Chalcone isomerase for improving activity of chalcone synthase and application of chalcone isomerase

By mutating the amino acid sequence of chalcone isomerase to form a complex with chalcone synthase, the enzyme activity and naringenin yield were improved, solving the problem of low catalytic activity of chalcone synthase and realizing the efficient production of flavonoids and the optimization of plant stress resistance traits.

CN121574974APending Publication Date: 2026-02-27SHANGHAI CHENSHAN BOTANICAL GARDEN
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610034267.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-12
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

The low catalytic activity of chalcone synthase leads to a low yield of flavonoid compounds, which affects plant growth, development and stress resistance. In addition, the content of naringenin, an intermediate produced by the combination of type IV chalcone isomerase and chalcone synthase, is low.

Method used

Mutating the amino acid sequence of chalcone isomerase, especially by H36L, H36M, or H36E mutations at position 36 on the top of β-Hairpin, forms a complex with chalcone synthase, thereby improving enzyme activity and product specificity.

Benefits of technology

It significantly increases the yield of naringenin in the total product to 90% or more, enabling the industrial production of flavonoids in the field of biosynthesis, optimizing plant stress resistance, and providing highly active and rare plant flavonoid extracts.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574974A_ABST
    Figure CN121574974A_ABST
Patent Text Reader

Abstract

The invention discloses chalcone isomerase capable of improving activity of chalcone synthase and application of the chalcone isomerase, compared with arabidopsis thaliana CHIL, the amino acid sequence of the chalcone isomerase has mutation H36L / M at the 36th site at the top of beta-Hairpin, or has mutation H36E at the 36th site, and meanwhile, has mutation F37T at the 37th site. The three-dimensional structure of the complex formed by the chalcone synthase and the IV type chalcone isomerase is analyzed, key amino acid residues on a contact surface when the complex is formed are identified, a catalysis and regulation mechanism of the chalcone synthase complex for exerting an enzyme activity function is disclosed, and the activity of the IV type chalcone isomerase is improved through the amino acid, located on beta-hairpin, on the IV type chalcone isomerase. According to the present invention, the mutation is performed on the naringenin, especially the H36 amino acid residue, such that the naringenin yield in the total product can be significantly improved, the naringenin content in the total product can be improved to 90% or more, and the method can be used for the field of biosynthesis and the industrial mass production of flavonoid compounds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of synthetic biotechnology, specifically relating to a chalcone isomerase that enhances the activity of chalcone synthase and its applications. Background Technology

[0002] Chalcone synthase (CHS) is the first enzyme in the biosynthetic pathway of flavonoids, catalyzing the synthesis of one molecule of 4-coumaryl-CoA (C). p Naringenin chalcone is a key rate-limiting and important regulatory enzyme in the formation of flavonoids. It is widely present in plants and has been found in parsley (…). Petroselinum crispum ), soybeans Glycine max ),peanut( Arachis hypogaea ),tomato( Solanum lycopersicum ) and apple ( Malus x domestica Borkh. Chalcone synthase has been cloned and identified in multiple species, including *Agropyron cristatum* and *Pteris vittata*. Chalcone synthase plays a crucial role in plant growth and development, as well as in resisting abiotic stresses. It participates in regulating the biosynthesis of anthocyanins, controlling the content of flavonoids in pollen grains to influence pollination, and regulating the production of stress-resistant flavonoids to help plants resist external biotic and abiotic environmental stresses, such as pathogen attack, ultraviolet radiation, mechanical damage, low temperature, or nitrogen deficiency. The crystal structure of chalcone synthase in alfalfa was resolved in 1999, and the structures of chalcone synthases in several other species have subsequently been reported. Due to limited research on the structure and catalytic mechanism of chalcone synthases in ferns, we previously cloned, identified, and resolved the function and molecular catalytic mechanism of novel chalcone synthases in *Pteris vittata* and *Pteris thunbergii*. Analysis revealed that the protein structure of chalcone synthase is relatively conserved, possessing a pseudo-symmetric motif of αβαβαβ, and functions as a homodimer, with each monomer's independent catalytic active center embedded within the monomer.

