0192] In this document, the method according to the present invention may also be referred to as the enzyme assay or simply the assay. Attached Figure Description
[0193] The present invention is further described with reference to the following drawings. These are not intended to limit the scope of the invention, but rather represent preferred embodiments of the invention to provide an explanation of the invention described herein.
[0194] Figure 1 The assay principle according to embodiments of the present invention includes the detection of Stx activity based on agar. A) Enzymatic reaction of Stx; B) Visualization of an example using a modified chromogenic probe (other reading methods are also possible); C) The application principle of the probe in laboratory diagnostics.
[0195] Figure 2 Comparison of 28S rRNA sequences of SRL in Homo sapiens and brown rats. The 28S rRNA sequences of the ricin-toxin loop in Homo sapiens (left, PDB 7UCR; SEQ ID NO: 9) and brown rats (right, PDB 1SCL; SEQ ID NO: 10) are shown. Highly conserved regions are highlighted in bold. The SRL recognition sequence G... AGAG is printed in gray font. Light gray underline = Stx identifies adenine depurinated within the sequence. A Watson-Crick base pairings are indicated by dashed lines. This figure was created using BioRender.com.
[0196] Figure 3 According to embodiments of the oligonucleotides of the present invention, in these embodiments, they represent synthetic single-stranded substrates (ssDNA, having a fluorophore and a quencher) based on SRL sequences and can be used to study Stx activity. Substrates 1-4 (StxSense1-4), substrate 4 as an RNA sequence (“4RNA”), and substrates 5, 9, 12, 15, and 16 (StxSense5, 9, 12, 15, and 16) are shown. Exemplary embodiments of the oligonucleotides of the present invention are shown, wherein embodiments 4 and 12 may be particularly preferred in some embodiments. Q = quencher; fluorophore (F): Cy5 = Cy5 fluorophore; FAM = 6-FAM fluorophore (fluorescein). Sequence color marking: light gray underline = depurine adenine within the Stx recognition sequence ( A ); 3 (GAGAG) Dark gray = repeating recognition sequence; underlined nucleotides = adapter sequence. Substrate image created using BioRender.com.
[0197] Figure 4 The location of the ricin-fucoidin ring (SRL), the target of Stx activity, within the 60S subunit of the ribosome. Synthetic SRL mimics containing a fluorophore (6-FAM) and a quencher (Q) were used for in vitro detection of Stx enzymatic activity. In the presence of Stx, SRL is depurinated, and its sugar-phosphate backbone is cleaved. Consequently, the fluorophore and quencher are no longer in physical proximity, resulting in a fluorescent signal.
[0198] Figure 5 This is a schematic diagram of a test procedure according to an embodiment of the method of the present invention, aimed at obtaining evidence of Stx activity from a sample. Here, evidence of Stx activity is obtained using a synthetic substrate that mimics SRL. This substrate is coupled with a fluorophore and a quencher. Stx cleaves the SRL substrate, resulting in the formation of a fluorescence signal. Based on this test procedure, the intensity of the fluorescence signal induced by Stx-positive samples can also be increased by modifying the sequence of the SRL substrate.
[0199] Figure 6Comparative analysis of several embodiments of developed SRL substrates (oligonucleotides) for specific detection of Stx activity. A comparative analysis from Example 1, wherein an embodiment of the oligonucleotides according to the present invention is used as an SRL substrate for specific detection of Stx activity. Based on (A) reference strain EDL933 O157:H7 (stx1a / 2a) and (B) 16-02409O157:H7 (stx2a), different SRL substrates (see also) were analyzed over a 12-hour time period. Figure 3 Analysis was performed using the substrate “5'FAM-stem-[SRL]” (substrate number 4; StxSense4; SEQ ID NO: 7). Stx enzyme activity was detected in both strains, but not in EDL933. Undetectable in stx1 / 2. Statistical analysis of the two strains using substrate 4 (StxSense4) showed that their fluorescence signals were similar to EDL933. stx1 / 2 There were significant differences compared to other tested substrates. The curve (median) is shown. Statistical analysis was performed using the Mann-Whitney test (for non-normally distributed data) and the Student's t-test with Welch correction (for normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 RFU, relative fluorescence unit; t[h], time [hours].
[0200] Figure 7 In this test, 100 mM ammonium acetate (depurinase buffer) was preferred and enhanced the fluorescence signal of Stx-positive samples. STEC strains were incubated in LB (pH 7) with ciprofloxacin (Cip) at 37°C and 250 rpm for 24 h. The Stx activity of the culture supernatant was then compared in 10 mM and 100 mM ammonium acetate. Results from three independent experiments are shown. Enzymatic activity of Stx produced in the culture supernatant of all cultures was repeatedly measured over 12 h using fluorescence development (RFU). Data are presented as median. Statistical analysis was performed using a Welch-corrected Student's t-test (for normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 RFU, relative fluorescence unit; t[h], time [hours].
[0201] Figure 8 Stx activity with DNA-based SRL substrates was preferably measured at an acidic pH. Bacterial strains were incubated for 24 h at 37 °C and 250 rpm in LB (pH 7) with Cip. Stx activity in the culture supernatant was then measured in 100 mM ammonium acetate at pH 3 to 7. Results from three independent experiments are shown. Enzymatic activity of Stx produced in the culture supernatant of all cultures was repeatedly measured over 12 h using fluorescence display (RFU). Data are presented as median values. Statistical analysis was performed using a Welch-corrected Student's t-test (for normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 D. RFU, relative fluorescence unit; t[h], time [hours].
[0202] Figure 9 In this test, the preferred minimum SRL concentration for Stx significance detection was 2 μM, and the curves showed saturation at 4 μM SRL (EDL933) and 5 μM SRL (16-02409), with RFU reaching its maximum. Bacterial strains were incubated in LB (pH 7) with Cip at 37°C and 250 rpm for 24 h. Subsequently, the culture supernatant was tested with different concentrations (1 µM to 8 µM) of SRL substrate in 100 mM ammonium acetate (pH 4) to examine enzyme activity. The results (median) of strains (A) EDL933 and (B) 16-02409 over time in three independent experiments are shown. Enzymatic activity of Stx produced in the culture supernatant of all cultures was repeatedly measured using fluorescence display (RFU) within 12 h. Statistical analysis for endpoint analysis was performed using a Welch-corrected Student's t-test (for normally distributed data endpoints). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 RFU, relative fluorescence unit; t[h], time [hours].
[0203] Figure 10The reaction temperature and sample dilutions could be adjusted relative to each other to optimize the detection of Stx activity in different samples. Bacterial strains were incubated for 24 h at 37 °C and 250 rpm in LB with Cip. Subsequently, the enzyme activity of culture supernatants for (A) EDL933 and (B) 16-02409 was tested at reaction temperatures between 37 °C and 57 °C (100 mM ammonium acetate, pH 4). Stx activity of culture supernatants diluted 1:2 and 1:5 (C, D) was also tested within a temperature range between 37 °C and 45 °C. The results of the three independent experiments over time (median) are shown. Enzymatic activity of Stx produced in the culture supernatants of all cultures was repeatedly measured within 12 h using fluorescence development (RFU). Data are presented as median values. Statistical analysis was performed using a Welch-corrected Student's t-test (for normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 RFU, relative fluorescence unit; t[h], time [hours].
[0204] Figure 11 In this test, the enzyme assay detects Stx2a-g and Stx1a-c in the culture supernatant, preferably after 30 min to 8 h, depending on the Stx concentration. To verify whether the enzyme assay detects all Shiga toxin subtypes, STEC strains covering the Stx1a-d and Stx2a-g subtypes were incubated for 24 h at 37°C and 250 rpm in LB (pH 7) with 12 ng / mL Cip. Stx production was analyzed as follows: Stx2 in the culture supernatant was detected using a Vero cell cytotoxicity assay and Western blotting (C), using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). Subsequently, the culture supernatant was analyzed in an enzyme assay (100 mM ammonium acetate, pH 4) to test enzyme activity (A, B). Enzymatic activity of Stx produced in the culture supernatants of three independent cultures for all cultures was repeatedly measured over 12 h using fluorescence visualization (RFU). Gray areas indicate samples classified as negative (relative to EDL933). stx1 / 2The data are presented as median values. Statistical analysis for the endpoint analysis was performed using a Welch-corrected Student's t-test (for endpoints of normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 RFU, relative fluorescence unit; t [h], time [hours]; MW [kDa], molecular weight.
[0205] Figure 12 The enzyme assay for STEC detection is based on Stx and is independent of the STEC serogroup. To verify whether this enzyme assay can detect other important serogroups besides O157 based on the generated Stx, three STEC strains from each of the O26, O91, O111, O113, O121, and O145 serogroups were selected from the strain library of the National Reference Center [NRZ(RKI)]. These strains were incubated in LB (pH 7) with Cip at 37°C and 250 rpm for 24 h. Subsequently, the culture supernatant was analyzed in an enzyme assay (100 mM ammonium acetate, pH 4) to examine Stx activity (A, B). Representative STEC strains for each serogroup are shown. Stx production was assessed using the following assays: a cytotoxicity assay with Vero cells (D) and Western blot (C) to detect Stx2 in the culture supernatant, using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). Stx activity for all three independent cultures was measured repeatedly over 12 hours using fluorescence visualization (RFU). Gray areas indicate samples classified as negative (relative to EDL933). stx1 / 2 The data are presented as median values. Statistical analysis for the endpoint analysis was performed using a Welch-corrected Student's t-test (for endpoints of normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 RFU, relative fluorescence unit; t [h], time [hours]; MW [kDa], molecular weight.
