Recombinant escherichia coli with high yield of lactose-N-tetrasaccharide and application of recombinant escherichia coli

By knocking out the gloA and nagB genes and integrating the lgtA2 and SewbdO genes into recombinant E. coli, the problems of glycerol dependence and limited yield in existing technologies have been solved, realizing the efficient fermentation production of lactose-N-tetrasaccharides under glycerol-free conditions, which is suitable for industrial-scale production.

CN121574892APending Publication Date: 2026-02-27CABIO BIOTECH (WUHAN) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511749453.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

When using recombinant Escherichia coli to produce lactose-N-tetrasaccharide in industrial fermentation, glycerol needs to be added as a substrate, and the yield is limited, making it difficult to meet the needs of large-scale production.

Method used

By knocking out the gloA and nagB genes on the E. coli genome and integrating the lgtA2 and SewbdO genes, recombinant E. coli was constructed, achieving high production of lactose-N-tetrasaccharide without glycerol, and further increasing the yield by combining the galE gene.

Benefits of technology

It significantly increased the yield of lactose-N-tetrasaccharide by about 65 times, reduced the residual amount of intermediate product LNTII, and achieved efficient fermentation production under glycerol-free conditions, making it suitable for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
  • Figure SMS_4
    Figure SMS_4
Patent Text Reader

Abstract

The invention discloses recombinant Escherichia coli with high yield of lactose-N-tetrasaccharide and application of the recombinant Escherichia coli, gloA and nagB genes on a genome of the recombinant Escherichia coli are knocked out, an lgtA2 gene and a SewbdO gene are integrated on the genome of the recombinant Escherichia coli, and compared with a recombinant Escherichia coli strain without the gloA and nagB genes, the fermentation production of LNT by the recombinant Escherichia coli strain without the gloA and nagB genes is remarkably improved; especially, after the galE gene is integrated on the genome, the lactose-N-tetrasaccharide can be produced by fermentation in a fermentation culture medium without glycerol, the yield of the lactose-N-tetrasaccharide is high, the intermediate metabolite LNTII is low, and industrial popularization and application are facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation and application technology, and more specifically, relates to a recombinant Escherichia coli that produces high levels of lactose-N-tetrasaccharides and its applications. Background Technology

[0002] Lacto-N-tetraose (LNT) is an important core component of human milk oligosaccharides (HMOs) with various physiological functions and applications. Currently, LNT production methods include chemical synthesis, enzymatic reactions, and microbial fermentation. Among these, microbial fermentation, often using *E. coli* as a host, utilizes metabolic engineering or co-fermentation strategies (such as metabolically engineered strains) to increase LNT yield, making it the most promising method for large-scale production.

[0003] LNT synthesis primarily involves two core pathways: the first uses lactose as a direct substrate, and the second uses glucose, glycerol, or other carbon sources as starting points. To improve and stabilize LNT production in *E. coli*, current recombinant *E. coli* fermentation for LNT production typically employs a mixed carbon source supplemented with glycerol as the substrate. For example, patent CN120060103A describes a method that modifies *E. coli* to overexpress the endogenous transport genes tauB, nikD, and livM, constructing recombinant *E. coli*. This recombinant *E. coli* is then fermented using a glycerol-based substrate in a fermentation medium with added lactose to improve LNT biosynthesis efficiency.

[0004] Patent CN118931810A describes the construction of recombinant *E. coli* by combining the genes SPase, galT, galE, and Cvβ3GalT. While this method allows for the production of LNTs without the addition of glycerol and using sucrose as a substrate, the recombinant *E. coli* requires co-fermentation with yeast to increase LNT production. Furthermore, the current industrial-scale production capacity of LNTs from recombinant *E. coli* remains limited. Therefore, researching a recombinant *E. coli* strain that can produce high LNTs without the need for glycerol during industrial fermentation would be more beneficial for large-scale industrial production of LNTs. Summary of the Invention

[0005] To address the aforementioned deficiencies or improvement needs of existing technologies, this invention provides a recombinant *E. coli* strain capable of high-yield lactose-N-tetrasaccharide production without glycerol, and its applications. The key point is the discovery that constructing recombinant *E. coli* using a combination of the *lgtA2* and *SewbdO* genes significantly increases LNT production (approximately 65-fold increase) compared to knocking out other genes in the *E. coli* genome or knocking out *gloA* or *nagB* individually. Furthermore, when using this strain for LNT production, high LNT production is achieved without the need for glycerol in the fermentation medium, and LNTII residue is minimal, thus solving the technical problem of limited capacity in the industrial-scale fermentation production of LNT using existing recombinant *E. coli* strains.

[0006] To achieve the above objectives, according to one aspect of the present invention, a recombinant Escherichia coli that produces high levels of lactose-N-tetrasaccharides is provided, wherein the recombinant Escherichia coli has the gloA and nagB genes knocked out from its genome and has integrated the lgtA2 and SewbdO genes into its genome. Preferably, the lgtA2 gene encodes β-1,3-acetylglucosamine transferase, and its encoded amino acid sequence is shown in SEQ ID NO:1; Preferably, the SewbdO gene encodes β-1,3-galactosyltransferase, and its encoded amino acid sequence is shown in SEQ ID NO:3.

[0007] Preferably, the recombinant Escherichia coli has the nucleotide sequence of the lgtA2 gene as shown in SEQ ID NO:2, and / or the nucleotide sequence of the SewbdO gene as shown in SEQ ID NO:4.

