Lysozyme, coding gene and recombinant vector thereof, and preparation method and application of lysozyme

Abstract

The invention belongs to the technical field of biotechnology, and discloses lysozyme, a coding gene thereof, a recombinant vector and a preparation method and application of the lysozyme. The amino acid sequence of the lysozyme is as shown in SEQ ID NO.2, and the nucleotide sequence of the coding gene of the lysozyme is as shown in SEQ ID NO.1. The recombinant vector is composed of a vector and the gene of the lysozyme. The preparation method of the lysozyme comprises the following steps: performing fermentation culture on host cells, performing induced expression on the lysozyme, performing lysis treatment on the host cells in fermentation liquor, performing centrifugation, collecting lysate supernatant, and finally performing purification treatment on the lysate supernatant to obtain the lysozyme. The lysozyme comes from a prophage sequence of a genome of methicillin-resistant staphylococcus aureus, the lysozyme is wide in lysis spectrum, stable in activity and safe to use, and the preparation method of the lysozyme is simple in process and convenient for industrial production.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a lysozyme, its encoding gene, a recombinant vector, a method for preparing the lysozyme, and its applications. Background Technology

[0002] Methicillin-resistant Staphylococcus aureus (MRSA) Methicillin-resistant Staphylococcus aureus Since its first report in 1961, MRSA (metastatic resistant bacterial submucous) has been one of the most common multidrug-resistant Gram-positive pathogens in clinical practice, posing a serious challenge to traditional antibiotic treatment. Its infection can lead to a variety of diseases, including skin and soft tissue infections, pneumonia, bloodstream infections, and sepsis, characterized by high morbidity and mortality. MRSA acquires resistance elements such as the SCCmec gene cassette, making it resistant not only to β-lactam antibiotics but also often resistant to fluoroquinolones, macrolides, and other antibiotics, posing a significant challenge to clinical treatment. Long-term, excessive, and even irrational use of antibiotics is a key factor driving the development and spread of bacterial resistance, rendering traditional antibiotic treatments increasingly ineffective. Therefore, the development of novel, highly effective, and less resistant antibacterial drugs is urgently needed.

[0003] To address this issue, biological antimicrobial therapies, represented by bacteriophages, have attracted widespread attention. Bacteriophages can specifically infect and lyse bacteria, and their related lysinases (such as lysozyme, endosomalin, and perforin) are considered promising antimicrobial agents. However, there are significant limitations to directly developing intact bacteriophages into clinical drugs: First, as viruses, bacteriophages may trigger immunogenic reactions, horizontal gene transfer, and toxin gene diffusion in the human body, leading to complex regulatory approval pathways; second, bacteriophages typically exhibit strict host specificity, often only lysing specific strains or a few closely related strains. While this narrow-spectrum characteristic is beneficial for maintaining the balance of the microbial community, it greatly limits their clinical applicability, restricting practical application scenarios.

[0004] Therefore, existing technologies need further improvement. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a novel lysozyme, its encoding gene, a recombinant vector, a method for preparing the lysozyme, and its applications. The lysozyme exhibits a broad cleavage spectrum, stable activity, and safe use. The preparation method for this lysozyme is simple and suitable for industrial production.

[0006] To address the aforementioned technical problems, this application provides the following technical solution: In a first aspect, this application provides a lysozyme, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] The phage lysozyme can specifically hydrolyze the key bond of the peptidoglycan of the bacterial cell wall, resulting in the rapid lysis and death of the bacteria. Compared with the intact phage, the recombinant lysozyme has higher safety as a protein drug, has no replication ability and genetic material, and has a wider antibacterial spectrum than the source phage, and can lyse a variety of different spectrum MRSA strains.

[0008] The present application provides a phage lysozyme isolated from the prophage sequence of the genome of methicillin-resistant Staphylococcus aureus (MRSA) for the first time, which has stable activity, good temperature stability and acid-base stability. Experiments have proved that the lysozyme has broad-spectrum lytic activity, and can lyse a variety of pathogenic bacteria such as Vibrio vulnificus, Listeria monocytogenes and Pseudomonas aeruginosa in addition to Staphylococcus aureus.

