Recombinant humanized II-type collagen biological scaffold and application thereof in cartilage repair
By preparing recombinant humanized type II collagen bioscaffolds, the safety and biocompatibility issues of existing cartilage repair materials have been resolved, enabling rapid repair and structural and functional reconstruction of hyaline cartilage, with excellent biocompatibility and safety.
Patent Information
- Application Number
- CN202511604659.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-02-27
AI Technical Summary
Existing cartilage repair materials, such as autologous cartilage transplantation, allogeneic cartilage transplantation, and synthetic materials, have shortcomings in terms of safety, immune response, and repair efficacy. In particular, animal-derived collagen poses immunogenicity risks and has insufficient biocompatibility, making it difficult to achieve structural and functional reconstruction of hyaline cartilage.
A recombinant humanized type II collagen scaffold was prepared into a sponge-like three-dimensional structure through a specific freeze-drying process. This promoted chondrocyte vitality and directional migration, avoided the use of cross-linking agents, and improved biocompatibility and safety. Furthermore, the specific three-dimensional structure actively induced type II collagen synthesis.
It enables rapid repair of hyaline cartilage, significantly improves the repair efficiency of cartilage defects, reduces the risk of immune response, has excellent biocompatibility and safety, shortens the repair cycle, and is suitable for medical devices that require long-term implantation.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular, to a recombinant humanized type II collagen biological scaffold and its application in cartilage repair. BACKGROUND
[0002] Hyaline cartilage, fibrocartilage and elastic cartilage play a variety of roles in the human body, including bearing the load of joints and intervertebral discs, providing joint lubrication, forming the external ear and nose, supporting the trachea, and forming long bones during development and growth. However, cartilage tissue itself has very weak self-repairing ability due to its lack of blood vessels, nerves and lymphatic system (studies have shown that adult cartilage has almost no regenerative potential), and it is difficult for joint cartilage damage to heal naturally, often leading to serious clinical problems such as osteoarthritis and joint dysfunction.
[0003] In terms of treatment, the repair strategies for cartilage defects mainly include autologous cartilage transplantation, allogeneic cartilage transplantation, artificial synthetic material filling and tissue engineering scaffold implantation, etc. However, the above-mentioned means all have their own shortcomings, for example, autologous cartilage transplantation faces donor limitation and secondary injury risk; allogeneic cartilage transplantation extracts animal cartilage (such as cow, pig, etc.), which has immunogenicity residue, and the allogeneic protein may cause immune rejection reaction of the body which cannot be estimated in advance; artificial synthetic scaffold material (such as polylactic acid, polyglycolic acid, etc. synthetic polymer) has good mechanical properties, but its biocompatibility and cartilage induction ability are insufficient, and fibrocartilage rather than functional hyaline cartilage is easily formed during the repair process, making it difficult to achieve structure and function reconstruction of damaged cartilage.
[0004] In cartilage tissue, the structure and organization of the extracellular matrix (ECM) of chondrocytes is a major determinant of normal function, and most diseases involving cartilage result in major changes in the ECM, which control disease progression (e.g., in osteoarthritis), cause the major symptoms of the disease (e.g., dwarfism caused by genetic mutations), or occur as a collateral injury to pathological processes occurring in nearby other tissues (e.g., osteochondritis dissecans and inflammatory joint disease). Collagen Type II, as the main component of the transparent extracellular matrix of cartilage, plays a key role in maintaining the integrity of cartilage structure, inducing chondrocyte adhesion and differentiation, etc. The traditional source of collagen type II is extracted from animals, which has differences in amino acid sequence with the human body, has the risk of immunogenicity (such as triggering antibody response), and may introduce exogenous contaminants such as viruses and mycoplasma during extraction, which limits the safety of clinical application; at the same time, the extraction efficiency of animal-derived collagen is low, and the purification process is complex, which is difficult to meet the demand of large-scale production. Animal-derived collagen has immunogenicity, and about 3% of patients have immune reactions such as edema, erythema, and itching in clinical application. In summary, the existing animal-derived collagen and other artificial synthetic materials have certain defects in promoting cartilage repair. SUMMARY
[0005] One of the purposes of the present application is to provide a humanized collagen protein scaffold that can promote cartilage repair.
[0006] The present application provides a recombinant humanized collagen type II biological scaffold, which is freeze-dried from a solution of a polypeptide, the amino acid sequence of the polypeptide comprising n repeating units; The repeating unit comprises any one of the following (1)-(3) amino acid sequences or variant sequences thereof: (1) the amino acid sequence shown in SEQ ID NO. 1; (2) an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO. 1; (3) a variant sequence obtained by mutating one or more amino acid residues of the amino acid sequence shown in SEQ ID NO. 1; Wherein, n is an integer greater than or equal to 1.
[0007] When n = 1, the amino acid sequence of the polypeptide includes a variant sequence obtained by mutating 1-15, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acid residues of the amino acid sequence shown in SEQ ID NO. 1.
[0008] The application researches and finds that when the polypeptide with the amino acid sequence shown in SEQ ID NO. 1 or a variant sequence is directly freeze-dried (without adding other reagents), a biological scaffold with a sponge-like three-dimensional structure can be obtained, which has the biological effect of promoting cartilage tissue regeneration and achieving cartilage defect repair.
[0009] Specifically, the biological scaffold of the application does not contain a crosslinking agent, can promote chondrocyte viability, has better biocompatibility than recombinant humanized type II collagen added with a crosslinking agent (such as glutaraldehyde), effectively reduces the potential toxicity risk of traditional animal collagen products, and achieves a breakthrough improvement in biocompatibility and safety, and is especially suitable for medical device application scenarios that need to be implanted for a long time.
[0010] The biological scaffold of the application can actively induce type II collagen synthesis through a specific three-dimensional structure, promote the directional migration and proliferation of chondrocytes, achieve structure / function dual repair, effectively avoid fibrocartilage formation, can significantly improve the BV / TV and ICRS scores of experimental cartilage defect bodies, and exhibit good cartilage rapid repair effect.
[0011] Meanwhile, the biological scaffold of the application can be customized to form a specific three-dimensional structure due to its superior biocompatibility, and has the ability to carry biological active factors, and can activate the repair function of autologous cartilage tissue.
