Burkholderia paragallinarum N7-2, application and method for relieving nicosulfuron stress by using burkholderia paragallinarum N7-2

By screening and purifying Ursodeoxycholic acid bacterium N7-2, a liquid bacterial agent was prepared for use in nicosulfuron-contaminated soil, solving the phytotoxicity problem of nicosulfuron to soybeans and achieving significant degradation and growth promotion effects.

CN121574868AActive Publication Date: 2026-02-27INST OF SOIL SCI CHINESE ACAD OF SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511750992.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-02-27
Estimated Expiration
2045-11-26

AI Technical Summary

Technical Problem

In existing technologies, the long-lasting residues of nicosulfuron in farmland soil cause phytotoxicity to the growth of subsequent soybean crops. Furthermore, existing microbial degradation strains are difficult to isolate and have low degradation efficiency, making it difficult to effectively mitigate the agricultural ecological risks of nicosulfuron pollution.

Method used

Using Ursodeoxycholic acid bacterium N7-2, a liquid bacterial agent was prepared through screening, purification and activation. This agent was then applied to nicosulfuron-contaminated soil. Combined with soybean seed pretreatment, the soybeans were planted in the contaminated soil to achieve the degradation of nicosulfuron.

Benefits of technology

It significantly reduces the concentration of nicosulfuron in the soil, improves the growth performance of soybean seedlings, with a degradation rate of up to 22.4% and an increase in leaf area of ​​72.8%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574868A_ABST
    Figure CN121574868A_ABST
Patent Text Reader

Abstract

The invention relates to burkholderia paragallinarum N7-2, application and a method for relieving nicosulfuron stress by using the burkholderia paragallinarum N7-2, the burkholderia paragallinarum N7-2 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.35323, and the preservation date is July 21, 2025. By applying the burkholderia paragallinarum N7-2 to the soil polluted by the nicosulfuron, the stress of the nicosulfuron to the growth of the soybeans can be obviously relieved. According to the embodiment, the concentration of the nicosulfuron in the rhizosphere soil of the soybean seedlings is reduced by 22.4%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a tropical Burkholderia paraknegol N7-2 bacterium, its application, and a method for alleviating nicosulfuron stress, belonging to the field of soil microbial technology. Background Technology

[0002] Nicosulfuron is a widely used systemic herbicide in agricultural production. Compared to other sulfonylurea herbicides, it exhibits higher bioactivity and plant selectivity against annual grasses and broadleaf weeds, playing a crucial role in ensuring the yield and quality of grain crops such as corn. However, with the continuous increase in the area and amount of pesticides applied in agricultural production, nicosulfuron accumulates in the soil environment, causing numerous agricultural and ecological problems, including long-lasting residues in the soil, phytotoxicity in subsequent crops, increased weed resistance, water pollution, and secondary toxicity of its products. This has raised significant concerns about its agricultural ecological risks and health hazards. Soybeans, as a common rotation crop with corn, are extremely sensitive to nicosulfuron pollution stress in the soil. Long-lasting nicosulfuron residues in cornfields can cause significant phytotoxicity to the development and growth of subsequent soybean crops, including poor emergence, inhibited seedling growth, increased disease incidence, and reduced yield, severely restricting the sustainable production of rotation systems. Therefore, developing green and efficient pollution control and removal technologies, and exploring environmentally friendly and low-cost pollution control materials and biological resources, are of significant scientific and practical guiding importance for addressing the long-term residual pollution of nicosulfuron in farmland soils. Soil is rich in functional microbial resources, and soil microbial degradation has become an important, environmentally friendly, and low-cost technical means for the efficient removal of pollutants. Although more than ten nicosulfuron-degrading microorganisms have been isolated and purified from soil / sludge environmental media, many problems remain, including difficulties in isolation and purification, low pollution removal efficiency, poor resistance to high pollution stress, and a lack of verification of practical application effects in farmland soils. These issues, to some extent, limit the development and utilization of efficient microbial degradation technologies in farmland soils.

[0003] It is evident that, based on existing microbial degradation strain resources, screening novel microorganisms with highly efficient nicosulfuron degradation functions and adaptability to high pollution stress from farmland soil, and conducting application verification of microbial degradation functions and technical systems, not only has practical significance for the development of nicosulfuron microbial agents for farmland soil and the application of pollution remediation technologies, but also provides important scientific and technological support for reducing pesticide damage to subsequent crops and ensuring the safe production of agricultural products. Summary of the Invention

[0004] In order to overcome the above-mentioned defects and deficiencies in the prior art, this invention provides a method for mitigating soybean nicosulfuron stress by using *U. tropicalis* N7-2 and its application, which can effectively alleviate the stress of nicosulfuron on soybeans in the soil.