[0009] Therefore, the novel lysozyme provided by the present application has high-efficiency and broad-spectrum lytic activity for MRSA, and the construction of a high-efficiency recombinant vector and the establishment of a large-scale preparation method have important scientific value and application prospects for the development of a new generation of biological agents against MRSA.

[0010] In a second aspect, the present application also provides a coding gene of the lysozyme, and the nucleotide sequence is shown in SEQ ID NO. 1.

[0011] The gene of the lysozyme is screened from the prophage sequence of the genome of methicillin-resistant Staphylococcus aureus (MRSA).

[0012] In a third aspect, the present application also provides a recombinant vector, which is composed of a vector and the gene of the lysozyme.

[0013] Optionally, the vector is pET-28(a), pET-30(a), pET-32(a) or pGEX-6P-2.

[0014] In a fourth aspect, the present application also provides a host cell, which is transformed with the recombinant vector.

[0015] Optionally, the host cell is Escherichia coli, such as Escherichia coli Rossetta (DE3), BL21 (DE3), BL21 CodonPlus, Tuner (DE3) pRARE2, Origam Shuffle, BL21 (DE3) pLysS / pLysE, BL21 (DE3) Star, BL21 (DE3) OmpT or Origami B (DE3).

[0016] In a fifth aspect, the present application also provides a pharmaceutical preparation, and the active ingredient is the lysozyme.

[0017] In a sixth aspect, the present application also provides a preparation method of the lysozyme, comprising the following steps: The host cell is subjected to fermentation culture, and the lysozyme is induced and expressed, and then the host cell in the fermentation liquor is lysed, the supernatant of the lysate is collected by centrifugation, and finally the supernatant of the lysate is purified to obtain the lysozyme.

[0018] Optionally, in the preparation method, the lysis method is that the lysis solution is added to the fermentation liquor and subjected to ultrasonic crushing.

[0019] Preferably, the ultrasonic crushing is performed under the following conditions: 30%, ultrasonic crushing for 5 s, interval for 5 s, and crushing for 30 min.

[0020] Optionally, in the preparation method, the purification treatment is performed by using a metal ion affinity chromatography column for purification.

[0021] Preferably, the purification is performed by using a BeyoGoldTM His-tag Purification Resin (Fast Flow, denaturant-resistant type) (P2236).

[0022] In a seventh aspect, the present application also provides the lysozyme, the coding gene of the lysozyme, the recombinant vector and the host cell in the application for the bacteriostasis of pathogenic bacteria and the preparation of a medicine for preventing and treating diseases caused by the infection of the pathogenic bacteria.

[0023] Preferably, the pathogenic bacteria include Staphylococcus aureus, Vibrio vulnificus, Listeria monocytogenes and Pseudomonas aeruginosa.

[0024] Preferably, the pathogenic bacteria include methicillin-resistant Staphylococcus aureus.

[0025] Optionally, the diseases caused by the infection of methicillin-resistant Staphylococcus aureus include slight skin damage and severe infection, such as pneumonia, phlebitis, meningitis, mastitis, urinary tract infection, and deep infection, such as osteomyelitis and endocarditis.

[0026] In actual application, the lysozyme can be used as an active ingredient to prepare a medicine preparation for preventing and treating the diseases caused by the infection of methicillin-resistant Staphylococcus aureus. The medicine preparation is not only safe to use, but also has a wide range of applications.

[0027] The present application has the following beneficial effects: 1. The bacteriophage lysozyme isolated from the prophage sequence of the genome of methicillin-resistant Staphylococcus aureus (MRSA) is provided for the first time, which has stable lysozyme activity, good temperature stability and acid-base stability, and has bacteriostatic effect on various pathogenic bacteria such as Staphylococcus aureus, Vibrio vulnificus, Listeria monocytogenes and Pseudomonas aeruginosa, especially methicillin-resistant Staphylococcus aureus. The lysozyme can be used as an active ingredient for the preparation of a medicine for preventing and treating diseases caused by infection of these pathogenic bacteria.