[0012] Preferably, in the polypeptide of the application, n is an integer between 1 and 12, and more preferably 9. Preferably, when n≥2, the repeating units are directly connected. Preferably, the polypeptide has an amino acid sequence as shown in SEQ ID NO. 2.
[0013] Preferably, the polypeptide has an amino acid sequence with at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence as shown in SEQ ID NO. 2. Preferably, the polypeptide has a variant sequence obtained by mutating one or more amino acid residues of the amino acid sequence as shown in SEQ ID NO. 2; for example, 1~135, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 27, 32, 40 or 54.
[0014] In the application, the nucleotide sequence encoding the polypeptide comprises the nucleotide sequence shown in SEQ ID NO. 3 or a degenerate sequence thereof.
[0015] This invention also provides a method for preparing the above-mentioned recombinant humanized type II collagen bioscaffold, comprising: S1. Cultivate host cells containing a nucleotide sequence encoding the polypeptide; S2. Harvest the host cells and / or culture medium containing the polypeptide, and isolate the polypeptide therefrom; S3. Freeze-dry the solution of the polypeptide.
[0016] The polypeptides of the present invention can be prepared using methods known in the art.
[0017] In the preparation method of the present invention, the host cell is a bacterium, a fungus, or an animal cell; the bacteria preferably include Escherichia coli; the fungus preferably includes yeast, more preferably Saccharomyces cerevisiae or Pichia pastoris.
[0018] In the preparation method of the present invention, the freeze-drying includes pre-freezing, sublimation drying, and desorption drying; The pre-freezing temperature is -40℃, the cooling rate is 13±2℃ / min, and the temperature holding time is 240min; The sublimation drying process is repeated 2-6 times, preferably 5 times; The sublimation drying process employs a gradient temperature increase, with the temperature gradient controlled at 5-10℃ / cycle; the heating rate between each sublimation drying cycle is 0.5-1℃ / min; and the temperature holding time for each sublimation drying cycle is 300-1200min. Preferably, the specific steps of the sublimation drying are as follows:
[0019] The number of times the analytical drying is performed is 1 to 4, preferably 2 times; the analytical drying adopts a gradient temperature increase, and the temperature increase gradient is controlled at 8-18℃ / time; the temperature increase rate between each analytical drying is 0.5-1℃ / min; the temperature holding time for each analytical drying is 300-600min; Preferably, the specific steps of the analytical drying are as follows:
[0020] Preferably, after pre-freezing, a vacuum is drawn to a vacuum level of 13 Pa.
[0021] In a further preferred embodiment of the preparation method of the present invention, the freeze-drying process is as follows: .
[0022] This invention uses a specific freeze-drying process to prepare the above-mentioned peptides into a biological scaffold with a specific three-dimensional structure, which can exert an ideal effect of rapid induction of cartilage repair.
[0023] In the preparation method of the present invention, the solvent of the polypeptide solution is an isotonic solution, preferably one or more of sodium chloride aqueous solution, PBS buffer, and Tris-HCl buffer; the mass concentration of the sodium chloride aqueous solution is 0.5 wt%-3.0 wt%; preferably 0.9 wt%-2.0 wt%. Preferably, the concentration of the PBS buffer is 0.2 mol / L; Preferably, the concentration of the Tris-HCl buffer solution is 1 mol / L, and the pH is 6.5~7.0; When the solvent is PBS buffer or sodium chloride aqueous solution, the concentration of the polypeptide solution is 2-15 mg / mL; When the solvent is Tris-HCl buffer, the concentration of the polypeptide solution is 5-10 mg / mL.
[0024] This invention uses a specific polypeptide solution system to enable freeze-dried products to form solid three-dimensional protein scaffolds. If the solution system is not appropriate, products with three-dimensional structures cannot be obtained.
[0025] The present invention also provides a composition comprising the above-described recombinant humanized type II collagen bioscaffold or a recombinant humanized type II collagen bioscaffold prepared by the above-described method.
[0026] The compositions of the present invention may further include active ingredients carried in the recombinant humanized type II collagen bioscaffold.
[0027] In this invention, other active ingredients or excipients can be combined with the above-mentioned biological scaffold according to different usage requirements to prepare a composition with stronger / richer efficacy.
[0028] The present invention also provides the application of the recombinant humanized type II collagen biological scaffold or the recombinant humanized type II collagen biological scaffold or composition prepared by the above-mentioned method in the preparation of cartilage repair products.
[0029] In the application of this invention, the cartilage repair product has a sponge-like three-dimensional structure.
[0030] The present invention also provides a method for repairing cartilage defects and / or regenerating chondrocytes in vivo, comprising the step of filling the cartilage defect site (preferably, filling the knee joint cartilage defect site) with the recombinant humanized type II collagen biological scaffold or the recombinant humanized type II collagen biological scaffold or composition prepared by the above-mentioned method, wherein the method is not for disease diagnosis or treatment purposes.
[0031] Terminology Definition As used in this article, "recombinant collagen" is a new type of biomaterial that uses cutting-edge structural biology, genetic engineering and other technologies to screen and prepare a gene encoding the functional region of human collagen specific type as a template, and obtains an amino acid sequence that is the same as or similar to that of human collagen.
[0032] As used herein, “recombinant humanized type II collagen” refers to a recombinant protein consisting of or substantially consisting of sequences derived from human type II collagen. In this context, recombinant humanized type II collagen may consist of or substantially consist of fragments or multiple repeats of fragments derived from human type II collagen.
[0033] As used herein, the term “expression” includes any step involved in peptide production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0034] As used herein, the term "vector" is a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well known to those skilled in the art and include, but are not limited to: plasmids; phage particles; Cos plasmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage, and animal viruses. Vectors may contain various elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain a replication initiation site. Vectors may contain the nucleic acids of this invention for introduction into cells for expression. Vectors may contain expression control elements operatively linked to the nucleic acids, such as promoters, terminators, and / or enhancers.
[0035] As used herein, the term "expression vector" refers to a straight or circular DNA molecule containing a polynucleotide encoding a polypeptide and operatively linked to a control sequence provided for its expression. In this document, the expression vector may be an *E. coli* expression vector.
[0036] As used herein, the term “recombinant expression vector” refers to a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, or modified to contain nucleic acid segments in a manner not normally found in nature, or is synthetic and contains one or more control sequences.