[0008] Preferably, the recombinant Escherichia coli, wherein the integrated lgtA2 gene and the target sequence of the SewbdO gene are synthesized according to the following: The lgtA2 gene and the SewbdO gene were synthesized into a nucleotide sequence in the following order: transposon element, first promoter, first operon, ribosome binding site, tag, lgtA2 gene, second promoter, second operon, ribosome binding site, SewbdO gene, and transposon element. Preferably, the target sequences of the integrated lgtA2 gene and the SewbdO gene are as shown in SEQ ID NO:5; the selection of the insertion site follows the principle of having no effect on LNT synthesis, or inserting into a gene that may reduce LNT production.

[0009] Preferably, the recombinant Escherichia coli further integrates the galE gene; the galE gene encodes UDP-glucose-4-isomerase, the encoded amino acid sequence of which is shown in SEQ ID NO:6, which can produce high levels of lactose-N-tetrasaccharide under glycerol-free culture conditions.

[0010] Preferably, the recombinant Escherichia coli has the nucleotide sequence of the galE gene as shown in SEQ ID NO:7; Preferably, the target sequence of the integrated galE gene in the recombinant Escherichia coli is synthesized according to the following method: The galE gene was synthesized into a target sequence in the order of promoter, operator, RBS, galE gene, and terminator.

[0011] Preferably, the target sequence of the integrated galE gene in the recombinant Escherichia coli is shown in SEQ ID NO:8.

[0012] Preferably, the recombinant Escherichia coli further includes one or more genes from the genome, namely wecB, lacZ, fucIK, wcaJ, and ugd, which have been knocked out.

[0013] Preferably, the recombinant Escherichia coli is constructed according to the following method: Using *Escherichia coli* BL21star(DE3) as the recipient strain, the wecB, nagB, gloA, and ugd genes were knocked out of the recipient strain's genome, and the galE gene was integrated; simultaneously, the lgtA2 gene and SewbdO were integrated into the recipient strain; preferably, the lacZ, fucIK, and wcaJ genes were also knocked out of the recipient strain's genome. The knockout and integration techniques can be chosen from those familiar to those skilled in the art, such as mainstream gene editing techniques like λ-Red homologous recombination.

[0014] In addition, the present invention also provides the application of recombinant Escherichia coli as described in the present invention in the preparation of lactose-N-tetrasaccharide by microbial fermentation.

[0015] Preferably, the application is for the industrial fermentation production of lactose-N-tetrasaccharide without the need for glycerol as a substrate. The recombinant E. coli has knocked out the gloA and nagB genes in its genome and integrated the lgtA2 gene, the SewbdO gene, and the galE gene. Preferably, the target sequences of the integrated lgtA2 gene and the SewbdO gene are as shown in SEQ ID NO:5, and the target sequence of the integrated galE gene is as shown in SEQ ID NO:8.

[0016] Preferably, in the application, glycerol is used as a substrate for fermentation to produce lactose-N-tetrasaccharide, wherein the recombinant Escherichia coli has knocked out the gloA and nagB genes in its genome and integrated the lgtA2 and SewbdO genes, and preferably the target sequences of the integrated lgtA2 and SewbdO genes are shown in SEQ ID NO:5.

[0017] In summary, compared with the prior art, the above-described technical solutions conceived by this invention can achieve the following beneficial effects: The recombinant *E. coli* provided by this invention knocks out the gloA and nagB genes in its genome and integrates the lgtA2 and SewbdO genes into its genome. Compared with recombinant *E. coli* whose genome knocks out one or more of the wecB, lacZ, fucIK, wcaJ, and ugd genes, or knocks out gloA or nagB genes alone, knocking out gloA and nagB genes in its genome can significantly promote the fermentation of lactose-N-tetrasaccharide (LNT) by recombinant *E. coli*, with less LNTII residue, achieving metabolic balance in the LNT synthesis pathway, high substrate utilization, and fewer product impurities. Furthermore, recombinant *E. coli* with the galE gene integrated into its genome can produce lactose-N-tetrasaccharide in large-scale fermentation under glycerol-free culture conditions, with high lactose-N-tetrasaccharide yield and less residual intermediate product LNTII, which is beneficial for industrial promotion and application. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0019] This invention uses the lgtA2-SewbdO combined gene as the target gene. By comparing the effects of knocking out different genes (wecB, lacZ, fucIK, wcaJ, ugd, gloA, and nagB genes) in the *E. coli* genome on the LNT production capacity of the strain, it was unexpectedly discovered that compared with recombinant *E. coli* with the knockout of other genes or the knockout of gloA or nagB genes alone, recombinant *E. coli* with the knockout of gloA and nagB genes significantly increased LNT production (approximately 65-fold increase), while reducing LNTII residue. Furthermore, it achieved high LNT production under glycerol-free culture conditions. In particular, recombinant *E. coli* integrating the lgtA2-SewbdO combined gene and the galE gene (with the gloA and nagB genes knocked out) showed superior LNT production capacity without glycerol as a substrate. Specifically, the recombinant strain w10ΔwecBΔugdΔgloAΔnagB[galE] + ,lgtA2 + [Sewbdo⁺] (w10 represents BL21star(DE3)ΔlacZΔfucIKΔwcaJ) The average yield of LNT produced using fermentation medium without added glycerol can reach 118.27 g / L.