[0005] To solve the above-mentioned technical problems, the present invention provides a tropical burkermansia N7-2, which is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 35323 and deposit date of July 21, 2025.

[0006] In addition, the present invention also provides the application of Tropical Burkholderia holmium N7-2 in alleviating nicosulfuron stress in soybean seedlings.

[0007] Furthermore, the use of Ursodeoxycholic acid bacterium N7-2 to degrade nicosulfuron in the soil can alleviate the stress of nicosulfuron on soybean seedlings.

[0008] The present invention also provides a method for alleviating nicosulfuron stress in soybean seedlings, comprising the following steps: S1 was used to pretreat *U. tropicalis* N7-2 to obtain a liquid bacterial agent of *U. tropicalis* N7-2; wherein, *U. tropicalis* N7-2 is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 35323 and accession date of July 21, 2025; S2 soybean seed pretreatment; S3 incorporates the liquid inoculum agent N7-2 of Burkholderia tropicalis into soil contaminated with nicosulfuron. S4 involves planting the pretreated soybean seeds into the soil from step S3.

[0009] The specific process of step S1 is as follows: The *U. tropicalis* N7-2 strain, preserved in an ultra-low temperature freezer at -80℃, was activated and cultured in 100 mL of GSM medium at 180 rpm and 30℃ for 2 days. A 5 μL inoculation loop was used to streak the activated culture onto GSM agar plates for isolation, and cultured at 30℃ for 2 days. Single colonies were picked and cultured in 100 mL of PB medium at 180 rpm and 30℃ until OD600 = 1. The culture was centrifuged at 5000 rpm for 10 minutes, resuspended in 100 mL of 0.1% sodium chloride solution, and centrifuged again at 5000 rpm for 10 minutes. This process was repeated twice to obtain a liquid *U. tropicalis* N7-2 bacterial agent with OD600 = 1.

[0010] Place soybean seeds in a 50mL sterile plastic centrifuge tube, soak them in 30mL of 70% ethanol solution and shake them repeatedly for 3 minutes. After discarding the ethanol, add 30mL of 1% sodium hypochlorite solution, invert and mix thoroughly for 5 minutes, then rinse 5 times with sterile distilled water and sow them in a pot. The beneficial technical effects achieved by this invention are as follows: This invention discloses *U. tropicalis purpurea* N7-2, its application, and a method for alleviating nicosulfuron stress. By applying *U. tropicalis purpurea* N7-2 to soil contaminated with nicosulfuron, the stress of nicosulfuron on soybean growth can be significantly alleviated. Examples show that the concentration of nicosulfuron in the rhizosphere soil of soybean seedlings decreased by 22.4%. Attached Figure Description

[0011] Figure 1 This is a scanning electron micrograph of the tropical Burkholderia holmium N7-2 of the present invention; Figure 2 The present invention relates to Tropical Burkholderia holmium N7-2 ( Paraburkholderia tropica N7-2) Phylogenetic tree; Figure 3 The effects of different conditions on the ability of *U. tropicalis* N7-2 to degrade nicosulfuron are as follows: (a) different pH values, (b) initial concentration of nicosulfuron, and (c) initial inoculum amount of *U. tropicalis* N7-2. Figure 4 The results of the tropical Burkholderia paraknegriensis N7-2 of this invention in alleviating the stress of nicosulfuron in the soil on soybean seedlings are statistically analyzed; wherein: (a) is a photo of the plant after 21 days of culture; (b) is a photo of the plant leaves after 21 days of culture; (c) is the statistical results of the leaf area after 21 days of culture; (d) is the content of nicosulfuron in the non-rhizosphere and rhizosphere soils after 21 days of culture.

[0012] Tropical Burkholderia, classified as Paraburkholderia tropica N7-2 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 35323 and deposit date of July 21, 2025. Detailed Implementation

[0013] The present invention will be further described below with reference to specific embodiments. These embodiments are only used to more clearly illustrate the technical solutions of the present invention and should not be construed as limiting the scope of protection of the present invention.

[0014] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0015] The microbial culture medium used in the following examples, namely glucose inorganic salt culture medium (GSM), consists of glucose (1.0 g / L), KH2PO4 (0.5 g / L), K2HPO4 (1.5 g / L), NaCl (0.5 g / L) and MgSO4·7H2O (0.5 g / L). Agar (14.0 g / L) is added to the GSM solid medium.