[0206] Figure 13: Detection of Shigella strains producing Stx. Composed of Shigella dysenteriae (Stx1) and Shigella flexneri (Stx1). Shigella flexneri The Stx produced by (Stx2) was the same as that produced by STEC (95% (Stx1) and 55% (Stx2)). To test whether the enzyme assay also detected Stx produced by Shigella, five Shigella dysenteriae strains and six Shigella flexneri strains were selected from the NRZ (RKI) strain library. Representative Shigella strains in each case are shown. The strains were incubated in LB (pH 7) with Cip at 37°C and 250 rpm for 24 hours. Stx production was tested by detecting Stx2 in the culture supernatant using a cytotoxicity assay with Vero cells (A) and Western blotting (B), using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). (C) Stx activity for all three independent cultures was repeatedly measured over 12 h using fluorescence display (RFU). The gray area indicates that the sample was classified as negative (relative to EDL933). stx1 / 2 The data are presented as median values. Statistical analysis for the endpoint analysis was performed using a Welch-corrected Student's t-test (for endpoints of normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2. RFU, relative fluorescence unit; t [h], time [hours]; MW [kDa], molecular weight.
[0207] Figure 14The enzyme activity using the SRL substrate showed no cross-reactivity with other non-Stx-producing enteropathogenic Escherichia coli (EAEC, EPEC, EIEC). Since samples from diarrheal patients may also contain other enteropathogenic Escherichia coli, the cross-reactivity of these strains with the specific SRL substrate was examined. Two strains were selected from the NRZ (RKI) strain library. These strains were incubated in LB (pH 7) with Cip at 37°C and 250 rpm for 24 h. Stx production was assessed using (A) a cytotoxicity assay with Vero cells and (B) Western blotting to detect Stx2 in the culture supernatant, using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRad Laboratories, Inc.). (C) Stx activity in three independent cultures for all cultures was repeatedly measured over 12 h using fluorescence visualization (RFU). The gray area indicates that the sample was classified as negative (relative to EDL933). stx1 / 2 The data are presented as median values. Statistical analysis was performed using the Welch-corrected Student's t-test (for normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 RFU, relative fluorescence unit; t [h], time [hours]; MW [kDa], molecular weight.
[0208] Figure 15 For other enteric pathogens that do not possess Stx (Salmonella spp., Yersinia spp.), no nonspecific reactions were detected when using SRL substrates to detect enzyme activity. Besides the already tested enteric pathogen Escherichia coli, other enteric pathogens can also cause diarrhea. To rule out nonspecific reactions of these pathogens to the enzyme assay, four species of Yersinia spp. (…) Yersinia sp .) and six species of Salmonella ( Salmonella spp.The strain was tested. The strain was incubated in LB (pH 7) with Cip at 37°C and 250 rpm for 24 h. Stx production was tested using (A) a cytotoxicity assay with Vero cells and (B) Western blot to detect Stx2 in the culture supernatant, using α-Stx2 (mouse, 135 / 6-B9, Sifin) and fluorescent α-mouse IgG (StarBright Blue B520, BioRadLaboratories, Inc.). (C) Stx activity for all three independent cultures was repeatedly measured over 12 h using fluorescence visualization (RFU). Gray areas indicate samples classified as negative (relative to EDL933). stx1 / 2 The data are presented as median values. Statistical analysis was performed using the Welch-corrected Student's t-test (for normally distributed data). p<0.05; p<0.01; (p<0.001), relative to EDL933 stx1 / 2 RFU, relative fluorescence unit; t [h], time [hours]; MW [kDa], molecular weight.
[0209] Figure 16 The following describes the in vitro detection of Shiga toxin enzyme activity according to an embodiment of the method of the present invention. The sample was incubated for 24 h at 37°C and 250 rpm on LB medium with 12 ng / mL Cip, or on LB agar with 12 ng / mL Cip. 5 μL of the obtained culture supernatant, or 1 to 3 single colonies, was added to a white 96-well plate along with the prepared reaction mixture. The enzymatic reaction was carried out at 44°C for 1 to 12 h. The fluorescence signal (RFU, relative fluorescence units) was detected using a fluorescence detection device such as a real-time circulator. Culture supernatant / colony of reference strain EDL933 was used as a positive control; LB and EDL933 stx1 / 2 As a negative control, and with a defined threshold. This image was created using BioRender.com.
[0210] Figure 17 A) Stx activity was detected using substrates StxSense1 to StxSense4 and the STEC strain EDL933 O157:H7, which produces Stx1a and Stx2a. B) Stx activity was detected using substrates StxSense1 to StxSense4 and the STEC strain 16-02409 O157:H7, which produces Stx2a.
[0211] Figure 18 A) Stx activity was detected using substrates StxSense4, 5, 9, 12, 15, and 16, as well as the STEC strain EDL933 O157:H7 which produces Stx1a and Stx2a. B) Stx activity was detected using substrates StxSense4, 5, 9, 12, 15, and 16, as well as the STEC strain 16-02409 O157:H7 which produces Stx2a.
[0212] Figure 19 A) Stx activity was assessed using substrates StxSense1 through StxSense4, and the gene knockout mutant EDL933 O157:H7, which does not produce Stx1 and Stx2. B) Stx activity was assessed using substrates StxSense4, 5, 9, 12, 15, and 16, and the gene knockout mutant EDL933 O157:H7, which does not produce Stx1 and Stx2.
[0213] Figure 20 Comparison of DNA / RNA substrates StxSense4. Using DNA-based and RNA-based StxSense4, targeting STEC strain EDL933 O157:H7, stx1a / 2a and the gene knockout mutant EDL933 O157 stx1 / 2 Stx enzyme activity was analyzed.
[0214] Example The present invention is further described by the following embodiments. These are not intended to limit the scope of the invention, but rather to illustrate preferred embodiments of various aspects of the invention for illustrative purposes.
[0215] Materials and methods In this embodiment, a synthetic single-stranded DNA substrate was used to detect the enzyme activity of Stx. Figure 4 The location of the ricin-fucoidin ring (SRL) targeted by Stx activity within the 60S subunit of the ribosome is shown. A synthetic SRL mimic with a fluorophore (6-FAM) and a quencher (Q) was used for in vitro detection of Stx enzymatic activity. In the presence of Stx, SRL is depurinated, and its sugar-phosphate backbone is cleaved. Consequently, the fluorophore and quencher are no longer in physical proximity, resulting in a fluorescent signal.
[0216] bacterial strains As the basis of this invention, the inventors examined a total of 94 strains from the strain library of the National Reference Center (NRZ) of the Robert Koch Institute (RKI) for Salmonella and other bacterial enteropathogens between 1998 and 2021, as well as two established reference strains, EDL933 and EDL933. stx1 / 2 PCR was used to confirm the presence of [the virus] in all strains. Stx The strains encompassed different serotypes and various types and subtypes of Shiga toxin. The tested STEC strains carried... stx1, stx2 or stx1 / 2 combination.
[0217] The sample strains selected for developing the method (e.g., enzyme assay) according to the invention consist of the following: reference strains EDL933 O157:H7 and STEC strain 16-02409 O157:H7 as positive controls; and Escherichia coli C600 and KO mutant EDL933 as negative controls. stx1 / 2 O157:H7. In addition, other enteropathogenic Escherichia coli strains without the Stx gene were used as control strains: three enteropathogenic Escherichia coli (EPEC), three enterocele Escherichia coli (EAEC), and two enteroinvasive Escherichia coli (EIEC). Additionally, six Salmonella species and four Yersinia enterocolitica strains were also included. Yersinia enterocolitica Eleven strains of Shigella flexneri and Shigella dysenteriae were tested.
[0218] Table 4: The strains used in this embodiment for developing enzyme assays were selected from the positive and negative controls.
[0219]
[0220] Culture of STEC strains in liquid medium and on agar plates and induction of Stx production Preparation of culture supernatant stx Inducement) For each bacterial strain, 3 mL of LB medium warmed to room temperature was placed in a sterile glass tube. STEC strains were picked from the glycerol stock solution using a sterile glass rod and inoculated into the LB tubes for overnight culture. The overnight culture conditions were 37°C and 250 rpm in a shaker (New Brunswick Scientific, Innova 42) for 16 hours. The following day, the OD600 of each culture was measured using a spectrophotometer (Beckman Coulter, DU720). Subsequently, all cultures were adjusted to an OD600 of 0.05 using 4 mL of fresh LB medium in new sterile glass tubes. To induce Stx production, 5 µL of 10 µg / mL Cip (final Cip concentration: 12 ng / mL) was added to the culture tubes. The samples were then incubated in a shaker at 37°C and 250 rpm for 24 hours. During the testing of the optimal inducers for Shiga toxin induction, mitomycin C (MMC, 1 mg / mL), gentamicin (1.2 µg / mL), and ethylenediaminetetraacetic acid (EDTA, 20 mM) were also investigated.