[0028] 2. The preparation method of the bacteriophage lysozyme based on the prokaryotic expression system is provided, which has simple process, controllable conditions, low cost and is convenient for industrial production. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 Flow analysis of clinical respiratory system MRSA A. (A) The number and proportion of respiratory system MRSA in different departments; (B) The number and proportion of strains carrying different prophages; (C) The distribution of virulence genes in departments; (D) The distribution of drug resistance genes in departments; Figure 2 A diagram showing the three-dimensional structure prediction of lsy81 protein; Figure 3 A lys81 gene amplification electrophoresis map; M is DL-2000 Marker; lane 1 is a negative control; lane 2 is lsy81 gene; Figure 4 An enzyme digestion electrophoresis map of empty plasmid pET-28(a); M is DL-5000 Marker; lanes 1-5 are double enzyme-digested pET-28(a); lane 6 is pET-28(a); Figure 5 A plasmid map of recombinant expression vector pET-28(a)-lys81; Figure 6 An SDS-PAGE result map of lysozyme lsy81 prokaryotic expression; M is marker; lane 1 is uninduced bacterial lysate; lane 2 is uninduced bacterial lysate supernatant; lane 3 is induced bacterial lysate; lane 4 is induced bacterial lysate supernatant; Figure 7 A His-tagged recombinant protein purification map under non-denaturing conditions; M is marker; CL is bacterial lysate; L is lysate supernatant; FT is flow-through liquid; W1-W3 are non-denaturing lysate washes 1-3; W4-W5 are non-denaturing wash liquid 1 (10mM imidazole) washes 4-5; W6-W8 are non-denaturing wash liquid 2 (20mM imidazole) washes 6-8; E1-E4 are eluent (250mM imidazole) elutions 1-4; Figure 8 Figure for the bacteriostatic effect of different concentrations of lysozyme Lys81 on MRSA 56 in vitro; Figure 9 Figure for the pH stability monitoring results of lysozyme Lys81; Figure 10 Figure for the temperature stability detection results of lysozyme Lys81; Figure 11 Figure for the detection results of cation concentration on the stability of lysozyme Lys81; wherein, A is Na + Effect on the stability of lysozyme Lys81; B is Mg 2+ Effect on the stability of lysozyme Lys81; C is Ca 2+ Effect on the stability of lysozyme Lys81. DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application. In the present application, unless specified, the equipment and raw materials used are commercially available or commonly used in the art. The methods in the following embodiments are conventional methods in the art, unless otherwise specified.

[0031] Example 1: Screening of representative lysozyme 1.1 Acquisition of clinical respiratory system strains 901 strains of Staphylococcus aureus were collected from the clinic of a hospital. Drug sensitivity detection found that there were 449 strains of methicillin-resistant Staphylococcus aureus (MRSA). As shown in FIG. Figure 1 A, 55.9% of the MRSA were isolated from the respiratory system. The high isolation rate, rapid spread and significant blank of respiratory system MRSA make it important and urgent to study respiratory system MRSA. Among these respiratory system MRSA, there are differences in the distribution of different departments. Neurosurgery, ICU, respiratory medicine and neurosurgery are high-risk departments for respiratory system MRSA infection, and the number of samples is larger. This may be related to the complexity of the condition of patients in these departments, the frequency of invasive operations and low immune function. All samples were subjected to whole genome sequencing to analyze their prophage carrying, drug resistance genes and virulence gene characteristics.