[0016] Example 1: Screening, isolation, and purification of Ursodeoxychondria paraknockholes N7-2 *U. paraburdenobacterium tropicalis* N7-2 was derived from black soil in Changchun City, Jilin Province. The specific process is as follows: An initial 1000 mg / kg nicosulfuron aqueous solution was prepared and filtered through a 0.22 μm sterile aqueous syringe to prepare nicosulfuron GSM medium. 5 g of fresh soil and 50 mL of 100 mg / kg nicosulfuron GSM medium were added to 150 mL Erlenmeyer flasks, and the mixture was incubated at 30℃ and 150 rpm for 72 hours. After 3 days of incubation, 10 mL of the medium was added to 50 mL of 200 mg / kg nicosulfuron GSM medium, and incubated for another 3 days. This process was repeated until the volume of 800 mg / kg nicosulfuron GSM medium reached 400 mL, and the mixture was incubated for 3 days. The resulting turbid solution after acclimatization was diluted and spread onto 800 mg / kg nicosulfuron GSM solid medium, and incubated at 30℃ until single colonies appeared.

[0017] Single colonies from solid culture media were selected and inoculated into 100 mg / kg nicosulfuron GSM medium. After purification through three cycles of liquid-solid culture, samples were taken at 0, 12, 24, 36, 48, 72, and 96 hours to determine the residual concentration of nicosulfuron. Candidate colonies with nicosulfuron degradation function were selected, such as... Figure 1 As shown, it was stored at -80°C with a 25% glycerol-water preservation solution.

[0018] The selected colonies were identified based on phylogenetic analysis of their 16S rRNA sequences. PCR primers were 27F (SEQ ID NO.1: AGAGTTTGATCCTGGCTCAG) and 1492R (SEQ ID NO.2: GGTTACCTTGTTACGACTT). PCR reaction conditions were: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 90 s, and 72℃ stable extension for 10 min, repeated 25 times. The cells were stored at 10℃ until the reaction was complete. Products were detected by 2% agarose gel electrophoresis, and PCR products were purified using a DNA gel purification kit. The total volume of the PCR amplification system was 20.0 µL, and its components were: 2.0 µL of 10× Ex Taq Buffer, 1.6 µL of 2.5 mM dNTP Mix, 1.0 µL each of forward and reverse primers (5p Primer 1 and 5p Primer 2), 0.5 µL of template DNA, 0.2 µL of 5 U / µL Ex Taq DNA polymerase, and finally, sterile ddH2O was added to bring the volume to 20.0 µL. The 16S rRNA fragment was obtained and sent to Shanghai Meiji Biotechnology Co., Ltd. for sequencing using the Illumina Nextseq 2000 platform. The sequencing results were compared with the NCBI database using MEGA 10.0, and a phylogenetic tree was constructed using the neighbor-joining method to identify the strain. Comparative analysis revealed... Paraburkholderia tropica The highest sequence similarity was 99.64%. This indicates that the degrading bacteria isolated in this invention belong to [a specific group / organization]. Paraburkholderia Fungi tropica The strain was named N7-2. The phylogenetic tree is as follows: Figure 2 As shown.

[0019] Example 2: Degradation of nicosulfuron by Burkholderia paratyphimurium N7-2 1. An initial 1000 mg / kg nicosulfuron aqueous solution was prepared and filtered through a 0.22 μm sterile aqueous syringe filter to prepare 100 mg / kg nicosulfuron GSM medium. A stock solution of *U. tropicalis* N7-2, cultured for 24 hours, was added to adjust the initial inoculum concentrations (OD600) to 0.04, 0.08, 0.15, 0.28, and 0.5, respectively. The pH was adjusted to 6.5, and the mixture was incubated at 30℃ and 180 rpm in a shaking incubator. Sampling points were set at 96 hours to detect the residual concentration of nicosulfuron. The results are as follows: Figure 3 As shown in Figure (a), it can be seen from the figure that when the initial inoculum amount of Tropical Burkholderia N7-2 is 0.15, the degradation ability of nicosulfuron is the strongest.

[0020] 2. A stock solution of *U. tropicalis* N7-2 cultured for 24 hours was added to 50 mg / kg nicosulfuron GSM medium to achieve an OD600 concentration of 0.15. The pH of the culture system was adjusted to 5, 6, 6.5, 7, 8, and 9 using 1 mol / L NaOH or HCl aqueous solution filtered through a 0.22 μm sterile water membrane filter. The culture was then incubated at 30℃ and 180 rpm in a shaking incubator for 96 hours. The residual concentration of nicosulfuron was then determined. The results are as follows: Figure 3 As shown in (b) of the diagram.