[0221] To obtain the culture supernatant, 3 mL of bacterial culture was transferred to a 1.5 mL reaction tube (Eppendorf) and centrifuged at 9,000 x g for 5 min. The supernatant was then separated from the precipitate. The culture supernatant was then aseptically filtered using a 0.2 µm filter (Sartorius) and stored at 4°C for no more than one week until use in experiments; the precipitate was stored at -20°C.
[0222] Concentration of Stx culture supernatant (preferably without concentration) If necessary, concentrate 2 mL of the Stx-induced and sterilized supernatant using a centrifugal filter (Amicon Ultra 0.5 mL Centrifugal Filter, size exclusion molecular weight 10 kDa, Merck Millipore) to 100 µL (i.e., 10-fold or 20-fold concentration). For this purpose, centrifuge 500 µL of Stx culture supernatant in four cycles at 14,000 xg for 6 min each. Then, transfer the concentrated 100 µL volume to a new 1.5 mL reaction vessel by centrifuging at 1,000 rpm for 2 min with the filter column inverted. The concentrate should be stored at 4°C for no more than one week, and then stored at -20°C.
[0223] Culture of STEC strains on LB agar The selected strains were additionally cultured on LB agar plates supplemented with 12 ng / mL Cip. For this purpose, 100 µL of 12 ng / mL Cip was plated on sterile LB agar plates, and then a small amount of STEC strain was picked from the corresponding cryovials and streaked onto the agar plates using a sterile glass rod. The agar plates were incubated at 37°C for 18 h.
[0224] Optimization of liquid-based Stx enzyme activity assay To enhance the fluorescence signal (relative fluorescence units, RFU) of Stx-positive samples, several parameters of the liquid-based assay were adjusted and compared with previous optimal conditions. The following parameters were tested: plate type (white / clear, different manufacturers), depurinating buffer with 10 mM and 100 mM ammonium acetate (pH 4), depurinating buffer at pH 4 / pH 5 / pH 6 / pH 7, temperature gradient between 30°C and 55°C, and different concentrations of fluorescent SRL substrate (final concentration 1–8 µM).
[0225] Enzyme activity assay of STEC single colonies Routine culturing of STEC strains on agar plates also resulted in the secretion of Stx into LB agar (Kimmitt et al., 2000). For this purpose, 20 µL of the reaction mixture (19.5 µL of 10 mM ammonium acetate at pH 4 and 0.5 µL of SRL stock solution per sample) was transferred to the wells of a white 96-well plate. Subsequently, one to three colonies from the induced STEC strains grown on LB agar were randomly picked using an inoculation loop and transferred to the reaction buffer prepared above (20 µL of reaction buffer). Triple replicates were performed for each sample, as not all individual colonies produce Stx (Scotland et al., 1988). The enzymatic activity of Stx was measured in the same manner as that of the induced Stx culture supernatant.
[0226] Stx specificity determination To determine the specificity of the enzyme assay, STEC strains forming different Stx subtypes, Stx1 and Stx2, were used. Other serotypes were tested in addition to the "classic" STEC serotype O157:H7. To rule out nonspecific cross-reactivity with other diarrheal pathogens, various enteropathogenic Escherichia coli (EAEC, EPEC, EIEC) and other enteropathogens such as species of Shigella, Yersinia, and Salmonella were also tested.
[0227] Substrate To optimize the in vitro detection of detectable Stx enzyme activity, five different substrates based on the ricin ring (SRL) were designed and manufactured by idt Integrated DNA Technologies (see Table 1). Each of these SRL substrates is conjugated with a fluorophore / quencher pair, with the quencher located at the 3' end in all substrates. For substrate 1, the Cy5 fluorophore binds directly to adenine (manufacturer biomers.net) depurinated by Stx. All other substrates (substrates 2 through 4, manufacturer idt) are labeled with a 6-FAM fluorophore at the 5' end. In the initial state without the addition of Stx, the fluorophores in all substrates are close to the quencher, causing the fluorescence of the fluorophore to be absorbed by the quencher, thus rendering the fluorescence undetectable. Once the enzymatically active Stx depurinates the specific adenine, and additional strand breaks on the ssDNA produce the fluorophore and quencher fragments, the fluorescence is no longer absorbed by the quencher. Figure 3 Several synthetic SRL substrates (numbered 1 to 4; as embodiments of oligonucleotides according to the invention) are shown. Cy5 and FAM (here 6-FAM) represent fluorescent markers, and Q represents a quencher (BMN-Q620 in substrate 1, BHQ-1 in substrates 2-5). The Stx recognition sequence is highlighted in gray and embedded in the brown rat SRL sequence, while the target adenine for depurination is underlined. Substrate 3 contains two recognition sequences; substrate 5' FAM-Zen-SRL contains an additional internal quencher (Zen). Substrate 4 and 5' FAM-Zen-SRL contain adapted sequence ends (5' ACTT and 3' TGA) to improve fluorescence signal. This image was created using BioRender.com. Figure 4 The oligonucleotides (“ssDNA substrates”) used in this embodiment and their nucleotide sequences are also listed in Table 1.
[0228] These embodiments of the oligonucleotides according to the present invention were analyzed using the method described herein.
[0229] Figure 5 This illustrates the most important step in an enzyme assay for detecting Stx activity using a synthetic substrate mimicking SRL (i.e., an oligonucleotide embodiment according to the invention). This substrate is coupled with a fluorophore and a quencher. Stx cleaves the SRL substrate, resulting in the formation of a fluorescent signal. Fluorescently labeled single-stranded DNA substrates based on the ricin ring (SRL) can be used to detect the enzyme activity of Shiga toxin.
[0230] Enzyme activity was measured using Stx culture supernatant. Enzymatic assays for active Shiga toxin were performed in 96-well plates using STEC culture supernatant. Enzyme activity in samples (e.g., prepared STEC culture supernatant) could be verified by substrate conversion. Fluorescence was detected using a real-time circulator equipped with either a FAM or Cy5 filter, based on the fluorescent label. The reaction was carried out in white 96-well plates (Eppendorf SE (twin-tec®)). The reaction was conducted in a reaction mixture consisting of 100 mM ammonium acetate (pH 4) and SRL substrate. Ammonium acetate was stored at RT, and the SRL substrate was stored at -20°C until use. For each sample, 14.6 µL of 100 mM ammonium acetate (pH 4) was mixed with 0.4 µL of SRL substrate (100 mM stock solution; final concentration 2 µM) and added to the well. Subsequently, 5 µL of Stx culture supernatant was added to the reaction mixture to analyze the sample, and the reaction was carried out in a real-time circulator (CFX Opus 96, BioRad Laboratories). Stx activity was analyzed using RFU values measured in Excel and graphically visualized in GraphPad Prism 9 (GraphStats Technologies).
[0231] Table 5: Settings for performing enzyme activity assays in a real-time circulation instrument
[0232] Detecting enzyme activity in a reaction vessel The feasibility of detecting the enzymatic activity of Stx in a reaction vessel using ChemiDoc MP was investigated. For this purpose, 37.5 µL of 2 µM 5'FAM-stem-SRL in 100 mM depurinated buffer was mixed with 12.5 µL of Stx culture supernatant in a 1.5 mL reaction vessel and incubated at 44 °C (thermomixer, Eppendorf SE). The method was performed similarly to that used in 96-well plates, using the same reaction mixture:culture supernatant ratio. The enzymatic reaction was subsequently tested in a ChemiDoc (Bio-Rad Laboratories, Inc.) using a fluorescein filter. The fluorophore attached to the SRL substrate, 6-carboxyfluorescein (6-FAM), requires an excitation wavelength of λ = 495 nm and emits light at a wavelength of λ = 517 nm.
[0233] Example 1 This embodiment illustrates an RNA-based approach. NThe principle of enzyme assay for glycosidase activity is described in the embodiments of this invention, which enable the assay method. For the development work, the inventors used, among other things, SRLs derived from bacteria, yeast, or rats (brown rats). Human and rat SRL sequences differ at the single nucleotide level (see [link to invention]). Figure 2 (See Table 1). The nucleotide sequences of 28S rRNA and, consequently, SRL are highly conserved, especially at positions 4320 to 4329 in eukaryotic cells. The recognition sequence GAGA for Stx is also located in this region (Iordanov et al., 1997), which means that the effects of SRL should be organism-independent.
[0234] Five synthetic SRL substrates were designed based on natural SRL sequences to detect the enzymatic activity of Stx. To detect Stx activity, a sufficiently strong fluorescence signal is required, which should reliably distinguish Stx-positive and Stx-negative samples after a short testing time. To evaluate the developed substrates, culture supernatants of reference strain EDL933 O157:H7 and STEC strain O157:H7 16-02409 were used, along with LB culture medium and the KO mutant EDL933 as negative controls. Δstx1 / 2 O157:H7 (Gobert et al., 2007). Since Stx1 and Stx2 cannot be formed in this strain, a positive signal from the culture supernatant of this strain indicates a nonspecific reaction with the substrate. For more information on strain selection, see Section 3.2.1. The enzymatic reaction was carried out at 44°C in 100 mM ammonium acetate (pH 4) and 2 μM substrate in white 96-well plates from Eppendorf (TwinTec).