[0020] Based on this, the present invention provides a recombinant *E. coli* strain that produces high levels of lactose-N-tetrasaccharides. This recombinant *E. coli* strain has the gloA and nagB genes knocked out from its genome, and the lgtA2 and SewbdO genes are integrated into its genome, enabling it to successfully express lgtA2 protein (β-1,3-acetylglucosamine transferase) and SewbdO protein (β-1,3-galactosyltransferase). The selection of the insertion sites containing the lgtA2 and SewbdO genes follows the principle of not affecting LNT synthesis, or inserting into genes that may reduce LNT production, such as inserting into gene sites in the host genome that do not contribute to LNT synthesis (e.g., non-essential genes or metabolic bypass genes), or selectively inserting into gene sites whose expression would compete for precursors / inhibit LNT production pathways. Several such techniques have been disclosed in the prior art. For example, the target sequence insertion sites containing the lgtA2 gene and the SewbdO gene can be yjip, aggp, ushA, wcaC, otsA, lacA, caiB, intQ, hlyE, and setA.

[0021] The lgtA2 gene encodes β-1,3-acetylglucosamine transferase, which catalyzes the transport of lactose and intracellular UDP-G1cNAc into the cell to generate lactose-N-triose II (LNTriII). The amino acid sequence encoded by the lgtA2 gene is shown in SEQ ID NO:1, and in some cases, the nucleotide sequence of the lgtA2 gene is shown in SEQ ID NO:2. The nucleotide sequence described in this invention includes sequences in which the stop codon "TAA" in the nucleotide sequence of this gene is replaced with other stop codons such as "TAG" or "TGA".

[0022] The SewbdO gene encodes β-1,3-galactosyltransferase, which catalyzes the formation of LNT from LNTriII and UDP-Gal. The amino acid sequence encoded by the SewbdO gene is shown in SEQ ID NO:3. In some embodiments, the nucleotide sequence of the SewbdO gene is shown in SEQ ID NO:4.

[0023] The lgtA2 gene and the SewbdO gene are synthesized into a target sequence in the following order: transposon element-first promoter-first operon-RBS-tag-lgtA2 gene-second promoter-second operon-RBS-SewbdO gene-transposon element. For example, in some embodiments, the lgtA2 gene and the SewbdO gene are synthesized into a target sequence as shown in SEQ ID NO:5 in the following order: (transposon element-T7 promoter-lactose operon-RBS-His tag), lgtA2 gene, (T7 promoter-lactose operon-RBS), SewbdO gene, transposon element. Except for the elements and transposon elements labeled (transposon element-T7 promoter-lactose operon-RBS-His tag) and (T7 promoter-lactose operon-RBS), the meaningless sequences between other elements are MSF (multiple cloning site sequences). In one specific implementation, the target sequences of the lgtA2 and SewbdO genes inserted into Escherichia coli BL21star(DE3) are shown in SEQ ID NO:5.

[0024] Furthermore, preferably, the recombinant *E. coli* also integrates the galE gene into its genome; the galE gene encodes UDP-glucose-4-isomerase, which can catalyze the production of UDP-Glc from UDP-Gal. The amino acid sequence encoded by the galE gene is shown in SEQ ID NO: 6, which can produce high levels of lactose-N-tetrasaccharide under glycerol-free culture conditions. In some embodiments, the nucleotide sequence of the galE gene is shown in SEQ ID NO: 7; the galE gene is synthesized into a target sequence in the order of promoter, operon, ribosome binding site (RBS), galE gene, and terminator. In some embodiments, the galE gene is synthesized into a target sequence in the order of (T7 promoter-lactose operon-RBS), galE gene, and T7 terminator, as shown in SEQ ID NO: 8, wherein the meaningless sequence between elements is the MSF (multiple cloning site sequence). In a specific embodiment, for ease of operation, the nagB can be knocked out in *E. coli* BL21star(DE3) while simultaneously integrating the target sequence of the galE gene shown in SEQ ID NO: 8. This recombinant Escherichia coli can produce high levels of LNTs without the need for glycerol as a substrate, making it more suitable for industrial-scale production.

[0025] The nagB gene encodes glucosamine-6-phosphate deaminase, and its knockout prevents the degradation of fructose-6-phosphate into glucosamine-6-phosphate. In some embodiments, the nucleotide sequence of the knocked-out nagB gene is shown in SEQ ID NO:9.

[0026] The gloA gene encodes lactylglutathione lyase, and knocking it out can prevent the degradation of glyceraldehyde 3-phosphate into D-lactic acid. In some embodiments, the nucleotide sequence of the knocked-out gloA gene is shown in SEQ ID NO:10.

[0027] The recombinant *E. coli* further includes the knockout of one or more genes from the genome, namely the wecB gene, lacZ gene, fucIK gene, wcaJ gene, and ugd gene. In some embodiments, the recombinant *E. coli* is constructed according to the following method: Using Escherichia coli BL21star(DE3) strain as the recipient strain, the wecB, nagB, gloA, and ugd genes in the recipient strain genome were knocked out, and the galE gene was integrated; at the same time, the lgtA2 gene and the SewbdO gene were integrated into the recipient strain; preferably, the lacZ gene, fucIK gene, and wcaJ gene in the recipient strain genome were also knocked out.

[0028] For example, using Escherichia coli BL21star(DE3) as the recipient strain, the wecB, nagB, gloA, ugd, lacZ, fucIK and wcaJ genes in the recipient strain genome were knocked out using the λ-Red homologous recombination system; the galE gene was integrated into the genome using the λ-Red homologous recombination system, and the lgtA2 and SewbdO genes were inserted into the recipient strain genome.