[0003] Chalcone isomerase (CHI) is the second rate-limiting enzyme in the biosynthetic pathway of flavonoids. Its overall structure resembles an inverted bouquet, employing an open β-sandwich fold. Structural analysis has revealed several key amino acid sites related to catalytic activity. There are four types in plants. Type I and Type II chalcone isomerases can catalyze the conversion of naringenin chalcone to (2S)-naringenin. Type II chalcone isomerase can also catalyze the conversion of isoliquiritigenin to glycyrrhizin. Type III chalcone isomerase has fatty acid binding function and can affect fatty acid synthesis and seed development in plant cells. Type IV chalcone isomerase, also known as CHIL (CHI-like), has some catalytically related sites that have been mutated, resulting in it not possessing the catalytic activity of Type I or Type II chalcone isomerases. However, it has been reported that Type IV chalcone isomerase can interact with chalcone synthase, thereby reducing the production of chalcone synthase byproducts and enhancing the production of flavonoids in plants. In nature, flavonoids possess a variety of biological activities, including antioxidant, antiviral, antitumor, and free radical scavenging properties. However, the molecular mechanism by which this type IV chalcone isomerase and its mutant bind to and regulate chalcone synthase remains unclear. Furthermore, the content of the intermediate naringenin produced is low, resulting in low yield, activity, and utilization of the final flavonoid compounds.

[0004] Therefore, it is necessary to study the interaction forms and complexes between chalcone synthase and type IV chalcone isomerase using structural biology, biochemistry, enzymology, and synthetic biology techniques to improve chalcone synthase activity and product specificity. This will provide targets for research on increasing the content and regulating the types of flavonoids in different plants, further optimize plant stress resistance traits, and provide raw materials for obtaining highly active and rare plant flavonoid extracts, thereby promoting the development of the cosmetics and health product industries. Summary of the Invention

[0005] The purpose of this invention is to provide a chalcone isomerase that enhances the activity of chalcone synthase and its applications, thereby addressing the problems of low catalytic activity and low yield of flavonoid compounds in existing technologies. This provides a target for research on increasing the content and regulating the types of flavonoid compounds in different plants, further optimizing plant stress resistance traits, and also provides raw materials for obtaining highly active and rare plant flavonoid extracts, thus promoting the development of the cosmetics and health product industries.

[0006] To address the above problems, this patent provides the following technical solution: A chalcone isomerase that enhances the activity of chalcone synthase, wherein the amino acid sequence of the chalcone isomerase has a mutation H36L at position 36 on the top of β-Hairpin compared to Arabidopsis thaliana AtCHIL. Alternatively, the amino acid sequence of the chalcone isomerase has a mutation H36M at position 36 on top of β-Hairpin compared to SEQ ID NO.2; Alternatively, the amino acid sequence of the chalcone isomerase has a mutation H36E at position 36 on top of β-Hairpin and a mutation F37T at position 37 compared to SEQ ID NO.2; The amino acid sequence of Arabidopsis thaliana AtCHIL is shown in SEQ ID NO.2.

[0007] Furthermore, the amino acid sequence of the chalcone isomerase is selected from sequences identical to any one of the following amino acid sequences, or having at least 80%, 85%, 90%, 95%, 98%, or 99% homology: SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.61, SEQ ID NO.62, SEQ ID NO.63, SEQ ID NO.64, SEQ ID NO.65, SEQ ID NO.66, SEQ ID NO.67, SEQ ID NO.68 or SEQ ID NO.69.

[0008] Furthermore, the chalcone isomerase is derived from any one of Arabidopsis thaliana, Ginkgo biloba, rice, corn, soybean, wheat, Selaginella tamariscina, Larix tigrinosa, Bryophytum comosum, Pteris vittata, Pteris thunbergii, tomato, or rice.

[0009] Furthermore, chalcone isomerase can increase the yield of naringenin.

[0010] This patent, in another aspect, provides a gene encoding a chalcone isomerase that enhances the activity of chalcone synthase.

[0011] This patent, in another respect, provides a plant individual, plant tissue, or plant cell containing a gene encoding a gene.

[0012] This patent also provides a recombinant vector containing a coding gene.

[0013] This patent also provides a recombinant cell or recombinant bacterium containing a recombinant vector.

[0014] Another aspect of this patent provides a flavonoid compound extracted from the aforementioned plant individual, plant tissue, or plant cell containing the encoding gene.