[0235] result The result is Figure 6 The curves of two Stx-producing strains, EDL933 and 16-02409, are shown in the figure. The curves are displayed over 12 hours (h).
[0236] All five substrates and three different bacterial strains were analyzed in the same reaction process within a white 96-well plate in a real-time apparatus. When detecting Stx activity using the five different SRL substrates, the same culture supernatant was used in each case to allow for direct comparison of the effects of each substrate. Stx production in the culture supernatant was validated using Vero cell cytotoxicity assays, Western blotting, and a Stx ELISA. Throughout the period, EDL933 was used for all SRL substrates. Δ stx1 / 2The curves were within the medium control range, where differences in fluorescence intensity existed between the SRL substrates. Using established methods, Stx was detectable in the culture supernatant in both Stx-producing strains. For EDL933, an increase in the curves was detected for substrate 2 (5'FAM-SRL or "StxSense2"; see Table 1) and substrate 4 (5'FAM-Stem-SRL or "StxSense4"; see Table 1). With substrate 4, Stx was detectable in both strains after one hour of reaction time, significantly higher than the negative control. In contrast, with substrate 2 (5'FAM-SRL or "StxSense2"), Stx activity could only be assessed as positive after six hours of reaction time. For EDL933, detection with substrate 4 ("5'FAM-Stem-SRL or "StxSense4") was 6 times faster than with substrate 2. The other three test substrates did not show an increase in the curve, meaning that at least under the selected specific conditions (assay conditions, strain EDL933, etc.), substrates 1, 3, and 5'FAM-Zen-SRL (see Table 1) were less suitable for detecting Stx activity in strain EDL933 compared to the other two substrates. For strain 16-02409, two positive curves were also detected (substrates 4 and 5'FAM-Zen-SRL). Similar to EDL933, with substrate 4, active Stx was detectable in the culture supernatant after only one hour of reaction time, while detection with substrate 5'FAM-Zen-SRL required approximately seven times longer. For the other three substrates, no positive signal was detected in the Stx culture supernatant. Figure 6 (See Table 1). Under the given conditions, only the two developed substrates could be used to detect Stx activity in both strains. Compared to other substrates, substrate 4 detected Stx earlier, and therefore, given its rapid detection of Stx in both STEC strains and its lack of reaction with the negative control, substrate number 4 (“5'FAM-stem-SRL” or “StxSense4”) was selected as the optimal substrate for all subsequent tests.
[0237] The detected fluorescence was used as a marker for the following: positive control EDL933, test strain STEC 16-02409, and negative control EDL933. stx1 / 2 The substrate was hydrolyzed by Stx. For the two Stx-producing strains (EDL933 and 16-02409), the substrate 5'FAM-stem-SRL (“StxSense4”; No. 4) was the optimal substrate for detecting Stx activity. The results represent the median of three replicates (n=3) and are representative of three independent experiments. Statistical analysis was performed using Student's t-test (corrected according to Welch's method). p<0.05; p<0.01; (, p<0.001), where the results are compared with EDL933 The results of stx1 / 2 are compared. RFU, relative fluorescence unit; t[h], time [hours].
[0238] Optimization of the method (enzyme assay) according to the present invention Enzymatic reactions are sensitive equilibrium processes. To date, research on Stx activity remains limited. Basu et al. investigated the in vitro activity of Stx on RNA and DNA substrates. They found that these reactions require an acidic pH and can proceed at both 20°C and 37°C (Basu et al., 2016). Stx activity is independent of cofactors such as NADP (Jackson, 1990).
[0239] After defining the embodiments of the invention using different substrates, the objective shifted to enhancing the fluorescence signal of Stx-positive samples and improving the stability of the enzymatic reaction and assay. Therefore, the various components of the enzyme assay were systematically studied and adjusted. For this purpose, the reaction solution, reaction temperature, and sample dilution, including ammonium acetate and SRL substrate, were tested.
[0240] Example 2 – Enhancing fluorescence in Stx-positive sample detection using a buffer solution containing 10-100 mM ammonium acetate Signal Stx activity assays were performed in a depurinated buffer consisting of ammonium acetate and SRL substrate. Literature indicates that a 10 mM buffer can be used for testing the enzyme activity of ribosome-inactivated proteins and for mass spectrometry analysis (Roday et al., 2008; Li and Tumer, 2017). Previous Stx activity assays used RNA-based SRL substrate concentrations between 1 mM and 2 μM (Basu et al., 2016, Li and Tumer, 2017), corresponding to substrate number 4 (5'FAM-stem-SRL; "StxSense4"), with a substrate cost of approximately €0.20 per sample. The effect of 2 μM SRL substrate on ammonium acetate concentration was analyzed for 12 h at 44 °C. The pH of both solutions was adjusted to pH 4. Stx activity was tested using 10 mM and 100 mM ammonium acetate, respectively. Figure 7 Under the above conditions, the selected strains (EDL933, 16-02409 and EDL933) were tested. Δstx1 / 2 The activity of Stx in the negative control and the α-control was tested.
[0241] No nonspecific reactions were detected in the negative control at any time point under both test conditions. Based on the RFU values of the negative control, the background noise was RFU=1167 in 10 mM ammonium acetate and RFU=905 in 100 mM ammonium acetate. In a direct comparison using depurinating buffer, higher Stx activity was detected in 100 mM ammonium acetate for both Stx-producing strains. (16-02409) stx2a and EDL933, stx1a / 2a Of the two, 100 mM ammonium acetate immediately increased the fluorescence signal after the reaction started, with RFU showing a 1.7-fold increase after only 2 hours. Eight hours after the reaction started, the curve for 16-02409 reached a plateau and remained constant until the end of the enzyme assay (12 hours). Two hours after the reaction started, the curve for 16-02409 in 100 mM ammonium acetate was clearly positive compared to the negative control. In 10 mM ammonium acetate, the curve was considered positive two hours after the reaction started. However, the increase in RFU was lower, and the maximum RFU value for 100 mM ammonium acetate was only reached after 12 hours of reaction time.
[0242] For the two STEC strains tested and their culture supernatants, the use of 100 mM ammonium acetate resulted in enhanced fluorescence signals, which were crucial for detecting Stx activity in EDL933.
[0243] Example 3 – In the enzymatic Stx detection process, a pH value below pH 5 is preferred. When using synthetic RNA substrates to test the enzyme activity of toxins, an acidic pH is crucial (Roday et al., 2008). Previous literature has examined the activity of ribosomally inactivated proteins such as ricin (Li and Tumer, 2017), and in some cases, the activity of Stx (Basu et al., 2015). Therefore, in the following sections, the activity of Stx in 100 mM ammonium acetate at pH levels between 3 and 7 will be tested. Figure 8 ).
[0244] EDL933, stx1a / stx2a and 16-02409, stx2a The curves are comparable. Negative control EDL933 Δ stx1 / 2Neither LB nor EDL showed nonspecific reactions at the tested pH values. At pH 3 and 4, significantly increased fluorescence signals were measured in EDL933 one hour after the reaction began (RFUpH3 = 16,862 and RFUpH4 = 26,113, respectively). The curve at pH 4 showed RFU values 1.5 times higher than those at pH 3. Increasing the pH to pH 5 resulted in a flatter curve, making positive signals possible after seven to eight hours of reaction. Depurinated buffers at pH 6 are not suitable for in vitro Stx activity assays because they cannot detect Stx activity even in Stx-positive culture supernatants.
[0245] This indicates that acidic pH values (pH 3 and pH 4) are optimal for detecting Stx activity. The fluorescence signal was enhanced in 100 mM ammonium acetate, therefore the conditions were adjusted in subsequent experiments, using 100 mM ammonium acetate at pH 4 for the culture supernatant.
[0246] Example 4 – Preferred minimum oligonucleotide concentration for reliable detection of Stx activity based on current test parameters. 2 μM The activities of ricin and purified Stx have been successfully detected using RNA substrates at concentrations between 10 nM and 2 μM (Basu et al., 2015), but not DNA substrates. Due to the reduced sensitivity of DNA substrates, SRL concentrations were set in the µM range between 1 μM and 8 μM for testing. For strain selection, the optimal concentration of substrate 5'FAM-stem-SRL (“StxSense4”; SEQ ID NO: 7) was determined.