[0029] In some embodiments, the recombinant Escherichia coli is obtained by modifying the E. coli BL21star(DE3)△lacZ△fucIK△wcaJ strain. The E. coli BL21star(DE3)△lacZ△fucIK△wcaJ strain is a modified strain obtained by knocking out the lacZ, fucIK and wcaJ genes in the genome of E. coli BL21star(DE3) as the recipient strain.

[0030] When referring to amino acid sequences and nucleotide sequences (e.g., SEQ ID NO: 1-12) in this document, it refers to amino acid sequences or nucleotide sequences that have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence or nucleotide sequence.

[0031] In addition, the present invention also provides the application of recombinant Escherichia coli as described in the present invention in the preparation of lactose-N-tetrasaccharide by microbial fermentation.

[0032] The application uses recombinant Escherichia coli as described in this invention as the seed culture, and ferments it in a fermentation medium with or without added glycerol to produce lactose-N-tetrasaccharide.

[0033] In some applications, for the industrial fermentation production of lactose-N-tetrasaccharide without the need for glycerol as a substrate, the recombinant *E. coli* has the nagB gene (SEQ ID NO: 9) and gloA gene (SEQ ID NO: 10) knocked out from its genome, and integrates the lgtA2 gene, SewbdO gene, and galE gene into its genome; preferably, the target sequences of the integrated lgtA2 gene and SewbdO gene are shown in SEQ ID NO: 5, and the target sequence of the integrated galE gene is shown in SEQ ID NO: 8. In some specific embodiments, the integration sites are yjip and nagB, respectively.

[0034] In some applications, lactose-N-tetrasaccharide is produced by fermentation in a glycerol-added fermentation medium. The recombinant E. coli has the nagB gene (SEQ ID NO: 9) and gloA gene (SEQ ID NO: 10) knocked out from its genome and integrates the lgtA2 gene and the SewbdO gene, but does not integrate the galE gene. The target sequences of the integrated lgtA2 gene and SewbdO gene are preferably shown in SEQ ID NO: 5.

[0035] The recombinant Escherichia coli further includes the knockout of one or more genes from the genome, namely wecB, lacZ, fucIK, wcaJ, and ugd; preferably, the knockout genes include wecB, lacZ, fucIK, wcaJ, and ugd.

[0036] The following are examples. The recipient strains in the following examples are selected from Escherichia coli; the Escherichia coli can be Escherichia coli BL21(DE3) or Escherichia coli BL21star(DE3).

[0037] Example 1: Construction of recombinant Escherichia coli (w10△wecB△ugd△gloA△nagB[galE) gene knockout) + ,lgtA2 + ,Sewbdo⁺]) 1.1 Modified chassis strains Lacto-N-tetraose (LNT) was used in this embodiment. The *Escherichia coli* BL21star(DE3) strain was used as the recipient strain for modification. Specifically, the wecB gene (wecB gene sequence is the same as CN119736222A), lacZ gene, fucIK gene, wcaJ gene, ugd gene (SEQ ID NO: 11), gloA gene, and nagB gene were knocked out of *E. coli* BL21star(DE3). Referring to patent CN119736222A, the lacZ gene, fucIK gene, and wcaJ gene were knocked out of the *E. coli* genome (lacZ, fucIK, and wcaJ gene sequences are the same as CN119736222A) to obtain strain BL21star(DE3)ΔlacZΔfucIKΔwcaJ, hereinafter referred to as w10. The wecB gene was then knocked out of w10, as detailed below: (1) Using the genomic DNA of the recipient *E. coli* as a template, and using wecB-up-F / R and wecB-down-F / R as primers respectively ( PCR amplification was performed to obtain the upstream and downstream homologous fragments wecB-up and wecB-down of the wecB gene, and the amplification products were detected by agarose gel electrophoresis.

[0038] (2) The PCR products from (1) were recovered using a DNA gel purification and recovery kit (Tiangen, catalog number: DP209).

[0039] (3) Overlap extension PCR was used to ligate the upstream and downstream homologous fragments wecB-up and wecB-down of the wecB gene to obtain the target fragment wecB-homo containing the homologous arm of the target gene.

[0040] (4) The wecB-homo fragment and gene editing plasmid were transformed into E. coli BL21star(DE3)△lacZ△fucIK△wcaJ competent cells by electroporation. Positive clones were selected, and the wecB knockout strains were screened using colony PCR identification primers wecB-yz-F / R.