[0037] As used herein, the term "control sequence" refers to the nucleic acid sequence necessary for the expression of the polynucleotide encoding the mature polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or exogenous (i.e., from different genes) for the polynucleotide encoding the polypeptide, or native or exogenous relative to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, control sequences include promoters and transcription and translation termination signals. These control sequences may be provided with multiple linkers for the purpose of introducing specific restriction sites that facilitate the linking of control sequences to the coding region of the polynucleotide encoding the polypeptide.
[0038] As used herein, the term "host cell" refers to a cell into which nucleic acid molecules have been introduced using molecular biology techniques. These techniques include transfection with viral vectors, transformation with plasmid vectors, and accelerated introduction of naked DNA via electroporation, lipid transfection, and particle gun techniques. Host cells can be eukaryotic or prokaryotic cells. For example, eukaryotic cells include yeast cells, animal cells, and / or insect cells. Prokaryotic cells can be E. coli cells.
[0039] The beneficial effects of this invention are at least as follows: Existing animal-derived collagens have certain shortcomings in cartilage repair, especially in the regeneration of hyaline cartilage in animals. The recombinant humanized type II collagen bioscaffold of this invention can effectively promote hyaline cartilage regeneration, achieve sequence controllability, and has advantages such as low immunogenicity, good biological activity, and fast repair speed.
[0040] Specifically, the bio-scaffold of this invention is designed from a natural protein with excellent biocompatibility. Through synthetic biology techniques, the core sequence of human collagen is optimized and recombined, resulting in a product that fully retains its natural conformation and function. Its immunogenicity is lower than that of animal-derived collagen, overcoming the safety barriers of traditional heterologous materials. Furthermore, the bio-scaffold of this invention can be manufactured using a clean process, achieving zero chemical residues. A specific low-temperature freeze-drying process completely avoids the introduction of cross-linking agents and organic solvents, eliminating the risk of biotoxicity from the source of preparation. In addition, electron microscopy characterization of the bio-scaffold of this invention shows that it exhibits a network structure. This biomimetic ECM topological feature makes the scaffold comparable to natural cartilage tissue, and its multi-scale homogeneous structure ensures functional stability. Moreover, in a rat articular cartilage defect model (2 mm in diameter), the experimental group achieved complete hyaline cartilage coverage within 4 weeks (while the control group only achieved fibrous repair), shortening the repair cycle compared to known products and significantly improving cartilage regeneration efficiency, thus gaining a critical time window for new bone integration. In addition, serum biochemical tests showed that the fluctuation range of serum indicators such as ALT, AST, and BUN in the test animals was consistently ≤15% (baseline value), indicating good biocompatibility and laying the foundation for clinical translation. Attached Figure Description
[0041] Figure 1 It is a recombinant humanized type II collagen solution.
[0042] Figure 2 These are photographs of the morphology of recombinant humanized type II collagen solution after freeze-drying under different filling conditions.
[0043] Figure 3 This is a photograph of the recombinant humanized type II collagen bioscaffold in Example 3.
[0044] Figure 4 This is a scanning electron microscope image.
[0045] Figure 5 This is the result of a cell viability test.
[0046] Figure 6 To organize the overall view, the area circled in red in the image is the experimental area.
[0047] Figure 7 This is the result of Micro-CT 3D reconstruction. The area circled in red in the image is the experimental area.
[0048] Figure 8 The results are from a three-dimensional analysis using Micro-CT. In the figure, A represents the bone volume / total volume (BV / TV) statistical result, and B represents the ICRS score result.
[0049] Figure 9 The results are for serum biochemical enzyme activity.
[0050] Figure 10 The results represent serum biochemical liver function tests. A represents the alanine aminotransferase (ALT) test result, B represents the aspartate aminotransferase (AST) test result, and C represents the creatinine test result.
[0051] Figure 11 This represents serum biochemical lipid metabolism. A represents the results of the low-density lipoprotein cholesterol experiment, B represents the results of the total cholesterol experiment, C represents the results of the albumin experiment, and D represents the results of the total protein experiment.
[0052] Figure 12 These are pathological sections. The area circled in red in the image is the experimental area. The second row of images is a magnified view of the center of the area circled in red in the first row.
[0053] Figure 13 Quantitative results of type II collagen in cartilage defect sites.
[0054] In all figures (if any), ns represents no significant difference. This means P < 0.05. This means P < 0.01. This represents P < 0.001. This means P < 0.0001. Detailed Implementation
[0055] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art.
[0057] Example 1: Preparation of Recombinant Humanized Type II Collagen 1.1 Gene Design and Optimization Based on the human type II collagen α1 chain sequence (NCBI accession number: NP_000081.3), the core repeat region was retained, and non-essential regions were truncated. A protein amino acid sequence based on the motif GEPGLQGPAGPPGEKGEPGDDGPSGAEGPP (SEQ ID NO.1) was designed (SEQ ID NO.2): GEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEK GEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPP.
[0058] The coding sequence was optimized using Pichia pastoris-preferred codons (Codon Adaptation Index > 0.95). The resulting nucleic acid sequence was SEQ ID NO. 3. GGTGAGCCTGGGCTCCAAGGTCCTGCTGGTCCCCCGGGTGAAAAGGGTGAACCAGGTGATGACGGTCCATCAGGTGCTGAAGGACCCCCTGGGGAGCCCGGACTTCAGGGTCCAGCTGGGCCCCCAGGAGAGAAAGGCGAGCCCGGGGATGATGGTCCATCCGGTGCTGAAGGTCCACCAGGTGAACCTGGCCTACAAGGACCCGCAGGGCCTCCAGGTGAAAAGGGTGAGCCAGGTGACGACGGTCCATCTGGTGCTGAAGGTCCACCCGGAGAGCCCGGTTTGCAAGGTCCAGCCGGTCCTCCCGGTGAGAAAGGGGAACCGGGGGATGACGGTCCATCTGGTGCGGAAGGTCCACCAGGCGAACCTGGTCTACAAGGTCCAGCTGGTCCTCCAGGTGAAAAGGGTGAACCTGGTGACGATGGACCATCTGGTGCTGAGGGGCCACCCGGGGAGCCCGGTCTCCAGGGGCCCGCGGGACCCCCTGGCGAAAAGGGTGAGCCGGGTGATGATGGGCCTTCCGGTGCTGAAGGTCCACCTGGGGAACCAGGTTTGCAAGGTCCAGCCGGTCCGCCTGGCGAGAAAGGTGAGCCCGGTGACGACGGGCCTAGTGGTGCCGAAGGCCCGCCAGGGGAGCCAGGCTTACAGGGACCAGCGGGCCCTCCTGGCGAAAAGGGTGAACCAGGTGACGATGGTCCTTCCGGGGCGGAAGGTCCTCCGGGAGAACCTGGACTGCAAGGTCCAGCCGGTCCACCCGGAGAAAAGGGTGAGCCTGGAGATGACGGCCCGAGCGGTGCTGAAGGTCCCCCG。
[0059] The synthesized gene sequence was verified by double digestion with EcoRI / NotI.