[0015] Another aspect of this patent provides the application of a chalcone isomerase that enhances the activity of chalcone synthase in increasing the content of flavonoid compounds or improving enzyme activity.

[0016] Furthermore, the specific applications are as follows: Step A: Modify the endogenous CHIL gene of the target plant so that the endogenous CHIL gene of the target plant encodes chalcone isomerase; Step B: Construct a recombinant vector using the modified endogenous CHIL gene of the target plant from Step A, and transform the recombinant vector into the target plant.

[0017] Furthermore, the modification in step A is mutagenesis or gene editing.

[0018] Furthermore, the target plants include wheat, rice, barley, oats, corn, sorghum, sugarcane, water chestnut, millet, buckwheat, sorghum, sesame, cotton, soybean, peanut, sweet potato, potato, apple, tobacco, mint, sunflower, cucumber, eggplant, zucchini, pumpkin, winter melon, bitter melon, loofah, cucumber, watermelon, cantaloupe, leek, scallion, onion, leeks, spinach, lettuce, rapeseed, tomato, lettuce, garland chrysanthemum, blueberry, grape, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, and wolfberry. Ginseng, Polygonum multiflorum, Angelica sinensis, American ginseng, dragon fruit, kiwifruit, ginkgo, camphor tree, Masson pine, Chinese pine, white pine, Podocarpus macrophyllus, Pinus armandii, Pinus armandii, Pinus dabies, red pine, red pine, black pine, Pinus huangshanensis, Pinus yunnanensis, Pseudolarix amabilis, Pinus sylvestris, cedar, cocoa, coffee tree, rubber, coconut, oil palm, areca nut, pepper, sisal, lemongrass, cashew, fern, Pteris vittata, Selaginella tamariscina, Lysimachia foenum-graecum, Nephrolepis cordifolia, Acer tectorum, Dryopteris crassirhizoma, Acer tectorum, Acer tectorum, Acer tectorum, Cibotium barometz, or Dryopteris crassirhizoma.

[0019] Therefore, it can be concluded that this application provides a chalcone isomerase that enhances the activity of chalcone synthase and its application. Type IV chalcone isomerase can bind to chalcone synthase, regulating the activity and product specificity of chalcone synthase. The three-dimensional structure of the complex formed by chalcone synthase and type IV chalcone isomerase was analyzed, key amino acid residues on the contact surface during complex formation were identified, and the catalytic and regulatory mechanism of the chalcone synthase complex in exercising its enzymatic function was revealed. Furthermore, by mutating the amino acid located at β-hairpin on type IV chalcone isomerase, especially the H36 amino acid residue, the yield of naringenin in the total product can be significantly increased, raising the content of naringenin in the total product to 90% or more. This can be used in the field of biosynthesis for the industrial-scale production of flavonoid compounds. Attached Figure Description

[0020] The above description of the present invention and the following detailed embodiments will be better understood when read in conjunction with the accompanying drawings. It should be noted that the drawings are merely examples of the claimed technical solutions.