[0247] The determination was performed using the same culture supernatant in the same 96-well plate under the same reaction conditions (100 mM ammonium acetate, reaction temperature 44°C). Figure 9 Representative curves for EDL933 (A) and 16-02409 (B) at different SRL concentrations are shown. The negative control did not show a nonspecific reaction. EDL933 was detected at all tested SRL concentrations. stx1a / 2a Positive RFU signals were observed. Nevertheless, the curves for different SRL concentrations still differed in their slope and fluorescence intensity. For the same culture supernatant, higher SRL concentrations resulted in stronger fluorescence signals. At SRL concentrations above 4 μM, a saturation effect was observed after approximately 4 hours of reaction. Further increases in SRL concentration did not lead to an increase in RFU values. For 16-02409, stx2aDifferent SRL concentrations resulted in comparable curves, but differences still existed. All tested SRL concentrations produced positive fluorescence signals after a seven-hour reaction time, with higher intensities at SRL concentrations between 1 μM and 6 μM. However, no plateau phase in the fluorescence signal was detected. Furthermore, SRL concentrations above 5 μM showed a stronger saturation effect, negatively impacting the fluorescence signal at subsequent time points. SRL concentrations between 1 μM and 4 μM also caused an increase in fluorescence signal with increasing concentration; however, SRL concentrations above 5 μM resulted in lower fluorescence signals at higher concentrations.
[0248] For the two STEC strains tested, optimal Stx activity was found at SRL concentrations of 4–5 μM. This corresponds to a substrate cost of approximately €0.4–0.5 per sample. The tests also determined that an SRL concentration of 2 μM is the preferred minimum concentration, enabling efficient Stx detection while ensuring reliable assays. Considering the cost required to develop this rapid assay, subsequent experiments used this minimum SRL concentration of 2 μM, which corresponds to a 50% reduction in SRL usage cost.
[0249] Example 5 – A reaction temperature ≥40℃ is advantageous for detecting Stx activity in culture supernatant. In human infection diagnosis, standard culture of STEC is performed at 37°C. However, it has been described that STEC enrichment and recovery from food are superior at a culture temperature of 44°C (Tzschoppe et al., 2012; Amagliani et al., 2018). Therefore, for enzyme assays, the temperature range between 37°C and 57°C should be tested. Figure 10 Representative curves for two STEC strains, EDL933(A) and 16-02409(B), are shown. Except for one case, the curves for the negative control were assessed as negative: EDL933 showed negative curves at temperatures above 57°C. Δstx1 / 2 It exhibits a nonspecific response to SRL substrates.
[0250] Within a temperature range of 37°C to 57°C, the Stx activity of both EDL933(A) and 16-02409(B) increased with increasing temperature. At reaction temperatures below 55.8°C, the RFU values of EDL933 were 1.25 to 5 times lower than those of 16-02409. An increase in RFU values was detected up to a maximum reaction temperature of 57°C. All other reaction temperatures showed flatter curves. For 16-02409, the increase in RFU values between 37°C and 49.5°C was less than the increase above 50°C. Above 50°C, the curve rose more rapidly and became steeper during the first two hours of the reaction.
[0251] For both temperature gradient and SRL substrate concentration, the curves of EDL933 showed an overall decreasing trend compared to STEC strain 16-02409. Since the saturation effect may lead to a decrease in Stx activity during the enzyme reaction (Bisswanger, 2014), the Stx activity of EDL933 was measured using culture supernatants diluted 1:2 and 1:5 at a temperature gradient of 37℃ to 45℃. Figure 10 (C and D). Within this range, the curve shows the lowest RFU value (see...). Figure 10 (A). The reaction proceeded unchanged in 100 mM ammonium acetate (pH 4) with 2 μM SRL substrate. No nonspecific reaction was observed in the negative control. For both dilutions, it was again observed that the higher the reaction temperature, the higher the RFU value and curve. The higher the sample dilution, the more pronounced its temperature dependence. By diluting the EDL933 culture supernatant, the RFU signal increased from 0.6-fold at 40 °C to 5-fold at 43.7 °C. Overall, sample dilution led to a decrease in reaction temperature. The adjusted conditions resulted in the detection of Stx after reaction times ranging from 30 minutes to three hours.
[0252] Both the dilution of the culture supernatant and the reaction temperature affect Stx activity. Under given conditions, a reaction temperature of at least 44°C is ideal.
[0253] Example 6 – Detection of Stx variants Although STEC is characterized by high heterogeneity, for example due to serological populations, stx Stx is still considered the virulence factor for all STECs. Based on its amino acid sequence, Stx is divided into two types: Stx1 and Stx2. They are approximately 56% identical in their sequences. These two Stx types can be further divided into subtypes: Stx1 currently has three known subtypes ( stx1a, stx1c stx1d As for Stx2, since the nomenclature was proposed by Scheutz and colleagues in 2011 (Scheutz et al., 2012), seven subtypes have been identified: stx2a to stx2g Although Stx subtypes differ, all Stx have similar mechanisms of action, which forms the basis for enzyme assays. Therefore, different STEC strains covering multiple Stx types were used, and their activities were tested.
[0254] Severe disease of HUS is primarily caused by the Stx subtype Stx1a in Stx1 and by Stx2a and Stx2c in Stx2 (De Rauw et al., 2018; Byrne et al., 2020). Strains with the same serotype O157:H7 can be selected for these Stx subtypes. The concentration of Stx1 was on average 7-fold lower than that of Stx2 culture supernatant. Overall, under the same culture conditions, there were significant differences in Stx concentration among different strains. The highest concentrations were detected in Stx2a-d, while the Stx concentrations in Stx2e-g were 9 to 170 times lower than those in high-Stx2-producing STEC strains. This difference in Stx expression was detectable in both Western blotting and Vero cell cytotoxicity assays for all Stx-producing strains.
[0255] Although the concentration of Stx1 in the culture supernatant was lower than that of Stx2 due to the lack of phage lysis (Wagner et al., 2002), this enzyme assay detected not only the Stx2 subtype Stx2a-g used in the study, but also the Stx1 subtypes Stx1a and Stx1d. Figure 11 (AB). Negative control EDL933 Δ stx1 / 2 No Stx activity was observed, confirming the protein blot ( Figure 11 (C) and cytotoxicity assays ( Figure 11 The results in D) were negative. Stx activity detected in the enzyme assay varied among different strains. At a reaction time of 12 hours, the strongest signals detected were: Stx2a with RFU = 97,309, Stx2b with RFU = 111,296, and Stx1a / 2a with RFU = 85,722; while Stx1a (RFU = 14,062), Stx2e (RFU = 19,653), and Stx1d (RFU = 5,522) showed the weakest signals in the culture supernatant.
[0256] The Stx activity gradient is only roughly correlated with the bands in Western blotting, meaning that a high signal in Western blotting does not always equate to high Stx activity. This difference between Western blotting signal and Stx activity was particularly evident when observing two Stx1a / 2a-producing strains, EDL933 and 17-00261. Although the signals in Western blotting of these two samples showed comparable band intensities, the RFU signals differed by 2.5-fold. Compared to EDL933, 17-00261 exhibited the strongest fluorescence signal, ranking third overall among all strains tested. This intensity difference was also observed in other strains. Although the Stx2a-producing strain 16-02409 showed a weaker signal than the aforementioned two strains, its detected Stx activity was 1.1-fold and 2.7-fold higher, respectively.
[0257] LOD measurements showed that Stx activity was generally correlated with Stx concentration (Stx ELISA) for Stx1a, Stx2a, and Stx1a / 2a. To examine the extent to which this correlation could be inferred from the measured fluorescence signal, the culture supernatant of all eight tested strains was adjusted to a concentration of 80 ng / mL (results not shown). This concentration was within the linear range of the previously established correlation curve. Direct comparisons of Stx activities of different Stx isoforms at the same concentration revealed fluorescence signal differences of 3 to 5 times.
[0258] Example 7 – STEC detection is serologically independent. STECs are a diverse bacterial community, further characterized in diagnosis by features such as the types of O and H antigens on their surface (Beutin et al., 2007). Currently, 185 O antigens and 53 H antigens have been described, which can appear in different combinations within STECs (Iguchi et al., 2020). If STECs are grouped according to their O antigens, they belong to the same serogroup. Combinations of O and H antigens produce serotypes, such as O157:H7. Because serogroup assessment is useful, especially in the case of HUS induced by STEC infection, 18 additional STEC strains from six different non-O157 serogroups (O26, O91, O111, O113, O121, O145) were analyzed. Three different strains were selected from each serogroup for testing, and a representative strain from each serogroup was used as follows: Figure 12 As shown.
[0259] Stx was detected in all strains by Western blotting and cytotoxicity assays. WGS analysis revealed Stx subtypes in the tested strains, including Stx1a, Stx1c, Stx2a, Stx2b, and Stx2d, all of which showed activity in the enzyme assays. Three strains exhibited low fluorescence signals in the enzyme assays: 19-01474 (O91, Stx1a / 2b), 19-01776 (O91, Stx2d), and 16-03404 (O145, Stx2a). Comparison with Western blotting results confirmed the low Stx concentrations in these strains, indicating a correlation between Stx concentration and activity.
[0260] In this study, a total of 64 STEC strains, representing 21 different serogroups, were examined. Their Stx subtypes, serogroups, and serotypes were confirmed by whole-genome sequencing (WGS). Of these strains, 38% were of type O157 (n=27), and the remaining 62% were non-O157 (n=37), representing a total of 20 different serogroups. Three sorbitol-fermenting STEC strains were also included. Of the 64 strains from different serogroups, two (3%) were negative in enzyme assays using culture supernatants (O104-Stx1c and O157-Stx2c). All sorbitol-fermenting STEC O157:H strains were positive in enzyme assays.