[0021] 3. *Burkholderia tropicalis* N7-2 bacterial stock solution, cultured for 24 hours, was added to GSM medium containing 0, 100, 200, 400, and 800 mg / kg nicosulfuron, respectively, to achieve a bacterial concentration of OD600 = 0.15. The mixture was then incubated at 30℃ and 180 rpm in a shaking incubator, with the pH adjusted to 6.5. After 96 hours of incubation, the residual concentration of nicosulfuron was measured. The results are as follows: Figure 3 As shown in (c) in the figure.

[0022] Detection of nicosulfuron residual concentration: After cultivation, 2 mL of culture medium was added to a 2 mL centrifuge tube and centrifuged at 10000 rpm and 4℃ for 2 minutes. 0.2 mL of the supernatant was mixed with 1.8 mL of acetonitrile and vortexed at 1000 rpm for 5 minutes; then centrifuged again at 10000 rpm and 4℃ for 2 minutes to remove trace amounts of salt components. The supernatant was filtered through a 0.22 μm organic syringe filter and transferred to a 2 mL sample vial for analysis. The residual concentration of the nicosulfuron parent compound was determined by high performance liquid chromatography (HPLC, Agilent 1200). The HPLC mobile phase was acetonitrile:0.1% acetic acid / water = 40:60, the column was a Waters Symmetry C18 (5 μm, 4.6 mm × 250 mm), and the column oven temperature was set to 30℃. A diode array detector (DAD) was used, with a detection wavelength of 240 nm (nicosulfuron). The flow rate was 1 mL / min, the injection volume was 5 μL, and the retention time was 12 minutes. The elution time of nicosulfuron was 5.35 minutes.

[0023] The results are as follows Figure 3 As shown: The study found that tropical Burkholderia N7-2 can achieve a degradation rate of 81.16% for nicosulfuron in GSM medium at 30℃, pH 6.5, initial inoculum OD600=0.15, and nicosulfuron concentration of 50 mg / kg.

[0024] Example 3: Soil application of Burkholderia tropicalis N7-2 alleviates the stress of nicosulfuron on soybean seedling growth. The *U. tropicalis* N7-2 strain, preserved in an ultra-low temperature freezer at -80℃, was activated and cultured in 100 mL of GSM medium at 30℃ and 180 rpm for 2 days. A small amount of the activated culture was streaked onto GSM agar plates for isolation, and cultured at 30℃ for 2 days. Single colonies were picked and cultured in 100 mL of PB medium at 30℃ and purified until OD600 = 1. The culture was centrifuged at 5000 rpm for 10 minutes, resuspended in 100 mL of 0.1% sodium chloride solution, and centrifuged again at 5000 rpm for 10 minutes. This process was repeated twice to obtain a liquid *U. tropicalis* N7-2 bacterial agent with OD600 = 1.

[0025] The potted soil was collected from Kuancheng District, Changchun City, Jilin Province. The soil texture was silty loam, and the physicochemical indicators were: pH 7.01, organic matter content 28.86 mg / kg, available nitrogen content 139.65 mg / kg, available phosphorus content 36.45 mg / kg, and available potassium content 265 mg / kg. After air drying, the soil was sieved through a 10-mesh sieve and then used to prepare a 3 mg / kg nicosulfuron-contaminated soil solution.

[0026] The seed pretreatment process is as follows: Soybean seeds are placed in a 50mL sterile plastic centrifuge tube, soaked in 30mL of 70% ethanol solution and shaken repeatedly for 3 minutes. After discarding the ethanol, 30mL of 1% sodium hypochlorite solution is added, and the tube is thoroughly inverted and mixed for 5 minutes to achieve surface disinfection. Then, the seeds are rinsed 5 times with sterile distilled water.

[0027] This experiment was conducted using a pot method. Each pot was filled with 100g of nicosulfuron-contaminated soil, and 10% (by weight) of liquid Burkholderia tropicalis N7-2 inoculant was added. Four pretreated "Jinong 28" soybean seeds were sown, and the soil moisture content was maintained at 20% during cultivation. The control group received no inoculant. After 21 days of cultivation, plant samples were collected to measure plant height, root length, fresh weight, and the area of ​​the first pair of true leaves. Simultaneously, rhizosphere and non-rhizosphere soil samples were collected, freeze-dried, ground, and sieved before the nicosulfuron residue content was extracted and determined.