[0021] Figure 1Agarose gel electrophoresis images of the first amplification products of CHS and CHIL (M is the marker; 1 is the first amplification product of the CHIL gene (630 bp); 2 is the first amplification product of the CHS gene (1188 bp)). Figure 2 Clonal identification diagrams for CHIL and CHS (M is the marker; A is the 630 bp CHIL gene, 1-8 represent different CHIL monoclonals; B is the 1188 bp CHS gene, 9-16 represent different CHS monoclonals). Figure 3 SDS-PAGE image of CHS protein after expression and purification (M is marker; 1 is CHS first supernatant, 2 is CHS second precipitate, 3 is CHS flow-through buffer 1, 4 is CHS flow-through buffer 2, 5 is CHS elution sample; black arrow indicates CHS protein, size 43 kDa). Figure 4 SDS-PAGE image of CHIL protein after expression and purification (M is marker; 1 is CHIL first supernatant, 2 is CHIL second precipitate, 3 is CHIL flow-through buffer 1, 4 is CHIL flow-through buffer 2, 5 is CHIL elution sample; black arrow indicates CHIL protein, size 25 kDa). Figure 5 This is a peak diagram of size exclusion purification of CHS protein (the horizontal axis represents the elution volume of CHS protein in mL; the vertical axis represents the absorbance value in mA). Figure 6 This is a peak diagram of size exclusion purification of CHIL protein (the horizontal axis represents the elution volume of CHIL protein in mL; the vertical axis represents the absorbance value in mA). Figure 7 for Figure 5 The molecular size exclusion purification peak diagram of CHS protein corresponds to the SDS-PAGE chromatogram of the collected protein (M is marker; 1 is the protein sample before rapid protein liquid chromatography; 2 is the protein sample in the elution at 10.0-10.5 mL; 3 is the protein sample in the elution at 11.0-11.5 mL; 4 is the protein sample in the elution at 13.5-14.0 mL; 5 is the protein sample in the elution at 14.0-14.5 mL; 6 is the protein sample in the elution at 14.5-15.0 mL; 7 is the protein sample in the elution at 15.0-15.5 mL; 8 is the protein sample in the elution at 15.5-16.0 mL; 9 is the protein sample in the elution at 16.0-16.5 mL). Figure 8 for Figure 6The molecular exclusion purification peak diagram of the CHIL protein corresponds to the SDS-PAGE chromatogram of the collected protein (M is the marker; 1 is the protein sample before rapid protein liquid chromatography; 2 is the protein sample in the elution at 15.0-15.5 mL; 3 is the protein sample in the elution at 15.5-16.0 mL; 4 is the protein sample in the elution at 16.0-16.5 mL; 5 is the protein sample in the elution at 16.5-17.0 mL; 6 is the protein sample in the elution at 17.0-17.5 mL). Figure 9 The graph shows the enzyme activity assays of the CHS-CHIL complex and CHS alone (where the horizontal axis represents the time of compound appearance in min; the vertical axis represents enzyme activity; the purple line represents the substrate produced by the CHS enzyme; the blue line represents the substrate produced by the CHS+CHIL complex; the green line represents the peak position of the naringenin (NAR) standard sample; CK-No Pr indicates the control without enzyme in the reaction system; CK-No Sub indicates the control without substrate in the reaction system). Figure 10 The following is a statistical graph showing the effect of the CHS-CHIL complex and CHS alone on naringenin production in Arabidopsis thaliana (where A and B are statistical graphs comparing the CHS-CHIL complex and CHS alone, and C is the statistical graph after normalization; the horizontal axis represents the added enzyme, "WT" represents wild-type CHIL protein, and "-" represents no wild-type CHIL protein added; the vertical axis represents relative activity, expressed as %). Figure 11 This is a molecular exclusion purification peak diagram of CHS-CHIL complex protein (the horizontal axis represents the elution volume of CHS-CHIL complex protein in mL; the vertical axis represents the absorbance value in mA). Figure 12 for Figure 11 The molecular size exclusion purification peak diagram of the CHS-CHIL complex protein