[0261] Example 8 – Stx-producing Shigella can be detected by enzyme assay. Shiga toxins were initially described in Shigella bacteria. Subsequent studies also confirmed the production of Stx in STEC and its close relationship with Stx. Similar to STEC, Shigella produces Stx1 and Stx2. Shigella dysenteriae produces Stx1, and Shigella flexneri produces Stx2. Since Stx1 and Stx2 are comparable to the toxins found in STEC, it was expected that this enzyme assay would detect Stx produced by Shigella. To test this hypothesis, the production and activity of Stx were examined in five Shigella dysenteriae strains and six Shigella flexneri strains; the results for representative strains are shown in Figure 13.
[0262] In all Shigella strains, similar to the Stx1-producing STEC strain, Stx1 production was detected on Vero cells via its cytotoxic effect, but not in enzyme assays. In Shigella flexneri, three out of six strains showed no Stx production in Western blotting and cytotoxicity assays, and no Stx activity in enzyme assays either. For the remaining three Shigella flexneri strains, both Stx production and strong Stx activity were confirmed in enzyme assays. Similar to the Western blotting signal and observed cytotoxicity, the Stx activity in all three cases was stronger than that of the reference strain EDL933. Based on these tests, it can be shown that this rapid test using Stx activity detection can detect Stx2-producing Shigella flexneri.
[0263] Example 9 – Enzyme assay showed no cross-reactivity with other STX-negative enteropathogenic Escherichia coli. Besides STEC, other enteric pathogens can cause (bloody) diarrhea and intestinal inflammation. Diarrhea type reduction can be used for preliminary diagnosis. To rule out potential cross-reactivity with other enteric pathogens in enzyme tests used to detect STEC, this study included other pathogens that can cause diarrhea. The study focused on both other enteric pathogenic Escherichia coli such as EAEC and other enteric pathogens such as Yersinia spp. These studies aimed to evaluate the specificity of the enzyme tests.
[0264] Besides Shiga toxin-producing Escherichia coli (STEC), other pathogenic Escherichia coli can also cause diarrhea. These include EAEC, EPEC, EIEC, and ETEC. These pathogenic Escherichia coli are associated with STEC but do not produce Shiga toxin. To rule out non-specific cross-reactivity that may be caused by other enzymes in pathogenic Escherichia coli, for example, six strains were included to test the accuracy of the test.
[0265] Figure 14 The test results are shown. No Shiga toxin was detected in either Western blot or cytotoxicity assays in the six strains tested. The culture supernatant of pathogenic Escherichia coli caused only mild impairment to Vero cell viability, with levels similar to the negative control EDL9331. stx1 / 2 Quite similar. In enzyme assays used to detect Stx activity, only the positive control EDL933 ( stx1a / 2a) and 16-02409 ( stx2a)Stx activity was detected in [samples], but not in EPEC, EAEC, or EIEC. This result is consistent with the Stx detection results. Except for one strain, the RFU values of the curves for all strains remained at a low level of 1200 after 12 hours of reaction. The curve for one strain (01-05814, EPEC) rose slightly to 1500 RFU after approximately 7 hours of reaction. However, this curve was still clearly negative, roughly at the level of the negative control EDL9331. stx1 / 2 The two Stx positive control strains were clearly assessed as positive in the enzyme assay after reaction times of 1 h and 2 h, respectively, so the slight rise in the curve of EPEC strain 01-05814 is normal behavior in this assay.
[0266] Example 10 – Other STX-negative enteric pathogens To investigate the accuracy of the enzyme assay, other pathogens causing diarrhea were included, resulting in the testing of a total of four *Yersinia enterocolitica* strains and six *Salmonella* strains. Figure 15 Four serotypes of Salmonella were selected: Salmonella typhimurium (…). S. Typhimurium), Salmonella enteritidis (S) . Enteritidis), Salmonella Virginiais (S) . Virginia) and Salmonella infantis (S) . (Infantis). Two strains of each of the two clinically relevant serotypes of Salmonella Typhimurium and Salmonella Enteritidis were tested. No Stx production was detected in either strain by Western blotting or cytotoxicity assays, and no enzyme activity was detected in enzyme assays. At each stage of the reaction, the RFU values for all enteric pathogens were lower than those of the negative control. The positive control EDL933 was significantly positive after two hours of reaction.
[0267] Based on test strains of enteropathogenic Escherichia coli and other pathogens, it was shown that these pathogens, which also cause diarrheal diseases, do not exhibit enzyme activity in enzyme assays targeting specific SRL substrates.
[0268] Example 11 – The detection limit of the enzyme assay is in the range of ng / mL. The culture supernatant of selected strains, quantitatively analyzed by Stx-ELISA, was used to determine the detection limit according to the method (“enzyme assay”) described in this invention. Based on the calculated Stx concentration, a dilution series with eight dilution gradients in arithmetic dilutions was created for each of the three Stx-producing strains. The concentration ranges for each dilution series are as follows: for EDL933, stx1a / 2a Between 1 ng / mL and 113 ng / mL; for 20-01044, stx1aBetween 1 ng / mL and 126 ng / mL; and for 16-02409, stx2a The levels ranged from 1 ng / mL to 138 ng / mL, roughly within the same range. LOD assays were performed on three strains expressing different Stx subtypes because comparisons of activities between different Stx subtypes have not yet been described in the literature.
[0269] All three tested STEC strains showed comparable curves between the Stx concentration used and the measured fluorescence (results not shown). A linear increase was observed for 20-01044. stx1a Between 35 ng / mL and 126 ng / mL; for 16-02409, stx2a Between 25 ng / mL and 138 ng / mL; and for EDL933, stx1a / 2a The concentrations ranged from 30 ng / mL to 113 ng / mL. Within the linear range, all three plots showed a positive Pearson correlation (p>0.0001). Higher Stx concentrations were associated with higher measurable RFU values.
[0270] The limits of detection (LODs) for all three samples were calculated using full-curve linear regression. The regression curves showed the best fit to the measured values for Stx1a (R² = 0.9806) and the worst for Stx2a (R² = 0.8694). The determined LODs for Stx activity in the culture supernatant used ranged from 11 to 29 ng / mL, with slight variations among different Stx subtypes.
[0271] Example 12 – Detection of Stx variants using DNA constructs Under standard assay conditions (see above), the substrate StxSense4 was tested as both a DNA-based and RNA-based substrate. Compared to the DNA-based substrate, for the STEC strain EDL933 O157:H7, stx1a / 2a No specific activity of Shiga toxin against RNA-StxSense4 (SEQ ID NO:29) was detected. Figure 20 Therefore, the RNA-SRL substrate based on the successful DNA sequence StxSense4 (StxSense4 RNA; SEQ ID NO: 29) is not suitable for the expected detection of Stx activity.
[0272] Example 13 – Other DNA-SRL Substrates In this experiment, substrate StxSense1-4 (SEQ ID NO:4-7) and six other DNA-SRL substrates (StxSense5, StxSense9, StxSense12, StxSense15, StxSense16, see Table 6) were tested under the previously defined standard assay conditions (see above) using two STEC strains. Figure 17-18 ) and Stx gene knockout mutant ( Figure 19 The test is performed in the enzyme assay according to the present invention.
[0273] Table 6: Overview of Substrates Used
[0274] In addition to the SRL substrate StxSense4 (SEQ ID NO: 7), substrates StxSense12 (SEQ ID NO: 13), StxSense15 (SEQ ID NO: 16), and StxSense16 (SEQ ID NO: 17) are also suitable for positive detection of Stx. Specifically, the larger loop structure (StxSense12) enhances Stx activity, thereby amplifying the RFU signal. On the other hand, acyclic substrates (StxSense9; SEQ ID NO: 27) or substrates without the core sequence GAGA (StxSense5; SEQ ID NO: 28) significantly reduce the RFU signal. The gene knockout mutant EDL933 O157:H7 was used. stx1 / 2 When using LB medium or other substrates, no nonspecific reactions were detected on any of the substrates.
[0275] Example 14 – Detection in fecal samples Using the substrate described in this invention, sixteen fecal samples (nine stx-PCR positive and six stx-PCR negative) and fecal samples spiked with Stx culture supernatant were analyzed. The results showed that Stx could be detected both directly and after enrichment of the samples.