[0028] Weigh 5.00 g of soil sample (passed through a 2 mm sieve and thoroughly mixed) into a 50 mL centrifuge tube, add 1.5 mL of ultrapure water, and vortex at 2000 rpm for 30 s. Add 5 mL of acetonitrile extraction buffer containing 2% formic acid (v / v), and vortex for 3 minutes. Then add 2.00 g of anhydrous magnesium sulfate and 0.50 g of sodium chloride, vortex for 1 minute, and centrifuge at 5000 rpm for 5 minutes. Take 1.5 mL of the supernatant and add it to a 2 mL centrifuge tube containing 25 mg PSA and 150 mg anhydrous magnesium sulfate. Vortex at 2000 rpm for 1 minute, then centrifuge at 4000 rpm for 5 minutes. Pass the supernatant through a 0.22 μm organic syringe filter and transfer it to a 2 mL sample vial for analysis. Detect nicosulfuron residue.

[0029] The results are as follows Figure 4 As shown, (a) is a photograph of the plant after 21 days of cultivation; (b) is a photograph of the plant leaves after 21 days of cultivation; (c) is the statistical result of leaf area after 21 days of cultivation; and (d) is the content of nicosulfuron in non-rhizosphere and rhizosphere soils after 21 days of cultivation. Figure 4 The results show that after 21 days of application to nicosulfuron-contaminated soil, the concentration of nicosulfuron in the rhizosphere soil of soybean seedlings decreased significantly by 22.4%, and the area of ​​the first pair of true leaves increased significantly by 72.8%.

[0030] The present invention has been disclosed above with reference to preferred embodiments, but it is not intended to limit the present invention. All technical solutions obtained by adopting equivalent substitutions or equivalent transformations fall within the protection scope of the present invention.

Claims

1. A tropical Burkholderia paraknegaceae N7-2, characterized in that: The tropical burkerholz N7-2 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 35323 and deposit date of July 21, 2025.

2. Application of Tropical Burkholderia holmium N7-2 in alleviating the stress of nicosulfuron in soybean seedlings in soil.

3. The application according to claim 2, characterized in that: The stress of nicosulfuron on soybean seedlings was alleviated by using Ursodeoxycholic acid bacterium N7-2 to degrade nicosulfuron in the soil.

4. A method for alleviating nicosulfuron stress in soybean seedlings, characterized in that... Includes the following steps: S1 was used to pretreat *U. tropicalis* N7-2 to obtain a liquid bacterial agent of *U. tropicalis* N7-2; wherein, *U. tropicalis* N7-2 is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 35323 and accession date of July 21, 2025; S2 soybean seed pretreatment; S3 incorporates the liquid inoculum agent N7-2 of Burkholderia tropicalis into soil contaminated with nicosulfuron. S4 involves planting the pretreated soybean seeds into the soil from step S3.

5. The method for alleviating nicosulfuron stress in soybean seedlings according to claim 4, characterized in that, The specific process of step S1 is as follows: The *U. tropicalis* N7-2 strain, preserved in an ultra-low temperature freezer at -80℃, was activated and cultured in 100 mL of GSM medium at 180 rpm and 30℃ for 2 days. A 5 μL inoculation loop was used to streak the activated culture onto GSM agar plates for isolation, and cultured at 30℃ for 2 days. Single colonies were picked and cultured in 100 mL of PB medium at 180 rpm and 30℃ until OD600 = 1. The culture was centrifuged at 5000 rpm for 10 minutes, resuspended in 100 mL of 0.1% sodium chloride solution, and centrifuged again at 5000 rpm for 10 minutes. This process was repeated twice to obtain a liquid *U. tropicalis* N7-2 bacterial agent with OD600 = 1.

6. The method for alleviating nicosulfuron stress in soybean seedlings according to claim 4, characterized in that, The specific process of step S2 is as follows: Place soybean seeds in a 50mL sterile plastic centrifuge tube, soak them in 30mL of 70% ethanol solution and shake them repeatedly for 3 minutes. After discarding the ethanol, add 30mL of 1% sodium hypochlorite solution, invert and mix thoroughly for 5 minutes, then rinse 5 times with sterile distilled water and sow them in a pot.

Citation Information

Patent Citations

  • Nitrilase mutant and application thereof in catalytic synthesis of 2-chloronicotinic acid

    CN117603950A

  • Consortia of microorganisms for spatial and temporal delivery of nitrogen

    US20230062568A1

  • Use of bacterial strains to solubilize phosphorus for agriculture

    WO2023211979A2