[0032] The prophage carrying of respiratory system MRSA samples is relatively complex (as shown in FIG. Figure 1B), with the number of phages ranging from 0 to 6. Among them, the sample carrying 2 phages was the most common, accounting for about 73%. The presence of prophages may be related to the genomic diversity and adaptability of bacteria. Further studies are needed to explore its role in drug resistance and virulence. Figure 1 C), the number of virulence genes carried by the strains mainly ranged from 50 to 100, with the number of strains carrying 64 virulence genes being the most. The number of drug resistance genes varied significantly among different samples Figure 1 D), the number of drug resistance genes ranged from 0 to 22. Some samples carried multiple drug resistance genes, indicating that these strains may have resistance to multiple antibiotics, which increases the complexity of clinical treatment. Among them, the distribution of drug resistance genes also showed certain differences, which may be related to the source of the strains, the history of antibiotic use of the host, and the evolution of the strains. For example, the number of drug resistance genes in samples from ICU and neurosurgery departments was relatively large, which may be related to the more complex antibiotic treatment received by patients in these departments.

[0033] Spearman correlation analysis was used to analyze the relationship between the department of respiratory MRSA, the number of prophages, the number of virulence genes, and the number of drug resistance genes. The Spearman correlation analysis found that (as shown in Table 1) the number of prophages was significantly positively correlated with the number of virulence and drug resistance genes, and the correlation coefficients were 0.221 and 0.273, respectively.

[0034] Table 1 Correlation analysis of the number of prophages and the number of virulence and drug resistance genes, department

[0035] ** Significant correlation at the 0.01 level (two-tailed).

[0036] 1.2 Selection of representative lysozyme 1.2.1 Identification of lysozyme in prophages of MRSA We used prokka (v1.14.6) (Seemann, T., 2014) to make a preliminary annotation of the prophages, and then used eggNOG Mapper (v5.0.2) (Huerta-Cepas, J. et al., 2018) and InterProScan (v5.72) (Blum, M. et al., 2024) for detailed annotation. According to the criteria of lysozyme in PhaLP database (Criel, B. et al., 2021), we screened the lysozyme according to the annotation results, and analyzed the physicochemical properties of the protein according to the online website of protparam (https: / / web.expasy.org / protparam / ) (John M. Walker, 2005).

[0037] 1.2.2 Functional identification of lysozyme in MRSA phage On the Galaxy online platform, we used Proteinortho to analyze the homologous proteins (e-value <1e-5) between 8 lytic S. aureus phages obtained from ncbi and MRSA prophages. After removing duplicates using CD-hit, the obtained homologous proteins were annotated using vibrant, alphafold2 and dali servers to identify the functions of homologous proteins.

[0038] 1.2.3 Screening of representative lysozyme of prophage of clinical respiratory MRSA From the 345 respiratory tract MRSA prophage genomes, 60 lysozymes were predicted and de-duplicated, and physicochemical property analysis was performed, and 59 lysozymes were stable proteins. Using Proteinortho for identification and functional annotation, we finally found a lysozyme M81 with high homology to lytic phage, which was predicted to be a lysozyme by three-dimensional prediction, and the results are shown in Table 2.

[0039] Table 2 Homologous proteins in prophages, positions, related phages and predicted functions

[0040] Example 2 Construction, prokaryotic expression and purification of lysozyme 2.1 Physicochemical property analysis of M81 phage lysozyme lys81 The protein physicochemical property prediction analysis of M81 phage lysozyme lys81 was performed by Expasy online software (https: / / web.expasy.org / protparam / ).

[0041] The results showed that lysozyme lys81 consists of 482 amino acids, and its amino acid sequence is shown in SEQ ID NO. 2 of the sequence listing. The protein has a relative molecular mass of 54116.55, a theoretical PI of 8.91, an average hydrophilicity of -0.475, and an instability index of 37.62, which is less than 40, indicating it is a stable protein. The three-dimensional structure of M81 phage lysozyme lys81 was predicted using the Swissmodel website (https: / / swissmodel.expasy.org / ctive / ). The amino acid sequence was submitted, and the prediction results were downloaded, as shown in Figure 2.