[0276] References Amagliani, G., Rotundo, L., Carloni, E., Omiccioli, E., Magnani, M.,Brandi, G.,&Fratamico, P. (2018). Detection of Shiga toxin-producingEscherichia coli (STEC) in ground beef and bean sprouts: Evaluation ofculture enrichment conditions. Food Research International, 103, 398-405.https: / / doi.org / 10.1016 / J.FOODRES.2017.10.059 Basu, D., Li, X. P., Kahn, J. N., May, K. L., Kahn, P. C.,&Tumer, N.E. (2015). The A1 subunit of Shiga toxin 2 has higher affinity for ribosomesand higher catalytic activity than the A1 subunit of Shiga toxin 1. Infectionand Immunity, 84(1), 149-161. https: / / doi.org / 10.1128 / IAI.00994-15 Becher F et al. Detection of functional ricin by immunoaffinity andliquid chromatography-tandem mass spectrometry. Anal Chem 2007 Jan 15;79(2):659-606. Beddoe, T., Paton, A. W., Le Nours, J., Rossjohn, J.,&Paton, J. C.(2010). Structure, Biological Functions and Applications of the AB5 Toxins.Trends in Biochemical Sciences, 35(7), 411. https: / / doi.org / 10.1016 / J.TIBS.2010.02.003 Bergan, J., Dyve Lingelem, A. B., Simm, R., Skotland, T.,&Sandvig, K.(2012). Shiga toxins. Toxicon, 60(6), 1085-1107. https: / / doi.org / 10.1016 / j.toxicon.2012.07.016 Beutin, L., Miko, A., Krause, G., Pries, K., Haby, S., Steege, K.,&Albrecht, N. (2007). Identification of human-pathogenic strains of shigatoxin-producing Escherichia coli from food by a combination of serotyping andmolecular typing of Shiga toxin genes. Applied and EnvironmentalMicrobiology, 73(15), 4769-4775. https: / / doi.org / 10.1128 / AEM.00873-07 / ASSET / AA811C1D-487C-40A3-8866-00AA6F26DFC4 / ASSETS / GRAPHIC / ZAM0150780370002.JPEG Brigotti, M., Carnicelli, D., Ravanelli, E., Vara, A. G., Martinelli,C., Alfieri, R. R., Petronini, P. G.,&Sestili, P. (2007). Molecular damageand induction of proinflammatory cytokines in human endothelial cells exposedto shiga toxin 1, shiga toxin 2, and α-sarcin. Infection and Immunity, 75(5),2201-2207. https: / / doi.org / 10.1128 / IAI.01707-06 Byrne, L., Adams, N.,&Jenkins, C. (2020). Association between ShigaToxin–Producing Escherichia coli O157:H7 stx Gene Subtype and DiseaseSeverity, England, 2009–2019. Emerging Infectious Diseases, 26(10), 2394.https: / / doi.org / 10.3201 / EID2610.200319 Chan YS, Ng TB. Shiga toxins: from structure and mechanism toapplications. Appl Microbiol Biotechnol. 2016 Feb;100(4):1597-610. COMMISSION Staff Working Document. Lessons learned from the 2011outbreak of Shiga toxin-producing Escherichia coli (SEC) O104:H4 in sproutedseeds. Commission of the European Communities. https. / / ec.europa.eu / food / sites / food / files / safety / docs / biosafety-crisis-cswd_lesson_learned_en.pdf. Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB.Recent advances in understanding enteric pathogenic Escherichia coli. ClinMicrobiol Rev. 2013 Oct;26(4):822-80. De Rauw, K., Jacobs, S.,&Piérard, D. (2018). Twenty-seven years ofscreening for Shiga toxin-producing Escherichia coli in a universityhospital. Brussels, Belgium, 1987-2014. PLOS ONE, 13(7), e0199968. https: / / doi.org / 10.1371 / JOURNAL.PONE.0199968 Deleavey GF, Damha MJ. Designing chemically modified oligonuclotidesfor targeted gene silencing. Chem Biol. 2012 Aug 24;19(8):937-54. Endo, Y., & Tsurugi, K. (1988). The RNA N-glycosidase activity of ricinA-chain. The characteristics of the enzymatic activity of ricin A-chain with ribosomes and with rRNA. Journal of Biological Chemistry, 263(18), 8735-8739.https: / / doi.org / 10.1016 / S0021-9258(18)68367-X Epid Bull 2016;44:489-93. Fagerquist CK et al. Top-Down proteomic identification of Shiga toxin2 subtypes from Shiga toxin-producing Escherichia coli by matrix-assisted laser desorption ionization-tandem time of light mass spectrometry. ApplEnviron Microbiol 2014 May;80(9):2928-40. FDA Bacteriological Analytical Manual, 8th Edition 1995, Chapter 4, Feb;2(2):123-40. Flieger A, Mielke M, Tietze E. Role of pathogen surveillance and subtyping for outbreak detection in foodborne bacterial infections – a microbiological perspective – aims, methods and perspectives of pathogen subtyping. Bundesgesundheitsblatt GesundheitsforschungGesundheitsschutz 2013;56(1):42-6. Frank C et al. Epidemic profile of Shiga-toxin-producing Escherichiacoli O104:H4 outbreak in Germany. N Engl J Med. 2011 Nov 10;365(19):1771-80. Fruth A et al. Network for Molecular Surveillance of EHEC Infections in Germany. Fruth A et al. Network for Molecular Surveillance of EHEC Infections in Germany. Epid Bull 2016;44:489-93. Fruth A, Prager R, Tietze E, Rabsch W, Flieger A. Molecular epidemiological view on Shiga toxin-producing Escherichia coli causing human disease in Germany: Diversity, prevalence, and outbreaks. Int J MedMicrobiol. 2015 Oct;305(7):697-704. Review. Garcia A, Fox JG, Besser TE. Zoonotic enterohemorrhagic Escherichiacoli: A One Health perspective. ILAR J. 2010;51(3):221-32. Garred O, van Deurs B, Sandvig K. Furin-induced cleavage and activation of Shiga toxin. J Biol Chem. 1995 May 5;270(18):10817-21. Glück, A., Endo, Y.,&Wool, I. G. (1992). Ribosomal RNA identityelements for ricin A-chain recognition and catalysis: Analysis with tetraloopmutants. Journal of Molecular Biology, 226(2), 411-424. https: / / doi.org / 10.1016 / 0022-2836(92)90956-K Gobert AP et al. Moculation of chemokine gene expression by Shiga-toxin producing Escherichia coli belonging to various origins and serotypes.Microbes Infect. 2008 Feb;10(2):159-65. Hull AE, Acheson DW, Echeverria P, Donohue-Rolfe A, Keusch GT.Mitomycin immunoblot colony assay for detection of Shiga-like toxin-producingEscherichia coli in fecal samples: comparison with DNA probes. J ClinMicrobiol. 1993 May;31(5):1167-72. Iguchi , A. , Nishii , H. , Seto , K. , Mitobe , J. , Lee , K. , Konishi , N. ,Obata , H. , Kikuchi , T. ,&Iyoda , S. (2020). Additional and typing PCR techniquestargeting Escherichia coli novel and Shigella-unique O-antigen biosynthesis gene clusters. Journal of Clinical Microbiology, 58(11). https: / / doi.org / 10.1128 / JCM.01493-20 / SUPPLEMENT_FILE / JCM.01493-20-S0001.PDF Iordanov , MS , Pribnow , D. , Magun , JL , Dinh , T.-H. , Pearson , JA , Li , S. , Chen , -Ye ,&Magun , BE (1997). Ribotoxic stress response:activation of the stress-activated protein kinase JNK1 by inhibitors of thepeptidyl transferase reaction and by sequence-specific RNA damage to thealpha-sarcin / ricin loop in the 28S rRNA. Molecular and Cellular Biology, 17(6), 3373-3381. https: / / doi.org / 10.1128 / MCB.17.6.3373 Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat RevMicrobiol. 2004. Karch H et al. The enemy within us: lessons from the 2011 European Escherichia coli O104:H4 outbreak. EMBO Mol Med. 2012 Sep;4(9):841-8. Case JA, Maunounen-Lasri A, Son I, Lin A, Hammack TS. Comparison ofeight different agars for recovery of clinically relevant non-O157 Shigatoxin-producing Escherichia coli from baby spinach, cilantro, alfalfa sproutsand raw milk. Food Microbiology 46(2015):280-287 Kimmitt , PT , Harwood , CR ,&Barer , MR (2000). Toxin geneexpression by shiga toxin-producing Escherichia coli: the role of antibioticsand the bacterial SOS response. Emerging Infectious Diseases, 6(5), 458. https: / / doi.org / 10.3201 / EID0605.000503 Kurmanova A et al. Structural requirements for furin-induced cleavage and activation of Shiga toxin. Biochem Biophys Res Commun. 2007 May 25;357(1):144-9. Lang C et al. Zinc metalloproteinase ProA directly activatesLegionella pneumophila PlaC glycerophospholipid:cholesterol acyltransferase.J Biol Chem. 2012 Jul 6;287(28):23464-78. Lang C, Hiller M, Flieger A. Disulfide loop cleavage of Legionellapneumophila PlaA boosts lysophospholipase A activity. Sci Rep. 2017 Nov 24;7(1):16313. Li, X.-P., Tumer, N. E., Barbier, J.,&Gillet, D. (2017). Differencesin Ribosome Binding and Sarcin / Ricin Loop Depurination by Shiga and RicinHolotoxins. Toxins 2017, Vol. 9, Page 133, 9(4), 133. https: / / doi.org / 10.3390 / TOXINS9040133 Mao, H., Luo, G., Zhan, Y., Zhang, J., Yao, S.,&Yu, Y. (2018). Themechanism and regularity of quenching the effect of bases on fluorophores:the base-quenched probe method. Analyst, 143(14), 3292-3301. https: / / doi.org / 10.1039 / C8AN00116B Marras SAE, Kramer FR, Tyagi S. Efficiencies of fluorescenceresonance energy transfer and contact-mediated quenching in oligonucleotideprobes. Nucleic Acids Research, 2002, 30(21): e122, Melton-Celsa AR, Kokai-Kun JF, O’Brien AD. Activation of Shiga toxintype 2d (Stx2d) by elastase involves cleavage of the C-terminal two aminoacids of the A2 pepetide in the context of the appropriate B pentamer. MolMicrobiol. 