corresponds to the SDS-PAGE chromatogram of the collected protein (M is marker; 1 is the protein sample before rapid protein liquid chromatography; 2 is the protein sample in the elution at 11.0-11.5 mL; 3 is the protein sample in the elution at 13.0-13.5 mL; 4 is the protein sample in the elution at 13.5-14.0 mL; 5 is the protein sample in the elution at 14.0-14.5 mL; 6 is the protein sample in the elution at 15.5-16.0 mL; 7 is the protein sample in the elution at 16.0-16.5 mL; 8 is the protein sample in the elution at 16.5-17.0 mL; 9 is the protein sample in the elution at 17.0-17.5 mL; CHS protein is 43 kDa; CHIL protein is 25 kDa). Figure 13This is a structural comparison diagram of CHIL in the CHS-CHIL complex and AtCHIL in Arabidopsis thaliana (where pink represents the CHIL structure in the CHS-CHIL complex; green represents the AtCHIL structure in Arabidopsis thaliana (PDB ID is 4DOK); the dashed circle indicates the structural difference between the two, β-Hairpin). Figure 14 This is a structural diagram showing the hydrophobic interaction between CHIL H36 and surrounding residues in CHS. Figure 15 for Figure 12 The conservation analysis diagram of the corresponding amino acids in various species (including Arabidopsis thaliana (AtCHIL, AtCHS), tomato (SlCHIL, SlCHS1), soybean (GmCHIL, GmCHS7), rice (OsCHIL, OsCHS1), maize (ZmCHIL, ZmCHS), ginkgo (GbCHIL, GbCHS1), and wheat (TaCHIL1, TaCHS2); Figure 16 Gel electrophoresis images of the cloned products of different AtCHIL and AtCHS mutant genes (where M is the marker; 1 is the AtCHIL H36V mutant, 2 is the AtCHIL H36I mutant, 3 is the AtCHIL H36M mutant, 4 is the AtCHIL H36L mutant, 5 is the AtCHIL H36E mutant, 6 is the AtCHIL H36E / F37T double mutant; 7 is the AtCHIL H36F mutant, 8 is the AtCHIL H36W mutant, 9 is the AtCHIL H36N mutant, 10 is the AtCHIL H36D mutant, 11 is the AtCHILH36Y mutant, 12 is the AtCHS F220A mutant, 13 is the AtCHS F271A mutant, and 14 is the AtCHS V215A / L219A double mutant). Figure 17 for Figure 16SDS-PAGE images of different AtCHIL and AtCHS mutant proteins after expression and purification (where M is the marker; 1 is AtCHIL H36V mutant, 2 is AtCHIL H36I mutant, 3 is AtCHIL H36M mutant, 4 is AtCHIL H36L mutant, 5 is AtCHIL H36E mutant, 6 is AtCHIL H36E / F37T double mutant; 7 is AtCHIL H36F mutant, 8 is AtCHIL H36W mutant, 9 is AtCHIL H36N mutant, 10 is AtCHIL H36D mutant, 11 is AtCHIL H36Y mutant, 12 is AtCHS F220A mutant, 13 is AtCHS F271A mutant, and 14 is AtCHSV215A / L219A double mutant). Figure 18 The graph shows the effect of the H36 amino acid mutation in Arabidopsis thaliana AtCHIL on enzyme activity and naringenin production (where the horizontal axis represents the added enzyme, "CHS(WT)+" represents wild-type AtCHS protein, "-" represents no wild-type AtCHIL protein added; "CHIL(WT)+" represents wild-type AtCHIL protein; the vertical axis represents relative activity, expressed as %; the letter ah represents the significance analysis result). Figure 19 Statistical graphs showing in vitro enzyme activity analysis of Arabidopsis thaliana AtCHIL wild-type and H36L mutant with rice OsCHS, maize ZmCHS, and soybean GmCHS, respectively (where the horizontal axis represents the added enzyme, "WT" represents wild-type AtCHIL protein, "-" represents no wild-type AtCHIL protein added; "H36L" represents AtCHIL H36L mutant protein; the vertical axis represents relative activity, expressed as %). "", "and" (Represents the results of the significance analysis). Figure 20 Statistical graphs of in vitro enzyme activity analysis of Ginkgo biloba GbCHIL wild-type and H41L mutants and rice OsCHIL wild-type and H38L mutants (where the horizontal axis represents the added enzyme, "WT" corresponds to the wild-type CHIL protein of each species, "-" represents no wild-type CHIL protein added; "H41L" represents the GbCHIL H41L mutant protein; "H38L" represents the OsCHIL H38L mutant protein; the vertical axis represents relative activity, expressed as %). "", "and" (This represents the results of the significance analysis). Detailed Implementation