[0041] Table 1 Primer sequences involved in knocking out the wecB gene Similarly, other genes were knocked out using the same method as the wecB gene knockout. This resulted in the construction of chassis strains with knocked-out wecB, lacZ, fucIK, wcaJ, ugd, gloA, and nagB genes. The knocked-out nagB gene is shown in SEQ ID NO:9, the knocked-out gloA gene in SEQ ID NO:10, and the knocked-out ugd gene in SEQ ID NO:11. The specific primer pairs and DNA sequence information used are as follows: ugd-up-F:CCTGATCCAGGCACAGCGTG; ugd-up-R: ATGACATCGGCCATTCAGCATAGCAACGCGTGAC; ugd-down-F:CTATGCTGAATGGCCGATGTCATTATTTCCAAC; ugd-down-R:TCGGTGCAGCCTGACCATAG; ugd-yz-F: TCGCCGATGACTACCAGCAG; ugd-yz-R:CGTCCCAGAGCAATGTTGTCC; gloA-up-F:GAATGAAGAAGCCGATGCACTG; gloA-up-R: GACCGCGACCGCGATGGAGCGTTGCAAATCGCC; gloA-down-F: CAACGCTCCATCGCGGTCGCGGTCTGGGCAACTAATC; gloA-down-R: GGCGCGGTTACAGCCGCTCG; gloA-yz-F: CACTCTGCTCACGGTTATTTGC; gloA-yz-R:CTGGGTGCTGTCGAAGTCCATG; nagB-up-F:CCTGGGCAATAAACGCAAC; nagB-up-R:gccgtgtacaTGAACGCATTGATACGATTG; nagB-down-F: gaactatatGCATCCAAAAGCGATCATGG; nagB-down-R: GCCTGATTCGGATGTTTTGC; nagB-yz-F: CGGACCAACGGTTATAGGCT; nagB-yz-R: GCCAGGGTCACTTTGGTAATG; The nucleotide sequence of the gene galE is shown in SEQ ID NO:7, and the primers used are as follows: galE-F: AATGCGTTCAtgtacacggccgcataatcg; galE-R:CTTTTGGATGCatatagttcctcctttcagc; The knocked-out nagB gene encodes glucosamine-6-phosphate deaminase. Knocking out nagB prevents the degradation of fructose-6-phosphate into glucosamine-6-phosphate. Simultaneously, during the knockout of the nagB gene, the galE gene is integrated. In the third step mentioned above, the nagB-up, galE, and nagB-down fragments are linked together to form nagB-galE-homo.

[0042] The galE gene encodes UDP-glucose-4-isomerase, and its encoded amino acid sequence is shown in SEQ ID NO:6. The nucleotide sequence of the galE gene integrated during the knockout of the nagB gene is shown in SEQ ID NO:8.

[0043] 1.2 Insertion of exogenous target genes lgtA2 and SewbdO The lgtA2 and SewbdO genes were inserted into the genome of the modified strain obtained in step 1.1. The lgtA2 gene encodes β-1,3-acetylglucosamine transferase, and its encoded amino acid sequence is shown in SEQ ID NO:1; the SewbdO gene encodes β-1,3-galactosyltransferase, and its encoded amino acid sequence is shown in SEQ ID NO:3. In this embodiment, the lgtA2-SewbdO gene was integrated into the host bacteria obtained in step 1.1.

[0044] Finally, the following E. coli BL21star(DE3) was obtained: △lacZ△fucIK△wcaJ△wecB△ugd△gloA△nagB[galE + ,lgtA2 + ,Sewbdo⁺] strain, abbreviated as w10ΔwecBΔugdΔgloAΔnagB[galE + ,lgtA2 + [,Sewbdo⁺]. The inserted nucleotide sequence containing the lgtA2 gene and the SewbdO gene is shown in SEQ ID NO:5, and the insertion site is yjiP.

[0045] Example 2: Construction of recombinant Escherichia coli with gloA and nagB genes not knocked out This embodiment further modifies and constructs recombinant Escherichia coli based on the BL21star(DE3)ΔlacZΔfucIKΔwcaJ (denoted as w10). The lgtA2-SewbdO gene is inserted into the same site in w10. Referring to Example 1, the recombinant strain w10[lgtA2] is finally obtained. + ,SewbdO + ].

[0046] Example 3: Construction of recombinant Escherichia coli with gloA and nagB genes not knocked out This embodiment further modifies and constructs recombinant Escherichia coli based on the BL21star(DE3)ΔlacZΔfucIKΔwcaJ strain. The wecB gene in w10 is knocked out, and the lgtA2-SewbdO gene is inserted as in Example 1, ultimately obtaining the recombinant strain w10ΔwecB[lgtA2]. + ,SewbdO + ].

[0047] Example 4: Construction of recombinant Escherichia coli with gloA and nagB genes not knocked out This embodiment further modifies and constructs recombinant Escherichia coli based on the BL21star(DE3)ΔlacZΔfucIKΔwcaJ strain. The wecB and ugd genes in w10 are knocked out, and the lgtA2-SewbdO gene is inserted as in Example 1, ultimately obtaining the recombinant strain w10ΔwecBΔugd[lgtA2]. + ,SewbdO + ].

[0048] Example 5: Construction of recombinant Escherichia coli with the nagB gene not knocked out This embodiment further modifies and constructs recombinant Escherichia coli based on the BL21star(DE3)ΔlacZΔfucIKΔwcaJ strain. The wecB, ugd, and gloA genes in w10 are knocked out, and the lgtA2-SewbdO gene is inserted as in Example 1, ultimately obtaining the recombinant strain w10ΔwecBΔugdΔgloA[lgtA2]. + ,SewbdO + ].

[0049] Example 6: Construction of recombinant Escherichia coli with gloA gene not knocked out This embodiment further modifies and constructs recombinant Escherichia coli based on the BL21star(DE3)ΔlacZΔfucIKΔwcaJ strain (w10). The wecB, ugd, and nagB genes in w10 are knocked out, and the lgtA2-SewbdO gene is inserted as in Example 1, ultimately obtaining the recombinant strain w10ΔwecBΔugdΔnagB[lgtA2] + ,SewbdO + ].