[0042] 2.2 Prokaryotic expression and purification of lysozyme Lys81 2.2.1 Obtaining the M81 phage lysozyme gene (lys81) Specific primer pairs lys81-F and lys81-R were designed and synthesized based on the whole genome of lysozyme lys81. PCR amplification was performed under optimized conditions, and a single band of the expected size (approximately 1492 bp) was successfully obtained. The PCR amplification products were detected by 1% agarose gel electrophoresis (Figure 3), and the target fragment amplified by PCR was recovered using the Novizan gel recovery kit.

[0043] The primer pair sequences are as follows: lys81-F:CAAATGGGTCGCGGATCCGAATTCATGCAAGCAAAATTAACTAAAAA (As shown in SEQ ID NO.3) lys81-R: GGTGGTGGTGGTGGGTGCTCGAGCTAACTGATTTCTCCCCATAAG (As shown in SEQ ID NO.4) 2.2.2 Construction of recombinant expression plasmid pET-28(a)-lys81 The empty vector plasmid pET-28(a) was double-digested and verified by 1% agarose gel electrophoresis. The gel was then recovered. Figure 4 The vector with sticky ends was obtained. The target gene was ligated to the digested plasmid using Novizan's homologous recombinase and then transformed into *E. coli* DH5α competent cells. Positive clones were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequencing results showed that the target gene was successfully inserted into the pET-28a plasmid. The positive clones were expanded and cultured, and the plasmid was extracted and named pET-28(a)-lys81 (Figure 5).

[0044] 2.2.3 Prokaryotic expression and purification of M81 bacteriophage lysozyme lys81 (1) Expression of lysozyme: The recombinant plasmid pET-28(a)-lys81 was transformed into E. coli Rossetta (DE3) competent cells, and positive bacterial liquid was identified by PCR.

[0045] E. coli Rossetta single colonies containing recombinant plasmids were picked into 1 mL of fresh LB liquid medium (containing 50 μg / mL Kan) and cultured at 37°C with shaking at 180 rpm overnight, i.e. seed bacteria.

[0046] The overnight seed bacteria were transferred to 200 mL of fresh LB liquid medium (containing 50 μg / mL Kan) at a ratio of 1:100 and cultured at 37°C with shaking at 180 rpm.

[0047] When the bacterial liquid concentration reached OD600 of 0.6-0.8 (about 3 h), IPTG was added to a final concentration of 1 mM, and induction was performed at 12°C with shaking at 150 rpm for 48 h.

[0048] (2) Extraction of lysozyme After induction, lysis buffer was added to the bacterial liquid, and the bacterial body was lysed using an ultrasonic disrupter. The whole bacteria and the supernatant of the lysed bacteria were analyzed by SDS-PAGE electrophoresis. The specific operation is as follows: Centrifuge at 4°C, 5000 g for 10 min, collect the bacterial body, suspend the bacterial body with pre-cooled 10 mL Lysis Buffer (50 mM Tris, 500 mM NaCl, adjust pH to 7.5), add 1 X protease inhibitor cocktail (universal, 100X) (Biyun Tian, P1006), and operate on ice. Ultrasonic lysis of bacteria on ice, breakage for 30 min, collect about 20 μL of broken liquid for subsequent analysis (marked as CL). Centrifuge at 4°C, 12000 g for 30 min, collect the supernatant.

[0049] SDS-PAGE identification was performed on uninduced bacterial lysate, uninduced bacterial lysate supernatant, induced bacterial lysate, and induced bacterial lysate supernatant to confirm the expression form of lysozyme.

[0050] (3) Purification of lysozyme Since the aforementioned lysozyme is a recombinant protein with His tag under non-denaturing conditions, purification is performed using the BeyoGold™ His-tag Purification Resin (Fast Flow, denaturant-resistant type) (P2236) of Biyun Tian, and the specific operation is as follows: Column loading: 1 mL of gel is added to the empty column of the affinity chromatography column (Bi Yun Tian, FCL06), slowly added along the wall to prevent the generation of bubbles. Use 5 times the column volume of Lysis Buffer to equilibrate twice to remove ethanol in the packing material.