[0022] The following detailed description of the features and advantages of the present invention is sufficient to enable any person skilled in the art to understand the technical content of the present invention and implement it accordingly. Furthermore, based on the specification, claims and drawings disclosed herein, those skilled in the art can easily understand the related objects and advantages of the present invention.

[0023] All other terms used herein for special definition are intended to have the general meaning understood by one of ordinary skill in the art, and in particular, meaning that one of ordinary skill in the art, upon reading the claims, specification and drawings of this patent, can directly and without doubt determine how the technical solution of this patent can be implemented.

[0024] Even if there are incomplete descriptions, omissions, or ambiguities in the grammar, words, punctuation, graphics, symbols, etc. of the claims, specification, and drawings of this patent, a person skilled in the art can still arrive at the only correct understanding by reading the claims, specification, and drawings as a whole without extensive reasoning or experimentation, and effectively exclude various incorrect interpretations that are not aimed at achieving the purpose of this patent.

[0025] Unless otherwise specified, all embodiments and preferred embodiments mentioned herein can be combined to form new technical solutions.

[0026] Unless otherwise specified, all the technical features and preferred features mentioned herein can be combined to form new technical solutions.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0028] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0029] (1) Source of sample materials

[0030] In this embodiment, Arabidopsis thaliana ( Arabidopsis thaliana ), rice ( Oryza sativa ), soybeans Glycine max ),corn( Zea mays ) and Ginkgo ( Ginkgo biloba All materials were obtained from Shanghai Chenshan Botanical Garden and the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences.

[0031] Primer synthesis and sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0032] (2) Reagents and consumables and their sources

[0033] Plant RNA extraction kits were purchased from TIANGEN; All-in-one reverse transcription kits, homologous recombinases, and Phanta Max Master Mix kits were purchased from Novizan Biotechnology Co., Ltd.; restriction endonucleases were purchased from New England Biolabs (NEB); PCR gel extraction kits and plasmid extraction kits were purchased from Shanghai Huiling Biotechnology Co., Ltd.; sodium chloride, agarose, agar powder, yeast extract, tryptone, hydrochloric acid, and magnesium chloride were purchased from Sinopharm Chemical Reagent Co., Ltd.; ampicillin, kanamycin, and chloramphenicol were purchased from Sangon Biotech (Shanghai) Co., Ltd.; DNase I was purchased from Genscript Biotech Co., Ltd.; PMSF, IPTG, and Tris were purchased from BBI Life Sciences Co., Ltd.; Ni-NTA was purchased from Qiagen; PAGE gel rapid preparation kits were purchased from Shanghai Yamei Biomedical Technology Co., Ltd.; p-coumaroyl-CoA, malonyl-CoA, and naringenin were purchased from Shanghai Yuanye Biotechnology Co., Ltd.

[0034] E. coli Top10 was used for cloning, Rosetta (DE3) for protein expression, and pETDuet-1 vector for gene cloning and protein expression.

[0035] (3) Source of instruments and equipment

[0036] The C1000 gradient gene amplification system and 1658004 protein electrophoresis system were purchased from Bio-Rad; the TS-Power agarose gel electrophoresis system was purchased from Biotop; the UL3L12 stacked constant temperature shaker was purchased from Yonglian Biotechnology (Shanghai) Co., Ltd.; the Centrifuge 5418R concentrator (small) was purchased from Eppendorf; the 705-type -80℃ ultra-low temperature freezer, Sorvall LYNX6000 high-speed centrifuge, REC4504V chromatography cabinet, Nanodrop 2000 ultra-micro spectrophotometer, Heraeus multifugeX1R concentrator (large), and milli-q pure water system were products of Merck KGaA; the Tanon-2500 gel imaging system was purchased from Shanghai Tianneng; the BD-82DL-type -20℃ ultra-low temperature freezer was purchased from Qingdao Haier Special Electric Freezer Co., Ltd.; and the H3O... 3-100°C constant temperature metal bath purchased from Ginkgo Biloba Biotechnology (Beijing) Co., Ltd.; SW-CJ-1FD ultra-clean workbench purchased from AIRTECH; SX-700 high-pressure steam sterilizer purchased from TOMY Corporation, Japan; ZWY-211G 37°C constant temperature shaker and ZXGP-A2050 37°C constant temperature incubator purchased from Shanghai Zhicheng; U-1800 spectrophotometer and Himac CR7 benchtop centrifuge (large) purchased from HITACHI; UH-03 high-pressure cell disruptor purchased from Shanghai Yonglian; AKTA FPLC rapid protein liquid chromatograph purchased from GE Healthcare; S7S-8A transfer decolorization shaker purchased from Shanghai Qite Analytical Co., Ltd.; 28990944 Superdex 200 Increase purchased from Cytiva; Crystal Gryphon protein crystal automated workstation purchased from ARI; LEICA KL300 LED microscope purchased from Feica; PB-10 pH meter purchased from Statorius, FA1004A analytical balance purchased from Shanghai Jingtian, and VOTEX-5 vortex oscillator purchased from Kylin-Bell.