[0060] 1.2 Expression vector assembly The optimized gene fragment was cloned into the pPICZαA vector (Invitrogen), replacing the original α-factor signal peptide and retaining the Zeocin resistance marker.
[0061] The constructed vector pPICZαA-hCol3 was confirmed to be correct by sequencing.
[0062] 1.3 Construction, electroporation, and screening of recombinant yeast strains: The linearized vector was transformed into Pichia pastoris GS115 competent cells by electroporation (1500 V, 25 μF, 200 Ω).
[0063] Positive clones were screened on YPD plates containing 100 μg / mL Zeocin, and 50 clones were randomly selected for PCR verification (primers: AOX1-F: 5'-GCGTCCAATGCAATTCCT-3', SEQ ID NO.4; 3'-AOX1-R: 5'-GCAAATGGCATTCTGACATCC-3', SEQ ID NO.5).
[0064] 1.4 Screening of high-expression strains Positive strains were initially screened and induced with methanol in BMGY / BMMY medium (1% v / v, 72 h, 30℃).
[0065] The expression levels of secreted proteins were analyzed by SDS-PAGE. The strain GS115 / pPICZαA-hCol3-7, which had the highest expression level, was selected for subsequent studies.
[0066] 1.5 Fermentation conditions for high-density fermentation Fed-batch culture was performed using a 5 L fermenter (BioFlo 310, NBS): Basic salt medium: growth medium (BMGY), initial glycerol concentration 4% (w / v); The specific formula is shown in Table 1.
[0067] Table 1 Glycerin replenishment period: Replenish glycerin to maintain a glycerin concentration of 4%, dissolved oxygen at 30%, temperature at 30℃, and pH at 5.0; Methanol induction period: Add methanol to raise the methanol concentration to 1.5% (v / v) and maintain it for 72 h, with dissolved oxygen >20% and the temperature reduced to 25℃.
[0068] 1.6 Expression Product Harvest Centrifuge (8000×g, 4℃, 20 min) to remove bacterial cells, and filter the supernatant through a 0.22 μm filter membrane.
[0069] Coomassie Brilliant Blue quantification showed that the final protein concentration in the fermentation broth reached 1.2 g / L (±0.15 g, n=3).
[0070] 1.7 Ammonium sulfate fractionation precipitation The fermentation supernatant (pH 7.4) was placed in an ice bath and stirred slowly. Solid ammonium sulfate was gradually added to 30% saturation (179 g / L). After standing at 4°C for 4 h, the mixture was centrifuged (12,000×g, 30 min, 4°C). The precipitate was discarded and the supernatant was collected. Continue adding ammonium sulfate to 55% saturation (add an additional 163 g / L), let stand for 12 h, centrifuge, collect the precipitate and completely dissolve it in TBS buffer (20 mM Tris-HCl, 50 mM NaCl, pH 7.8).
[0071] 1.8 Ion exchange chromatography purification An anion exchange column (Cytiva, HiTrap Q HP) was used. Equilibration buffer: 20 mM Tris-HCl, 50 mM NaCl, pH 7.8; Elution buffer: 20 mM Tris-HCl, 500 mM NaCl, pH 7.8.
[0072] Elution was performed at 30 CV, and the absorbance was monitored at 280 nm using UV. The main peak collection solution was concentrated by ultrafiltration (10 kDa tangential flow membrane) to obtain a recombinant humanized type II collagen solution, see [link to relevant documentation]. Figure 1 (The left image shows the bottle upside down after being bottled, and the right image shows the bottle standing at an angle after being bottled).
[0073] Example 2: Preparation of recombinant humanized type II collagen bioscaffold 1. Wash and dry Preparation: Obtain materials such as borosilicate controlled injection vials, halogenated butyl rubber stoppers for freeze drying of injections, and aluminum-plastic combination caps for antibiotic vials.
[0074] Washing and drying: After receiving the borosilicate glass vials, remove the outer packaging, neatly place them in an ultrasonic cleaner, and use purified water for ultrasonic cleaning; after cleaning, take them out and put them in an oven set at 80℃ to dry them for later use.
[0075] Remove the outer packaging of the freeze-dried halogenated butyl rubber stopper for injection, place it in a sterilization bag and seal it. Use a high-pressure steam sterilizer to perform moist heat sterilization at 121°C for 30 minutes. After sterilization, place it in an oven at 80°C for 8 hours to dry before use.
[0076] Remove the outer packaging of the antibiotic bottle with an aluminum-plastic combination cap, place it in a sterilization bag and seal it. Use a high-pressure steam sterilizer to perform moist heat sterilization at 121°C for 30 minutes. After sterilization, place it in an oven and dry it at 80°C for 8 hours until ready for use.
[0077] 2. Filling The prepared borosilicate-controlled injection vials (vials) and halogenated butyl rubber stoppers for freeze-drying were placed under a clean bench and irradiated with ultraviolet light for 30 minutes. The recombinant humanized type II collagen prepared in Example 1 was prepared into protein (peptide) solutions with concentrations of 2-15 mg / mL using different solvents (including PBS buffer (0.2M, Maclean, catalog number: P917808), Tris-HCl buffer (1M, pH 6.8, filtered sterile, enzyme-free, Maclean, catalog number T917656), and NaCl aqueous solutions of different concentrations), and placed under the clean bench.
[0078] Calculate the protein volume based on the Kjeldahl nitrogen concentration and specifications of the protein solution. Use a pipette to draw the protein solution into vials and partially stopper them with halogenated butyl rubber stoppers for injection freeze drying. After filling, arrange the vials neatly on the freeze drying tray and place the freeze drying tray into the freeze dryer for freeze drying.