[0051] Loading: 2-3 mL of protein extract extracted in step (2) is added to the chromatography column, and after loading, rotate for 1-2 h at 4°C, and collect about 20 μL of the flow-through liquid for subsequent analysis (marked as FL).

[0052] Wash the column 8 times, first wash 4 times with 1-2 times the column volume of 10 mM non-denaturing wash solution (50 mM Tris, 500 mM NaCl, 10 mM imidazole, adjust pH to 7.5), and then wash 4 times with 1-2 times the column volume of 20 mM non-denaturing wash solution (50 mM Tris, 500 mM NaCl, 20 mM imidazole, adjust pH to 7.5). Collect about 20 μL of the flow-through liquid for subsequent analysis (marked as W1-W8) each time.

[0053] Finally, elute 4 times, each time with 0.5-1 mL of non-denaturing elution solution (50 mM Tris, 500 mM NaCl, 250 mM imidazole, adjust pH to 7.5), and elute the His-tag protein, repeat 2 times each time. Collect about 20 μL of the flow-through liquid for subsequent analysis (marked as E1-E4) each time.

[0054] Collect the liquid during the purification process for SDS-PAGE identification.

[0055] 2.2.4 Experimental results and analysis (1) SDS-PAGE electrophoresis as shown in Figure 6 , the recombinant lysozyme mainly appears in lane 3, and the results show that the recombinant protein is mainly expressed in the form of inclusion bodies, and a small amount is expressed in a soluble form, and the protein size is about 54 kD, which is consistent with the expected size.

[0056] (2) The SDS-PAGE electrophoresis results of the purified product are shown in Figure 7 , and the results show that the target protein in the eluent CL, FL, W1-W8, E1-E4 has a protein size of about 54 kD, which is consistent with the expected size.

[0057] Example 3 Determination of the biological specificity of lysozyme 3.1 Determination of the lysis of lysozyme (1) Experimental method The M56 strain suspension was adjusted to an OD600 of about 0.6, mixed with different concentrations of Lys81 (60, 80, 100, 120, 140, 160 and 180 μg / mL) in equal volumes, and the control group was added with 1X PBS, with 3 parallel groups. After incubation at 37°C for 2 hours, the OD600 was measured.

[0058] (2) Experimental results and analysis The results, as shown in Figure 8 , showed that the OD600 values of the treatment groups with different concentrations of lysozyme Lys81 gradually decreased, and the bacterial solution gradually became clear. The OD600 values of the group without the addition of lysozyme Lys81 showed little change. Among them, the decrease trend of the 30 μg / mL lysozyme group was slightly worse; when the concentration of lysozyme was 40 μg / mL and 50 μg / mL, the interval of the decrease trend tended to be consistent, and when the concentration was 50 μg / mL, the interval of the decrease trend was very small, indicating that the application concentration of 50 μg / mL of Lys81 could achieve a strong antibacterial effect.

[0059] 3.2 Determination of the lysis spectrum of lysozyme (1) Experimental method A total of 62 strains of Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (39 strains), Acinetobacter baumannii, Salmonella enteritidis, Vibrio vulnificus, Escherichia coli, Listeria monocytogenes, Klebsiella pneumoniae and Pseudomonas aeruginosa (see Table 3 below) were selected for the determination of the lysis spectrum of the methicillin-resistant Staphylococcus aureus prophage lysozyme Lys81.

[0060] The test strains were cultured at 37°C to the mid-logarithmic growth phase, the strains were centrifuged and the precipitate was washed with 1X PBS for 3 times, then the bacterial body was resuspended with PBS and adjusted to an OD600 of about 0.6, and the volume was concentrated to 1 / 2 of the original volume. In a 96-well plate, 100 μL of concentrated bacterial solution was mixed with 100 μg / mL of 100 μL of lysozyme Lys81. The final concentration of lysozyme Lys81 was 500 μg / mL, and 100 μL of concentrated bacterial solution was mixed with 100 μL of 1X PBS as a control, with 3 parallel groups, and placed in a multifunctional enzyme marker. Incubate at 37°C. Measure the OD600 value at 0 h and 2 h, calculate the OD600 value decrease ratio, and determine the lysis spectrum of lysozyme Lys81.