2002 Jan;43(1):207-15. Melton-Celsa AR, O’Brien AD. New Therapeutic Developments againstShiga Toxin-Producing Escherichia coli. Microbiol Spectr. 2014 Oct;2(5). Noble, J. E., Wang, L., Cole, K. D.,&Gaigalas, A. K. (2005). Theeffect of overhanging nucleotides on fluorescence properties of hybridisingoligonucleotides labelled with Alexa-488 and FAM fluorophores. BiophysicalChemistry, 113(3), 255-263. https: / / doi.org / 10.1016 / J.BPC.2004.09.012 Olsnes S, Reisbig R, Eiklid K. Subunit structure of Shigellacytotoxin. J Biol Chem. 1981 Aug 25;256(16):8732-8. Perna, NT, Plunkett, G., Burland, V., Mau, B., Glasner, JD,Rose, DJ, Mayhew, GF, Evans, PS, Gregor, J., Kirkpatrick, HA, Pósfai, G., Hackett, J., Klink, S., Boutin, A., Shao, Y., Miller, L., Grotbeck, EJ, Davis, NW, Lim, A., … Blattner, FR (2001). Genome sequence ofenterohaemorrhagic Escherichia coli O157:H7. Nature 2001 409:6819, 409(6819),529-533. https: / / doi.org / 10.1038 / 35054089 Persad AK, LeJeune JT. Animal Reservoirs of Shiga Toxin-ProducingEscherichia coli. Microbiol Spectr. 2014 Aug;2(4):EHEC-0027-2014. Prochnow H et al. Subecllular quantification of uptake in Gram-negative bacteria. Anal Chem 2018 Nov 28. doi: 10.1021 / acs.analchem.8b03586.[Epub ahead of print] Robert Koch Institute (RKI). Epidemiological Yearbook of Notifiable Diseases for 2016. Berlin 2017. Robert Koch-Institut (RKI). Infektionsepidemiologisches Jahrbuchmeldepflichtiger Krankheiten für 2017. Berlin 2018. Roday, S., Sturm, M. B., Blakaj, D.,&Schramm, V. L. (2008). Detectionof an abasic site in RNA with stem-loop DNA beacons: Application to anactivity assay for Ricin Toxin A-Chain. Journal of Biochemical andBiophysical Methods, 70(6), 945-953. https: / / doi.org / 10.1016 / J.JPROT.2007.12.010 Scheutz F et al. Multicenter evaluation of a sequence-based protocolfor subtyping Shiga toxins and standardizing Stx nomenclature. J ClinMicrobiol. 2012 Sep;50(9):2951-63. Scotland, S. M., Rowe, B., Smith, H. R., Willshaw, G. A.,&Gross, R.J. (1988). Vero cytotoxin-producing strains of Escherichia coli from childrenwith haemolytic uraemic syndrome and their detection by specific DNA probes.Journal of Medical Microbiology, 25(4), 237-243. https: / / doi.org / 10.1099 / 00222615-25-4-237 / CITE / REFWORKS Tesh, V. L., Burris, J. A., Owens, J. W., Gordon, V. M., Wadolkowski,E. A., O’brien, A. D., Samuel3, J. E., Wadolkowski, E. A., Sung, L. M.,Burris, J. A., Samuel, J. E.,&O’brien, A. D. (1993). Comparison of therelative toxicities of Shiga-like toxins type I and type II for mice.Infection and Immunity, 61(8), 3392-3402. https: / / doi.org / 10.1128 / IAI.61.8.3392-3402.1993 Tzschoppe, M., Martin, A.,&Beutin, L. (2012). A rapid procedure forthe detection and isolation of enterohaemorrhagic Escherichia coli (EHEC)serogroup O26, O103, O111, O118, O121, O145 and O157 strains and theaggregative EHEC O104:H4 strain from ready-to-eat vegetables. InternationalJournal of Food Microbiology, 152(1-2), 19-30. https: / / doi.org / 10.1016 / J.IJFOODMICRO.2011.10.009 Wagner, P. L., Livny, J., Neely, M. N., Acheson, D. W. K., Friedman,D. I.,&Waldor, M. K. (2002). Bacteriophage control of Shiga toxin 1production and release by Escherichia coli. Molecular Microbiology, 44(4),957-970. https: / / doi.org / 10.1046 / J.1365-2958.2002.02950.X Wang J et al. Rapid Detection of Escherichia coli O157 and ShigaToxins by Lateral Flow Immunoassays. Toxins 2016,8;(4),92。
Claims
1. An oligonucleotide, comprising a) The nucleotide sequence of the 60S ribosomal subunit of the eukaryotic / mammalian ricin ring (SRL), wherein, The SRL nucleotide sequence includes at least one adenine; and b) At least one cut-dependent tag, The oligonucleotides are single-stranded and preferably constitute at least one ring structure or stem-loop structure.
2. The oligonucleotide according to claim 1, wherein, The at least one cleavage-dependent marker comprises at least one fluorophore and at least one quencher, wherein preferably, the at least one fluorophore and at least one quencher are arranged such that the at least one quencher quenches the fluorescence of the at least one fluorophore as long as the oligonucleotide is uncleaved.
3. The oligonucleotide according to any one of the preceding claims, wherein, The at least one cleavage-dependent marker includes at least one marker at the 3' end and / or at least one marker at the 5' end of the oligonucleotide.
4. The oligonucleotide according to any one of the preceding claims, wherein, The oligonucleotide is a single-stranded RNA (ssRNA) or a single-stranded DNA (ssDNA).
5. The oligonucleotide according to any one of the preceding claims, wherein, The oligonucleotide further includes at least one linker sequence between the SRL nucleotide sequence and the at least one marker, preferably wherein, The 5' connector sequence includes ACTT, and / or the 3' connector sequence includes AGT.
6. The oligonucleotide according to any one of the preceding claims, wherein, The SRL nucleotide sequence includes at least one GAGAG sequence.
7. The oligonucleotide according to any one of the preceding claims, wherein, The SRL nucleotide sequence includes at least one AGTACGAGAGGAAC sequence (SEQ ID NO: 3).
8. The oligonucleotide according to any one of the preceding claims, wherein, The SRL nucleotide sequence includes at least one ACTTAGTACGAGAGGAACAGT sequence (SEQ ID NO: 7).
9. The oligonucleotide according to any one of the preceding claims, wherein, The oligonucleotides form a single-ring structure or a stem-ring structure, and preferably comprise fewer than 26 nucleotides.
10. The oligonucleotide according to any one of the preceding claims, wherein, The oligonucleotide is present in the reaction solution, the detection solution, or the bacterial growth medium, or in a mixture of the above solutions.
11. A method for detecting active Shiga toxin in a sample, comprising the following steps: a) Provide at least one single-stranded oligonucleotide according to claims 1-10; b) Provide a sample for testing for Shiga toxin; c) Incubate the sample with the at least one single-stranded oligonucleotide; d) Detect the signal from the marker, wherein the signal indicates the presence of Shiga toxin in the sample.
12. The method according to claim 11, wherein, In step c), a signal is generated once the oligonucleotide is depurinated at at least one adenine by the Shiga toxin, wherein the oligonucleotide is cleaved.
13. The method according to claims 11-12, wherein, The Shiga toxin contained in the sample is selected from the group consisting of Stx1, Stx2, Stx1a-d and Stx2a-g, or other Stx types or subtypes.
14. The method according to any one of claims 11-13, wherein, The method includes the detection of a Shiga toxin-producing pathogen, wherein the Shiga toxin-producing pathogen is Shiga toxin-producing Escherichia coli (E. coli). E. coli ) bacteria (STEC), Acinetobacter spp. ( Acinetobacter ) bacteria or Shigella spp. Shigella )bacteria.
15. The method according to any one of claims 11-14, wherein, In step a), the oligonucleotide is present in an agar medium, and in step b), the sample is applied to the agar medium; and / or in step d), the detection detects a signal in the agar medium.
16. The method according to any one of claims 11-15, wherein, In step a), the oligonucleotide is present in the liquid reaction solution or detection solution, and in step b), the sample is introduced into the liquid reaction culture medium.
17. A reagent kit comprising at least the following components: a) the oligonucleotides according to claims 1-10, and b) Optionally, at least the reaction solution and / or the detection solution, wherein, The reaction solution and / or detection solution is preferably a depurinating buffer containing ammonium acetate.
Citation Information
Patent Citations
Enzyme activity test using fluorescently labeled oligonucleotide substrate
EP1241267A3