[0079] 3. Freeze-drying: Set the freeze-drying parameters according to the requirements in Table 2, start the freeze-drying cycle, and execute the freeze-drying cycle. The initial temperature of the freeze dryer is room temperature.
[0080] Table 2 4. Roller capping After freeze-drying, open the small door to discharge the contents, remove the vials, and use an antibiotic vial aluminum-plastic combination cap and a capping machine to cap them. After capping, the caps should be securely sealed, and the surface should be smooth without wrinkles, scratches, cap detachment, or leaks.
[0081] Recombinant humanized type II collagen scaffolds were prepared by freeze-drying. The shape changes after freeze-drying under different filling conditions are shown in the figure. Figure 2 As shown in Table 3, the freeze-dried products obtained under certain conditions are different from traditional freeze-dried powders, and can exhibit a well-supported scaffold structure without the addition of additional crosslinking agents and organic solvents.
[0082] Table 3. Filling parameters for the freeze-drying process and corresponding freeze-dried forms Example 3 Microstructure Characterization of Recombinant Collagen Scaffold 1. Sample Preparation The lyophilized recombinant humanized type II collagen scaffold prepared in Example 2 (wherein the filling process used 0.9wt% sodium chloride aqueous solution as solvent to dissolve collagen, and the collagen content was controlled to be 15mg / mL, see photo) was prepared. Figure 3 The process involves drying and gold plating, and the specific steps include: The sample was frozen and fixed in liquid nitrogen (-196℃, 10 min), and gold was sputtered onto the sample surface using an ion sputtering instrument (model: JEOL JFC-1600). The gold film thickness was controlled at 10 nm (sputtering current 15 mA, time 60 s).
[0083] 2. Test Conditions The scanning electron microscope used was a Hitachi SU8010 field emission electron microscope system. The parameters were set as follows: Accelerating voltage: 5 kV; Working distance: 8 mm; Detector: Secondary electron detector (SE).
[0084] Scanning electron microscope image (see) Figure 4 It can be seen that the recombinant collagen scaffold of the present invention has a sponge-like three-dimensional structure.
[0085] Example 4: Detection of cell viability of recombinant humanized type II collagen C28 / I2 cells (CCK-8 assay) 1. Experimental Materials Cell line: Human chondrocytes C28 / I2 (ATCC, L689). Equipment: CO2 incubator, microplate reader (detection wavelength 450nm). Reagents: CCK-8 assay kit (Liji Biotechnology, AC11L054), culture medium (DMEM + 10% FBS), glutaraldehyde cross-linked recombinant humanized type II collagen solution, and protein scaffold solution.
[0086] Glutaraldehyde cross-linking group: The glutaraldehyde cross-linked recombinant humanized type II collagen solution was prepared as follows: 0.03% glutaraldehyde (cross-linking agent) was added to 30 mg / mL recombinant humanized type II collagen (diluted with physiological saline), and cross-linked at 4℃, pH 7.5 for 24 h. Subsequently, it was diluted to the specified protein concentration using Dmem.
[0087] Protein scaffold group: The protein biological scaffold solution was prepared as follows: Take 25 mg of the recombinant type II collagen scaffold described in Example 3, weigh 1 mL of Dmem, dissolve and dilute to the specified concentration.
[0088] 2. Experimental Procedure Cell seeding: C28 / I2 cells were seeded at a rate of 5 × 10⁻⁶. 3 Cells / well were seeded at a density of 100 μL of complete culture medium per well and incubated at 37°C and 5% CO2 for 24 hours.
[0089] Analyte processing: The cross-linking group and the protein scaffold group were treated with different concentrations of glutaraldehyde (see [reference needed]). Figure 5 Cells were treated with 100 μL of culture medium in three replicates per group and cultured for 48 hours. A control group was prepared using complete culture medium.
[0090] CCK-8 assay: Add 10 μL of CCK-8 reagent to each well and incubate in the dark for 1 hour.
[0091] Absorbance measurement: The OD value of each well at 450 nm was measured using an ELISA reader. The reference wavelength (used for quality control to determine whether there are bubbles or other factors affecting the reading) is 600 nm.
[0092] 3. Data Analysis Calculate cell viability: Cell viability (%) = (As sample wells - Ab blank wells) / (Ab control wells - Ab blank wells) × 100, where As is the absorbance value of the experimental group, Ab is the absorbance value of the blank group, and Ac is the absorbance value of the control group.
[0093] See results Figure 5 As shown in the figure, the recombinant humanized type II collagen bioscaffold (protein scaffold) significantly promotes chondrocyte vitality and has better biocompatibility than glutaraldehyde-crosslinked recombinant humanized type II collagen (glutaraldehyde crosslinking).
[0094] Example 5: Experiment on repair of cartilage defects in rat knee joints 1. Laboratory animals and grouping Animal strain: SPF grade SD rats, male, 12 weeks old, weighing 350±20g; Group design (n=4 / group): Untreated model: Normal animals, without any treatment.
[0095] Protein scaffold assembly: Implanted with the recombinant humanized type II collagen scaffold of the present invention (see Example 3); Protein solution group: a solution containing 10 μL of recombinant humanized type II collagen; The solution of recombinant humanized type II collagen was prepared by dissolving the recombinant humanized type II collagen prepared in Example 1 in physiological saline to a concentration of 100 mg / mL. Modeling control group: only the defect was created without implanting any material; Positive control group already on the market: Injection of 10 μL of commercially available animal-derived cartilage defect implantation medical device—COLTRIX® CartiRegen collagen cartilage repair scaffold.
[0096] 2. Establishment of a cartilage defect model Anesthesia and disinfection: Isoflurane gas anesthesia, and the surgical area was shaved and disinfected with iodine-alcohol gradient. Surgical procedure (under sterile conditions): make a longitudinal incision on the medial side of the knee joint (about 1 cm long) and separate the quadriceps femoris muscle to expose the trochlear groove of the femur; A full-thickness cartilage defect (0.5 mm depth) was created using a 2 mm diameter trephine.
[0097] Protein scaffold assembly: The repair material is trimmed to the shape of the defect (2mm). 2 Fill in after ).