[0061] (2) Experimental results and analysis The results of the lysozyme cleavage spectrum are shown in Table 3. The lysozyme Lys81 had a cleavage rate of 52.27% for all S. aureus, including 53.85% for MRSA. In addition, it could also cleave V. vulnificus and L. monocytogenes, and had a cleavage rate of 50% for 10 strains of P. aeruginosa, but had no cleavage effect on A. baumannii, S. enteritidis, E. coli, and K. pneumoniae. The results show that the lysozyme Lys81 has a broad-spectrum bacteriostatic ability.

[0062] Table 3. Results of the lysozyme Lys81 cleavage spectrum determination of MRSA phages

[0063] The cleavage activity was 10%-30%, "+"; the cleavage activity was 31%-50%, "++"; the cleavage activity was 51%-70%, "+++"; the cleavage activity was 71%-100%, "++++"; and the cleavage activity was less than 10%, "-".

[0064] 3.3.1 pH stability analysis of lysozyme Lys81 3.3.1 pH stability analysis of lysozyme Lys81 (1) Experimental method: MRSA56 was cultured in BHI medium to the logarithmic phase, and the bacterial solution was divided into 8 groups. After centrifugation, the precipitate was washed 3 times with different pH buffers (1X PBS, pH adjusted to 4, 5, 6, 7, 8, 9, 10, 11), then the bacterial body was resuspended with the corresponding pH buffer and adjusted to OD600 of about 0.6, and then concentrated to 1 / 2 of the original volume. In a 96-well plate, 100 μL of concentrated bacterial solution under different pH conditions was mixed with 100 μg / mL of lysozyme Lys81 (lysozyme was diluted and prepared with different pH buffers) under the same pH, and the final concentration of lysozyme was 50 μg / mL. In the control group, an equal volume of 1X PBS was added instead of lysozyme Lys81, and each group had 3 replicates. After mixing, the OD600 value was quickly measured on a microplate reader, and then the bacterial and lysozyme mixture under different pH conditions was incubated at 37 ℃, and the OD600 value was measured after 2 h.

[0065] (2) Experimental results and analysis The results are shown in Table 3. The results show that the lysozyme Lys81 has a broad-spectrum bacteriostatic ability. Figure 9 The results show that the lysozyme Lys81 has a broad-spectrum bacteriostatic ability. The results show that the lysozyme Lys81 has a broad-spectrum bacteriostatic ability.

[0066] 3.3.2 Temperature stability analysis of lysozyme Lys81 (1) Experimental methods MRSA 56 was cultured in BHI medium to the logarithmic growth phase. After centrifugation, the precipitate was washed three times with 1X PBS, then resuspended in 1X PBS and adjusted to approximately 0.6 OD600. The culture was then concentrated to half its original volume. Lysozyme Lys81 was added and incubated at different temperatures (4, 16, 25, 37, 42, 56, 70 °C) for 30 min. After returning to room temperature, an equal volume of 100 μL of the concentrated bacterial culture was mixed, resulting in a final lysozyme concentration of 50 μg / mL. An equal volume of 1X PBS was added to the control group. The mixture was immediately placed in a microplate reader to measure OD600. The bacterial-lysozyme mixture was then incubated at 37 °C for 2 h, after which OD600 was measured again.

[0067] (2) Experimental results and analysis The measurement results are as follows Figure 10 As shown, lysozyme Lys81 exhibits consistently high activity within a temperature range of 0-70 ℃, indicating that lysozyme Lys81 has excellent thermal stability, a wide temperature range, and high activity stability.