[0037] Example

[0038] A chalcone isomerase for enhancing chalcone synthase activity and its application, comprising the following steps: S1. Arabidopsis RNA extraction and cDNA acquisition, the specific steps are as follows: (1) RNA was extracted from Arabidopsis thaliana using a plant RNA extraction kit. The reagents shown below are all included in the plant RNA extraction kit. The steps are as follows: a. Sample pretreatment: Arabidopsis leaves were ground into powder in liquid nitrogen. A certain amount of powder was taken as a sample, and lysis buffer SG and Proteinase K were added. The mixture was immediately shaken vigorously and placed at room temperature. Then, it was centrifuged at 10,000 rpm / min for 5 min. b. Take the supernatant from step a into the DNA removal column and centrifuge again at 10000 rpm / min for 5 min; c. Add anhydrous ethanol to the filtrate obtained in step b, mix well, transfer to a CR4 adsorption column, centrifuge at 10000 rpm / min for 2 min and discard the waste liquid. Return the CR4 adsorption column to the collection tube. d. Add RW3 to the CR4 adsorption column, centrifuge at 10000 rpm / min for 2 min and discard the waste liquid. Return the CR4 adsorption column to the collection tube. e. Add washing solution RW to the CR4 adsorption column, let it stand at room temperature for a period of time, then centrifuge at 10000 rpm / min for 2 min and discard the waste liquid. Put the CR4 adsorption column back into the collection tube and repeat step e. f. Place the CR4 adsorption column in a clean bench to dry the washing solution, and transfer it to a new RNase-Free centrifuge tube. Add RNase-Free ddH2O to the CR4 adsorption column, incubate at room temperature for 10 min, and centrifuge at 10,000 rpm / min for 2 min to obtain Arabidopsis RNA.

[0039] (2) The Arabidopsis RNA extracted in step (1) above was reverse transcribed using the All-in-one Kit Reverse Transcription Kit. The reagents shown below are all included in the All-in-one Kit Reverse Transcription Kit.

[0040] The reverse transcription system was: 4 μL of 5x All-in-one qRT SuperMix, 1 μL of Enzyme Mix, 0.1 μg of Arabidopsis RNA, and RNase-free H2O added to 20 μL; the reverse transcription program was: 50℃, 15 min; 85℃, 5 s; to obtain Arabidopsis cDNA.

[0041] S2. Preparation and purification of CHS and CHIL proteins from Arabidopsis thaliana, the specific steps are as follows: (1) Carrier construction: CHS Fragment genes and CHIL The gene fragments were inserted into the expression vector pETDuet-1 to obtain the recombinant expression plasmids pETDuet-AtCHS and pETDuet-AtCHIL. The specific steps are as follows: Based on the Arabidopsis thaliana type IV chalcone isomerase (CHIL, nucleotide sequence as shown in SEQ ID NO.1, 630 bp (NM_180439.2:236-865); amino acid sequence as shown in SEQ ID NO.2, 209 aa (NP_850770.1)) and chalcone synthase (CHS, nucleotide sequence as shown in SEQ ID NO.3, 1188 bp (NM_121396.4:287-1474); amino acid sequence as shown in SEQ ID NO.4, 395 aa (NP_196897.1)) published on NCBI, gene-specific primers were designed using Snapgene software. The primer sequences are shown below: Table 1. Vector Construction CHS and CHIL Primer sequence listing of fragment genes

[0042] The first round of PCR reaction was performed separately. CHS Fragment genes and CHILThe amplification of the gene fragment involved a first-round PCR reaction consisting of 2 μL of Arabidopsis cDNA. CHS Fragment gene or CHIL 1 μL each of upstream and downstream primers (10 μM) for the gene fragment, 25 μL of 2 × Phanta Max Master Mix (high-fidelity enzyme), and ddH2O were added to bring the total volume to 50 μL. After mixing and brief centrifugation, the first round of PCR was performed. The first round of PCR was programmed as follows: pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 15 s, annealing at 61℃ for 15 s, and extension at 72℃ for 30 s. The denaturation to extension process was repeated 35 times. After that, a full extension at 72℃ for 5 min was performed, and the product was stored at 4℃. These were the first amplification products of CHS and CHIL, respectively.

[0043] After the first round of PCR, the first amplification products of CHS and CHIL were separated by 1.5% agarose gel electrophoresis. Bands of approximately 1200 bp and 650 bp were then excised using a UV gel cutter, and the DNA was recovered using an enhanced gel extraction kit to obtain the target gene. CHS and CHIL For specific agarose gel electrophoresis results, please refer to [link / reference]. Figure 1 .