[0098] The control group of the model did not undergo defect filling.
[0099] Protein solution group and marketed positive control group: 10 μL was injected after cartilage defect modeling.
[0100] The joint capsule and skin were sutured layer by layer, and the mice were fed for another 4 weeks. After 4 weeks, the mice were processed for tissue and serum sampling.
[0101] 3. Get materials a. Quickly amputate both knee joints and open the joint cavity along the sagittal plane; use surgical forceps and tweezers to separate the bone tissue (preserving the cartilage-bone junction); rinse with pre-cooled PBS buffer; b. Blood was collected from the abdominal aorta of each group of mice, and serum was obtained by centrifugation (3000 rpm, 10 minutes); c. Take fresh bone tissue samples, fix the tissue samples with 4% paraformaldehyde (for histological analysis), and perform HE staining, Masson staining, Sirius staining, and immunohistochemical experiments.
[0102] 4. Experimental Results: (1) Observation of knee joint cartilage morphology See the general photos of the organization. Figure 6 Significantly shortened repair cycle: In a rat model of full-thickness cartilage defect with a diameter of 2.0 mm, the recombinant humanized type II collagen scaffold group of this invention achieved 80% ± 7% coverage of the defect area with new cartilage tissue in the 4th week, which was significantly higher than the model control group and the protein solution group.
[0103] Specific induction of hyaline cartilage regeneration: The recombinant humanized type II collagen scaffold of this invention lays the foundation for physiological hyaline cartilage expression in newly formed tissues, effectively avoiding the formation of fibrocartilage.
[0104] Breaking through the time bottleneck of existing technologies: Compared with the shape memory collagen scaffold (https: / / doi.org / 10.1016 / j.joca.2018.06.004, 12-week repair) and hyaluronic acid alginate: doroic acid and other cartilage repair hydrogels (PMCID: PMC4055114, 16-week repair) reported in the literature, the recombinant humanized type II collagen scaffold of this invention compresses the effective repair cycle by 30%-50%, and is one of the very few regenerative scaffold systems reported in the current literature that can achieve rapid repair in 4 weeks.
[0105] (2) Micro-CT three-dimensional structural analysis of the bone repair area Brand: PerkinElmer; Model: Quantum GX2.
[0106] Scan parameter settings: High-resolution scan for 15 minutes; Reconstruction and Analysis Process: a. Use RadiantViewer software for 3D reconstruction; b. Analyze the key defect area (ROI: a 3mm diameter cylinder covering the original defect area); c. Use RadiantViewer software to calculate quantitative parameters: Experimental conclusions: The analysis results of the rat bone specimens are as follows: Figure 7 and Figure 8 .
[0107] Micro-CT 3D reconstruction and ICRS scoring analysis showed that the protein scaffold group exhibited excellent osteochondral repair efficacy: 1) No modeling (normal control) group: BV / TV = 57.6±3.0%; 2) Protein scaffold group: BV / TV = 49.0±3.8%, which was 15% lower than the non-model group (p<0.05) and 85% higher than the model control group (p<0.01). 3) Protein solution group: BV / TV = 28.1±2.5%, which was 51% lower than the non-model group (p<0.01) and 6% higher than the model control group (p>0.05); 4) Control group with modeling: BV / TV = 26.5±1.1%, which was 54% lower than the group without modeling.
[0108] Compared with the non-model group, the BV / TV of the model control group was significantly reduced by 54% (p<0.001), indicating that the cartilage defect model was successfully established. The protein solution group only increased by 6% (p>0.05), with no significant effect. However, the BV / TV of the protein scaffold group was significantly increased by 85% compared with the model control group (p<0.01), showing a good cartilage repair effect. Simultaneously, an excellent cartilage repair effect of 12.2±0.8 points was obtained (significantly higher than 4.1 points in the model control group and 5.3 points in the protein solution group), with a defect filling rate of 97% and cartilage interface reaching Grade I integration, confirming that the recombinant humanized type II collagen scaffold of this invention can achieve a breakthrough in cartilage tissue repair through cartilage matrix regeneration.
[0109] (3) Combined determination of serum biochemical indicators in rats 1) Reagents and instruments: Albumin Assay Kit (BCA Method, Catalog No.: Alb-001); Total Protein Assay Kit (Biuret Method, Catalog No.: TP-002); Total cholesterol assay kit (enzymatic method, catalog number: TC-003); Creatinine assay kit (enzymatic method, catalog number: Cr-004); Standard solutions: albumin, total protein, cholesterol, creatinine (concentration gradient as shown in step 3). Micropipette (accuracy ±0.5 μL); Fully automated biochemical analyzer (OLYMPUS AU640 wavelength range: 400-700 nm); Constant temperature water bath (temperature control accuracy ±0.5℃).
[0110] 2) Sample preprocessing The collected serum samples were aliquoted into 1.5 mL centrifuge tubes, and stored at -80°C for later use, avoiding repeated freeze-thaw cycles.
[0111] Before testing, thaw the samples at room temperature, vortex mix for 5 seconds, and exclude samples with lipemia or hemolysis (absorbance OD450 < 0.1).
[0112] 3) Preparation of standard curve Albumin standard curve: Prepare bovine serum albumin solutions of 0, 10, 20, 40, and 80 g / L, mix them with BCA working solution at a volume ratio of 1:10, incubate at 37°C for 30 minutes, and measure absorbance at 562 nm.
[0113] Total protein standard curve: Prepare bovine serum albumin solutions of 0, 20, 40, 60, and 80 g / L, mix with biuret reagent at a volume ratio of 1:20, react at room temperature for 10 minutes, and measure absorbance at 540 nm.
[0114] Total cholesterol standard curve: Prepare cholesterol standard solutions of 0, 2, 4, 6, and 8 mmol / L, mix them with enzymatic reagents (containing cholesterol oxidase and peroxidase) at a volume ratio of 1:50, incubate at 37°C for 10 minutes, and measure absorbance at 500 nm.
[0115] Creatinine standard curve: Prepare 0, 50, 100, 200, and 400 μmol / L creatinine standard solutions, mix them with enzymatic reagents (containing creatinine enzyme and peroxidase) at a volume ratio of 1:10, incubate at 37°C for 5 minutes, and measure the absorbance at 505 nm.