[0068] 3.3.2 Effect of cations on the stability of lysozyme Lys81 (1) Experimental methods Different concentrations of NaCl, MgCl2, and CaCl2 (0 mM, 50 mM, 100 mM, 200 mM, 400 mM) were prepared in 1X PBS (pH = 7.4). Lysozyme Lys81 was incubated in different concentrations of NaCl, CaCl2, and MgCl2. The treated lysozyme was then added to an equal volume of MRSA 56 and incubated at 37°C for 120 minutes before OD600 was measured to determine its effectiveness.

[0069] (2) Experimental results and analysis Na + Stability test results are as follows Figure 11 As shown in A, no Na + At that time, the antibacterial rate of lysozyme was 14.03%, and the addition of Na... + Afterwards (between 25 mM and 400 mM), the antibacterial rate increased, indicating that Na+ has a strong activating effect on lysozyme Lys81. Among them, Na... + The antibacterial effect was optimal at a concentration of 50 mM (antibacterial inhibition rate reached 22.69%). With the increase of Na... + As the concentration increases, the activation effect weakens.

[0070] Mg 2+ Stability test results are as follows Figure 11 B, without Mg 2+ At that time, the antibacterial rate of lysozyme was 14.03%, and the addition of 25~50 mM Mg 2+ Afterwards, compared with the control group, the antibacterial effect of lysozyme did not change significantly, indicating that Mg 2+ It has almost no effect on enzyme activity. However, between 50 and 400 mM, with the increase of Mg... 2+ As the concentration increases, the antibacterial rate decreases significantly, and it has a significant inhibitory effect on enzyme activity.

[0071] Ca 2+ Stability test results are as follows Figure 11 C, the result shows that there is no Ca. 2+ At that time, the antibacterial rate of lysozyme was 12.54%, and the addition of 25~50 mM Ca 2+ Afterwards, compared with the control group, the antibacterial rate was improved, indicating that Ca 2+ It has a strong activating effect on lysozyme Lys81. However, in the range of 50-400 mM, the activation effect decreases with increasing Ca2+. 2+ With increasing concentration, the antibacterial rate of lysozyme decreased significantly, and it had a significant inhibitory effect on enzyme activity.

[0072] In the practical application of the above-mentioned lysozyme, its stability characteristics against the above three ions can be fully utilized to adjust the application environment and avoid the influence of the above ions on the activity of lysozyme.

[0073] It is understood that those skilled in the art can make equivalent substitutions or modifications to the technical solutions and concepts of this invention, and all such substitutions or modifications should fall within the protection scope of the appended claims.

Claims

1. A lysozyme, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

2.

2. A gene encoding lysozyme as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

3. A recombinant vector, characterized in that, It consists of a vector and the genome as described in claim 2.

4. The recombinant vector according to claim 1, characterized in that, The carrier is pET-28(a), pET-30(a), pET-32(a) or pGEX-6P-2.

5. A host cell, characterized in that, The host cell transformation includes the recombinant vector as described in claim 3.

6. A pharmaceutical preparation, characterized in that, The active ingredient is the lysozyme as described in claim 1.

7. A method for preparing lysozyme as described in claim 1, characterized in that, Includes the following steps: The host cells as described in claim 5 are fermented and cultured, and lysozyme is induced to be expressed. The host cells in the fermentation broth are then lysed, centrifuged, and the supernatant of the lysate is collected. Finally, the supernatant of the lysate is purified to obtain lysozyme.

8. The preparation method according to claim 7, characterized in that, The pyrolysis method is as follows: add pyrolysis solution to the fermentation broth and perform ultrasonic disruption.

9. The preparation method according to claim 7, characterized in that, Purification was performed using a metal ion affinity chromatography column.

10. The use of the lysozyme of claim 1, the lysozyme encoding gene of claim 2, the recombinant vector of claim 3, and the host cell of claim 5 in the inhibition of pathogens and in the preparation of drugs for the prevention and treatment of diseases caused by said pathogens.

Images