[0050] Example 7: Construction of recombinant Escherichia coli with gloA and nagB genes knocked out This embodiment further modifies and constructs recombinant *E. coli* based on the BL21star(DE3)ΔlacZΔfucIKΔwcaJ strain. The wecB, ugd, gloA, and nagB genes in w10 are knocked out. Following the procedure in Example 1, the lgtA2-SewbdO gene is inserted, ultimately obtaining the recombinant strain w10ΔwecBΔugdΔgloAΔnagB[lgtA2] + ,SewbdO + ].

[0051] Example 8: Construction of recombinant Escherichia coli with gloA and nagB genes knocked out The *E. coli* BL21star(DE3) constructed in Example 1 was △lacZ△fucIK△wcaJ△wecB△ugd△gloA△nagB[galE + ,lgtA2 + Based on the strain [Sewbdo⁺], further modifications were made, and the lacY gene (SEQ ID NO: 12) was inserted into the fourth IS186 sequence to construct the recombinant strain w10ΔwecBΔugdΔgloAΔnagB[galE] + ,lgtA2 + ,Sewbdo⁺,lacY⁺).

[0052] Example 9: Construction of recombinant Escherichia coli with gloA and nagB genes knocked out Using *Escherichia coli* BL21star(DE3) as the recipient strain, the genes lacZ, fucIK, wcaJ, wecB, nagB, gloA, and ugd were knocked out from the recipient strain's genome. The lacY gene (SEQ ID NO: 12) was integrated into the genome at the gloA position using the λ-Red homologous recombination system. Following Example 1, the lgtA2-SewbdO gene was inserted, thereby constructing recombinant *Escherichia coli* w10ΔwecBΔugdΔnagBΔgloA[lgtA2] + ,Sewbdo⁺,lacY⁺).

[0053] Example 10 Following the construction strategy in the previous patent CN119736222A, Escherichia coli BL21star(DE3) strain was used as the recipient strain. The setA gene, lacZ gene, fucIK gene, and wcaJ gene were knocked out in the chassis strain (the knockout gene sequences are consistent with CN119736222A). The pSPIN-N32-lgtA2-SewbdO-vag integration vector (lgtA2 gene sequence and SewbdO gene sequence are the same as in Example 1) and the pET-lacY-galE expression vector (same as CN119736222A) were constructed. The recombinant strain obtained by the final construction contained the pSPIN-N32-lgtA2-SewbdO-vag integration vector and the pET-lacY-galE expression vector, and the setA gene, lacZ gene, fucIK gene, and wcaJ gene were knocked out in the chassis strain.

[0054] Example 11 Using Escherichia coli BL21star(DE3) strain as the recipient strain, the lacZ, fucIK, wcaJ, wecB, ushA, setA, aggp, and pgaCD genes in the recipient strain genome were knocked out; the lgtA2-SewbdO gene was inserted as in Example 1, thereby constructing recombinant Escherichia coli LNTⅡ-1.

[0055] Example 12: Comparison of the LNT production capacity of different recombinant Escherichia coli strains This embodiment compares the LNT-producing ability of different recombinant Escherichia coli strains constructed in Examples 1 to 9, as detailed below: (1) The recombinant Escherichia coli strain that produces lactose-N-tetrasaccharide was inoculated into 5 mL of LB medium for activation culture to obtain seed culture.

[0056] (2) The seed solution (OD) obtained in step (1) 600 =1), inoculate 2% into 35mL of fermentation medium (4g / L diammonium hydrogen phosphate, 13.5g / L KH2PO4, 1.7g / L citric acid, 4g / L yeast extract, 20g / L glycerol, 1.4g / L MgSO4 heptahydrate, 8g / L lactose), and the initial culture temperature is 37℃ and the rotation speed is 250rpm.

[0057] (3) The growth of bacterial cells in the culture medium to the OD level was detected using an ultraviolet spectrophotometer. 600 When the LNT concentration is 0.6-0.8, add 0.2% IPTG, set the temperature to 30℃, and induce culture for 60 h. Take the supernatant after centrifuging the fermentation broth at 12000 rpm, and determine the LNT content in the supernatant using high-performance liquid chromatography (HPLC). Specific HPLC detection conditions are as follows: The supernatant was analyzed using a UltiMate 3000 HPLC system and an Aminex RHPX-87H Column 300 × 7.8 mm column. Mobile phase: 0.5 mL H₂SO₄; column temperature: 60 °C; flow rate: 0.5 mL / min; injection volume: 10 μL. The LNT detection results after 60 h of fermentation are shown in the table below: Table 2. LNT yields (g / L) of different recombinant Escherichia coli strains constructed in Examples 1-9 In the table, "w10" represents E. coli BL21star(DE3)△lacZ△fucIK△wcaJ.

[0058] As shown in Table 2 above, the LNT production capacity of different recombinant *E. coli* strains differed significantly under the same fermentation medium with added glycerol and fermentation conditions. Among these, the insertion of the same target gene (lgtA2-SewbdO), knocking out one or more genes from the *E. coli* genome, such as wecB, lacZ, fucIK, wcaJ, and ugd, had no significant effect on LNT production. Knocking out the gloA gene, however, showed a decreasing trend in LNT synthesis. Surprisingly, we found that knocking out both gloA and nagB genes significantly increased LNT production in recombinant *E. coli*, with the LNT production increasing compared to knocking out gloA alone (w10ΔwecBΔugdΔgloA[lgtA2]). + ,SewbdO + [Strain, with gloA and nagB genes knocked out w10ΔwecBΔugdΔgloAΔnagB[lgtA2]] + ,SewbdO + The strain produced approximately 65 times more LNTs; compared to the strain with the nagB gene knocked out alone, w10ΔwecBΔugdΔnagB[lgtA2] produced approximately 65 times more LNTs. + ,SewbdO + The knockout of the gloA and nagB genes increased the amount of LNTs by approximately three times. This demonstrates that knocking out the gloA and nagB genes synergistically promotes LNT synthesis in recombinant strains.