[0116] 4) Sample testing and data analysis Albumin detection: Add 45 μL of BCA working solution to 5 μL of serum sample, incubate under the same conditions as the standard curve, and calculate the concentration (linear range: 5-100 g / L, R0). 2 >0.995).
[0117] Total protein assay: Take 10 μL of serum sample, add 190 μL of biuret reagent, mix well, and measure directly. Calculate the concentration (linear range: 10-120 g / L, R0). 2 >0.99).
[0118] Total cholesterol detection: Add 98 μL of enzymatic working solution to 2 μL of serum sample, incubate at 37℃ for 10 min, and then measure the concentration (linear range: 0.5-12 mmol / L, R). 2 >0.998).
[0119] Creatinine detection: Add 180 μL of enzymatic working solution to 20 μL of serum sample, incubate at 37℃ for 5 min, and then measure the concentration (linear range: 20-800 μmol / L, R0). 2 >0.995).
[0120] All test results are automatically reported by the biochemical analyzer software (units: albumin g / L, total protein g / L, total cholesterol mmol / L, creatinine μmol / L).
[0121] Low-density lipoprotein cholesterol, alanine aminotransferase, and aspartate aminotransferase were detected by a fully automated biochemical analyzer.
[0122] Experimental conclusion: The test results are shown below. Figures 9 to 11 The recombinant humanized type II collagen scaffold exhibits significantly higher safety in rats with cartilage defects compared to marketed control animal collagen (marketed positive control group). Comparative experimental data shows that, compared to marketed control group products, the collagen scaffold described in this invention demonstrates significant advantages in detecting key liver injury indicators: Figure 9 Among serum enzyme indicators, the data for lactate dehydrogenase were significantly better than those of the marketed control group. Regarding liver injury-related indicators ( Figure 10 The levels of aspartate aminotransferase (AST), creatinine (CREA), and alanine aminotransferase (ALT) in the tested product were significantly better than those in the marketed control group. Furthermore, in terms of lipid metabolism indicators (…),… Figure 11 The four indicators of low-density lipoprotein cholesterol, total cholesterol, albumin, and total protein in the protein scaffold group were significantly better than those in the marketed control group, while the relevant values in the protein scaffold group were not significantly different from those in the blank control group. The statistical differences of the above biomarkers (P<0.05) fully demonstrate that the present invention, through its innovative recombinant humanized type II collagen scaffold design, effectively reduces the potential toxicity risks of traditional animal collagen products, achieving a breakthrough improvement in biocompatibility and safety, and is particularly suitable for medical device applications requiring long-term implantation.
[0123] (4) Analysis of tissue staining samples 1) Sample preparation a. Decalcification treatment: The knee joint tissue sampled and fixed in step 3c above was transferred into a 10% EDTA decalcification solution (pH 7.4) and decalcified by shaking at room temperature for 5 days, with the decalcification solution changed daily.
[0124] b. Dehydration and embedding: Gradient ethanol dehydration (70%→80%→95%→100%), xylene for transparency, paraffin impregnation, and then embedding into wax blocks.
[0125] c. Sectioning: Prepare 4 μm thick continuous sections using a microtome, attach them to a glass slide to prevent detachment, and bake at 60°C for 1 hour.
[0126] 2) HE staining steps a. Dewaxing and hydration: 10 minutes each of xylene I and II → 2 minutes each of gradient ethanol (100% → 95% → 80% → 70%) → rinse with distilled water.
[0127] b. Staining: Immerse in hematoxylin and argillaceae dye solution for 5 minutes → rinse with running water → differentiate with 1% hydrochloric acid and ethanol for 10 seconds → return to blue with running water for 15 minutes.
[0128] Immerse in eosin dye for 3 minutes → rinse with running water.
[0129] c. Dehydration and mounting: Gradient ethanol dehydration → xylene clearing → neutral resin mounting.
[0130] 3) Masson's trichrome staining steps a. Dewaxing and hydration: Same as step a in item 2) above.
[0131] b. Staining: Immerse in Weigert ironwood dye solution for 10 minutes → rinse with running water.
[0132] Stain with a mixture of Ponceau S and Acid Fuchsin for 5 minutes → rinse with 1% glacial acetic acid.
[0133] Differentiate with 1% phosphomolybdic acid solution for 3 minutes → immerse in aniline blue staining solution for 5 minutes → differentiate with 0.2% glacial acetic acid.
[0134] c. Dehydration sealing.
[0135] 4) Sirius Red staining: a. Dewaxing to water: Same as step a in item 2) above.
[0136] b. Sirius Red dyeing: After washing, the slices are immersed in Sirius red staining solution for 1 hour.
[0137] c. Differentiation and flushing: After staining, rinse twice quickly with 0.5% dilute acetic acid, each time for about 5 seconds. Then, rapidly differentiate and dehydrate with anhydrous ethanol.
[0138] d. Transparency and Sealing: After dehydration with anhydrous ethanol, the sections were cleared in xylene (xylene I for 5 minutes → xylene II for 5 minutes). They were then sealed with neutral resin or gum.
[0139] 5) Immunohistochemical staining (IHC) procedure a. Antigen retrieval: The sections were heat-retrieved for 20 minutes in sodium citrate buffer (pH 6.0, 95℃) and then allowed to cool naturally.
[0140] b. Blocking: Block with 3% BSA-PBS solution at room temperature for 30 minutes.
[0141] c. Primary antibody incubation: Add anti-type II collagen monoclonal antibody (abcam catalog number ab307674, 1:200 dilution) and incubate overnight at 4°C.
[0142] d. Secondary antibody reaction: HRP-labeled secondary antibody (1:500 dilution) was incubated at 37°C for 1 hour.
[0143] e. Color development: DAB color development solution for 3 minutes → hematoxylin counterstaining nuclei → flow cessation.
[0144] f. Sealing: Secure with neutral resin.
[0145] g. Use the IHC Profiler plugin for ImageJ software to process the data.
[0146] The experimental results are shown in Figure 12 and Figure 13 .
[0147] Experimental conclusions: HE staining showed that the recombinant humanized type II collagen scaffold group of the present invention had a continuous and intact cartilage layer structure, regular cell arrangement and no fibrosis (the repair effect was comparable to the normal control group without modeling), and was significantly better than the modeling control group (partially filled with fibrous tissue) and the protein solution group (scar-dominated). Masson staining showed that the proportion of mature collagen in the recombinant humanized type II collagen scaffold group of the present invention was >85% (close to normal cartilage), while the collagen in the model control group (about 40%) and the protein solution group (<15%) was sparse and disordered. Sirius red staining further verified that the recombinant humanized type II collagen scaffold of this invention was dominated by synthetic type II collagen for repair, consistent with the normal group, while the control group was dominated by type I collagen (orange-yellow). The newly generated type II collagen exerted its repair effect; For Collagen II (COL2) immunohistochemistry, the IHC Profiler plugin of ImageJ software was used for data processing and analysis to obtain... Figure 13 The results showed that, for the defective area, the antibody-positive expression of Collagen II (COL2) in the recombinant humanized type II collagen scaffold group of the present invention was slightly higher than that in the normal non-model group. This data indicates that the regeneration effect of Collagen II is close to that in the normal non-model group, and significantly higher than that in the model control group (<10%) and the protein solution group (<10%) (p<0.001).
[0148] Conclusion: The recombinant humanized type II collagen scaffold of this invention actively induces type II collagen synthesis through a three-dimensional biomimetic microenvironment, achieving dual structural and functional repair. The effect is close to that of normal cartilage and significantly better than that of the passive repair group (p<0.001), demonstrating its revolutionary regenerative potential.
[0149] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A recombinant humanized type II collagen bioscaffold, characterized in that, It is prepared by freeze-drying a solution of a polypeptide, wherein the amino acid sequence of the polypeptide contains n repeating units; The repeating unit comprises any one of the following amino acid sequences (1)-(3) or a variant thereof: (1) The amino acid sequence shown in SEQ ID NO.1; (2) An amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO.1; (3) A variant sequence obtained by mutating one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1; Where n ≥ 1 and is an integer.
2. The recombinant humanized type II collagen bioscaffold according to claim 1, characterized in that, n is an integer between 1 and 12, preferably 9; Preferably, when n≥2, the repeating units are directly connected; Preferably, the polypeptide has an amino acid sequence as shown in SEQ ID NO.
2.
3. The recombinant humanized type II collagen bioscaffold according to claim 1, characterized in that, The nucleotide sequence encoding the polypeptide comprises the nucleotide sequence shown in SEQ ID NO.3 or a degenerate sequence thereof.
4. The method for preparing the recombinant humanized type II collagen bioscaffold according to any one of claims 1-3, characterized in that, include: S1. Cultivate host cells containing a nucleotide sequence encoding the polypeptide; S2. Harvest the host cells and / or culture medium containing the polypeptide, and isolate the polypeptide therefrom; S3. Freeze-dry the solution of the polypeptide.
5. The preparation method according to claim 4, characterized in that, The host cell is a bacterium, fungus, or animal cell; the bacteria preferably include Escherichia coli; the fungus preferably includes yeast, more preferably Saccharomyces cerevisiae or Pichia pastoris.
6. The preparation method according to claim 4 or 5, characterized in that, The freeze-drying process includes pre-freezing, sublimation drying, and desorption drying. The pre-freezing temperature is -40℃, the cooling rate is 13±2℃ / min, and the temperature holding time is 240min; The sublimation drying process is repeated 2-6 times, preferably 5 times; The sublimation drying process employs a gradient temperature increase, with the temperature gradient controlled at 5-10℃ / cycle; the heating rate between each sublimation drying cycle is 0.5-1℃ / min; and the temperature holding time for each sublimation drying cycle is 300-1200min. Preferably, the specific steps of the sublimation drying are as follows: The number of times the analytical drying is performed is 1 to 4, preferably 2 times; the analytical drying adopts a gradient temperature increase, and the temperature increase gradient is controlled at 8-18℃ / time; the temperature increase rate between each analytical drying is 0.5-1℃ / min; the temperature holding time for each analytical drying is 300-600min; Preferably, the specific steps of the analytical drying are as follows: Preferably, after pre-freezing, a vacuum is drawn to a vacuum level of 13 Pa.
7. The preparation method according to any one of claims 4-6, characterized in that, The solvent for the polypeptide solution is an isotonic solution, preferably one or more of sodium chloride aqueous solution, PBS buffer, and Tris-HCl buffer; the mass concentration of the sodium chloride aqueous solution is 0.5 wt%-3.0 wt%; preferably 0.9 wt%-2.0 wt%. Preferably, the concentration of the PBS buffer is 0.2 mol / L; Preferably, the concentration of the Tris-HCl buffer solution is 1 mol / L, and the pH is 6.5~7.0; When the solvent is PBS buffer or sodium chloride aqueous solution, the concentration of the polypeptide solution is 2-15 mg / mL; When the solvent is Tris-HCl buffer, the concentration of the polypeptide solution is 5-10 mg / mL.
8. A composition, characterized in that, Includes the recombinant humanized type II collagen bioscaffold as described in any one of claims 1-3 or the recombinant humanized type II collagen bioscaffold prepared by the preparation method described in any one of claims 4-7.
9. The composition according to claim 8, characterized in that, It also includes active ingredients carried in the recombinant humanized type II collagen bioscaffold.
10. The use of the recombinant humanized type II collagen bioscaffold according to any one of claims 1-3, or the recombinant humanized type II collagen bioscaffold prepared by the preparation method according to any one of claims 4-7, or the composition according to claim 8 or 9 in the preparation of cartilage repair products.
11. The application according to claim 10, characterized in that, The cartilage repair product has a sponge-like three-dimensional structure.
12. A method for repairing cartilage defects and / or regenerating chondrocytes in vivo, characterized in that, The method includes filling a cartilage defect site with the recombinant humanized type II collagen bioscaffold according to any one of claims 1-3, or the recombinant humanized type II collagen bioscaffold prepared by the preparation method according to any one of claims 4-7, or the composition according to claim 8 or 9, wherein the method is not for disease diagnosis or treatment purposes.
Citation Information
Patent Citations
Preparation method of novel recombinant humanized collagen hydrogel
CN119390816A
Polypeptide, recombinant XIX type humanized collagen and application of recombinant XIX type humanized collagen
CN120842366A
Character keeping factor of human cartilage cell
JP2007308461A
The use of midkine protein and the protein-containing medical device
US20120108516A1