[0059] This invention uses *Escherichia coli* as the recipient strain. After knocking out the gloA and nagB genes in the recipient strain's genome, one or more exogenous target genes are integrated into its genome to promote LNT synthesis. It was found that the more target genes integrated into the recombinant strain's genome, the lower the amount of LNT produced by fermentation. Among the recombinant strains with knocked-out gloA and nagB genes, the LNT production from highest to lowest was: insertion of lgtA2-SewbdO gene > insertion of lgtA2-SewbdO and galE genes > insertion of lgtA2-SewbdO, galE, and lacY genes. The more target genes inserted, the lower the LNT production, which is speculated to be due to excessive target gene manipulation causing a metabolic burden on the strain.

[0060] Example 13 verifies the ability of recombinant E. coli with knockout of gloA and nagB genes to produce LNTs. To verify the LNT-producing ability of the recombinant E. coli with knockout of gloA and nagB genes screened in Example 12, this example focuses on examining the recombinant strain w10ΔwecBΔugdΔgloAΔnagB[lgtA2 + ,SewbdO + ] and w10ΔwecBΔugdΔgloAΔnagB[galE+ ,lgtA2 + [Sewbdo⁺] The ability of LNT production under culture conditions with and without glycerol addition, and under scale-up fermentation conditions, was verified using a 50L reactor, as detailed below: (1) The lactose-N-tetrasaccharide producing strain obtained above was inoculated into 5 mL of LB medium for activation culture for 16 h to obtain seed liquid (16 h of culture, OD600 is 1.5~2).

[0061] (2) Inoculate the seed solution into 200 mL of LB medium at an inoculation rate of 1% and incubate at 37°C and 250 rpm for 5-6 h to obtain secondary seed solution.

[0062] (3) The secondary seed liquid obtained in step 1 was transferred into a 50L fermenter containing fermentation medium at an inoculation rate of 1%. The initial culture temperature was 37℃, the rotation speed was 250rpm, the aeration rate was 35NL / min, the tank pressure was 0.06MPa, and the dissolved oxygen content was controlled to be greater than 2mg / L.

[0063] (4) The fermentation medium formula includes: 150g peptone, 50g yeast extract, 100g (NH4)2SO4, 230g K2HPO4, 205g KH2PO4, 7.5g citric acid, 5mL defoamer, 250g glucose, 50g MgSO4·7H2O, 0.5g anhydrous CaCl2, 25mL 1000× vitamin B1, and H2O to a final volume of 20L; adjust the pH to 6.8.

[0064] (5) When the initial glucose in the fermentation medium is completely depleted, glucose is added to the fermenter to control the glucose content at 1% (for the glycerol supplementation scheme, the glycerol content is controlled at 3%), and the culture temperature is 30℃.

[0065] (6) Four hours after adding carbon source (18 hours after fermentation begins), add 20% lactose hydrolysate to make the final concentration of D-galactose in the fermentation system 0.057 g / L. Then, add lactose and monitor the lactose content and consumption. The amount of added sugar is to control the lactose content in the fermentation broth at 10 g / L. Fermentation ends after 90 hours, and the LNT yield and LNTII residue (LNTII is equivalent to an impurity) in the fermentation broth are detected. Three batches were repeated, and the test results are shown in Table 3 below. The preparation method of the 20% lactose hydrolysate used in the examples is as follows: (1) Prepare a 20% lactose aqueous solution: Weigh 20g of lactose, dilute to 100mL with distilled water, and adjust the pH to 4.5 with dilute hydrochloric acid (2mol / L); (2) Enzymatic hydrolysis: Weigh 0.24g of lactase, add it to a 20% lactose aqueous solution, dissolve it, and heat and stir (55℃, 16h) to completely hydrolyze the lactose into glucose and D-galactose; (3) Sterilization and enzyme inactivation: After the enzymatic hydrolysis in step (2), the hydrolysate is subjected to high temperature treatment (115℃, 20min).

[0066] Table 3 shows the production of LNTs under fermentation conditions without the addition of glycerol (unit: g / L). Table 4 shows the production of LNTs using fermentation conditions with added glycerol (unit: g / L). LNT was produced under fermentation conditions without the addition of glycerol. The results showed that the recombinant strain w10ΔwecBΔugdΔgloAΔnagB[galE] with the gloA and nagB genes knocked out was the most effective. + ,lgtA2 + ,Sewbdo⁺]andw10ΔwecBΔugdΔgloAΔnagB[lgtA2 + ,SewbdO + All strains were able to produce high levels of LNTs with low levels of LNTII, indicating that the produced LNTs contained few impurities and were of high purity; especially the recombinant strain w10ΔwecBΔugdΔgloAΔnagB[galE + ,lgtA2 + The average yield of LNT produced using fermentation medium without added glycerol (118.27 g / L) was higher than that of w10ΔwecBΔugdΔgloAΔnagB[lgtA2 + ,SewbdO + (Average: 93.5 g / L).

[0067] In addition, the recombinant strains constructed in Examples 9-11 were scaled up in a 50L fermenter to produce LNT under the same fermentation conditions (without glycerol supplementation). The results showed that the average LNT concentration of the recombinant strain constructed in Example 10 was 58.3 g / L in a 50L fermenter; the average LNT concentration of the recombinant E. coli LNTⅡ-150L fermenter constructed in Example 11 was 65.5 g / L. The average LNT concentration of the recombinant E. coli LNTⅡ-250L fermenter constructed in Example 9 was 74.4 g / L. This indicates that the LNT production capacity of recombinant E. coli with knocked-out gloA and nagB genes was still significantly higher than that of recombinant strains without knocked-out gloA and nagB genes, further confirming that knocking out gloA and nagB genes is beneficial for improving the LNT production capacity of recombinant strains compared to knocking out other genes in the E. coli genome.

[0068] As is well known to those skilled in the art, using glycerol as a carbon source for recombinant bacteria is more conducive to the metabolic balance of the strain than using direct glucose as a feed, that is, the substrate and intermediate product residues are relatively lower, as shown in Table 4. However, glycerol is relatively expensive, which is not conducive to industrial application. The present invention can achieve high production of LNT and low residue of LNTII without glycerol. This indicates that by using Escherichia coli as the recipient strain and knocking out the gloA and nagB genes on the recipient strain genome, the lgtA2 gene, SewbdO gene and galE gene are preferentially integrated into its genome to construct a recombinant strain. The recombinant strain has a high balance of its own LNT synthesis pathway and can stably produce high LNT using fermentation medium without glycerol.

[0069] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A recombinant *Escherichia coli* strain that produces high levels of lactose-N-tetrasaccharides, characterized in that... The recombinant Escherichia coli had the gloA and nagB genes knocked out from its genome, and the lgtA2 and SewbdO genes were integrated into its genome. Preferably, the lgtA2 gene encodes β-1,3-acetylglucosamine transferase, and its encoded amino acid sequence is shown in SEQ ID NO:1; the SewbdO gene encodes β-1,3-galactosyltransferase, and its encoded amino acid sequence is shown in SEQ ID NO:

3.

2. The recombinant Escherichia coli as described in claim 1, characterized in that, The nucleotide sequence of the lgtA2 gene is shown in SEQ ID NO:2, and / or the nucleotide sequence of the SewbdO gene is shown in SEQ ID NO:

4.

3. The recombinant Escherichia coli as described in claim 2, characterized in that, The integrated lgtA2 gene and the target sequence of the SewbdO gene were synthesized as follows: The lgtA2 gene and the SewbdO gene were synthesized into a nucleotide sequence in the following order: transposon element, first promoter, first operator gene, ribosome binding site, tag, lgtA2 gene, second promoter, second operator gene, ribosome binding site, SewbdO gene, and transposon element. Preferably, the target sequences of the integrated lgtA2 gene and the SewbdO gene are as shown in SEQ ID NO:

5.

4. The recombinant Escherichia coli as described in claim 3, characterized in that, The recombinant Escherichia coli also integrates the galE gene; the galE gene encodes UDP-glucose-4-isomerase, and its encoded amino acid sequence is shown in SEQ ID NO:

6.

5. The recombinant Escherichia coli as described in claim 4, characterized in that, The nucleotide sequence of the galE gene is shown in SEQ ID NO:

7.

6. The recombinant Escherichia coli as described in claim 5, characterized in that, The nucleotide sequence of the integrated galE gene was synthesized as follows: The galE gene was synthesized into a nucleotide sequence in the order of promoter, operator, ribosome binding site, galE gene, and terminator. Preferably, the nucleotide sequence of the integrated galE gene is shown in SEQ ID NO:

8.

7. The recombinant Escherichia coli as described in claim 6, characterized in that, The recombinant E. coli also had one or more of the following genes knocked out from the genome: wecB, lacZ, fucIK, wcaJ, and ugd.

8. The recombinant Escherichia coli as described in claim 7, characterized in that, The recombinant Escherichia coli was constructed using the following method: Using Escherichia coli BL21star(DE3) strain as the recipient strain, the wecB, nagB, gloA, and ugd genes were knocked out in the recipient strain genome, and the galE gene was integrated; at the same time, the lgtA2 gene and the SewbdO gene were integrated into the recipient strain. The preferred strain also had the lacZ, fucIK, and wcaJ genes knocked out in its genome.

9. The use of the recombinant Escherichia coli as described in any one of claims 1 to 8 in the preparation of lactose-N-tetrasaccharide by microbial fermentation.

10. The application as described in claim 9, characterized in that, The recombinant *E. coli* strain described herein is used for industrial fermentation production of lactose-N-tetrasaccharide without the need for glycerol as a substrate. The gloA and nagB genes in the genome have been knocked out, and the lgtA2, SewbdO, and galE genes have been integrated. The target sequences of the integrated lgtA2 and SewbdO genes are preferably shown in SEQ ID NO:5, and the nucleotide sequence of the galE gene is shown in SEQ ID NO:8.

Citation Information

Patent Citations

  • Genetically engineered bacterium for producing lactose-N-neotetraose as well as construction method and application of genetically engineered bacterium

    CN119736222A

  • Construction method and application of recombinant escherichia coli for improving yield of lactoyl-N-tetrasaccharide

    CN120060103A