[0044] target gene CHS and CHIL Homologous recombination ligation was performed with the pETDuet-1 vector. The enzyme ligation reaction system was as follows: target gene... CHS or CHIL 2 μL of pETDuet-1 backbone vector, 1 μL of CEII enzyme, 4 μL of CEII buffer, and 11 μL of ddH2O were added. After mixing, the mixture was reacted at 37°C for 30 min. CHS Connecting products and CHIL The ligation product should be stored at 4°C until use.

[0045] T10 competent cells were thawed on ice, and... CHS Connecting products and CHIL The ligation product was added to 50 μL of T10 competent cells, gently mixed, and immediately placed on ice for 30 min, followed by heat shock at 42°C in a metal / water bath for 30 s, and then immediately placed on ice for 2 min. Under aseptic conditions, the transformed bacterial culture was added to 1 mL of antibiotic-free LB liquid medium and incubated on a shaker at 37°C and 220 rpm for 1 h. CHS Transformation culture and CHIL Transform the bacterial culture. Then, take 200 μL. CHS Transformation culture and CHILThe transformed bacterial cultures were spread onto LB solid medium containing ampicillin resistance and incubated overnight at 37°C upside down, resulting in CHS first plates and CHIL first plates.

[0046] Single-clone plaques from the first CHS plate and the first CHIL plate were selected and cultured separately to obtain CHS first-clone bacterial suspension and CHIL first-clone bacterial suspension, respectively. 1 μL of each of the CHS first-clone bacterial suspension and CHIL first-clone bacterial suspension was then used for a second round of PCR. The second round PCR reaction system was: 5 μL of 2 × Rapid Taq Master Mix and 1 μL of either the first CHS or CHIL first-clone bacterial suspension. CHS Fragment gene or CHIL 0.5 μL each of the upstream and downstream primers (10 μM) for the gene fragment were added, and the volume was adjusted to 20 μL with ddH2O. The second round of PCR reaction program was as follows: pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 15 s, annealing at 61℃ for 15 s, and extension at 72℃ for 30 s. The denaturation to extension process consisted of 35 cycles, followed by a full extension at 72℃ for 5 min. CHS Second amplification product and CHIL The second amplification product was stored at 4°C for later use. And the... CHS Second amplification product and CHIL The second amplification product was detected by 1.5% agarose gel electrophoresis. CHS The fragment size is approximately 1200bp. CHIL The fragment size is approximately 650 bp. See the agarose gel electrophoresis verification image for details. Figure 2 .

[0047] Select CHS Second amplification product and CHIL The positive clones of the second amplification product were expanded and cultured on a shaker at 200 rpm and 37°C for approximately 12 h. After extracting the plasmid using a plasmid miniprep kit, an appropriate amount of plasmid was sent to Shanghai Sangon Biotech Co., Ltd., and sequencing was performed using universal primers DuetDOWN1: 5'- GATTATGCGGCCGTGTACAA -3' (SEQ ID NO.9) and pET Upstream: 5'-ATGCGTCCGGCGTAGA -3' (SEQ ID NO.10). The sequencing results were compared and analyzed; a similarity of 100% indicated successful construction of the recombinant protein plasmid vector. CHS Recombinant plasmids and CHIL Recombinant plasmids were stored at -20°C.

[0048] (2) Protein expression

[0049] The result obtained in step S2 (1) CHS Recombinant plasmids and CHIL The recombinant plasmid was transformed into *E. coli* Rosetta (DE3) competent cells. Except for the difference in competent cells, the transformation method was the same as in step S2 (1). After plating, the cells were incubated overnight at 37°C in an incubator. Single colonies from the CHS and CHIL plates were picked and cultured overnight in 20 mL of ampicillin-resistant LB broth to obtain the second CHS and CHIL monoclonal bacterial suspensions. After overnight culture, 20 mL of the CHS and CHIL monoclonal bacterial suspensions were inoculated into 2 L of ampicillin-resistant LB broth at a 1:100 ratio to obtain the first CHS and first CHIL amplified bacterial suspensions, respectively. These were then cultured in a shaker at 37°C and 220 rpm for approximately 4 h. The first amplified bacterial suspension was cultured until OD... 600 nm When the concentration is 0.5-0.7, add IPTG (isopropyl β-D-Thiogalactoside) to a final concentration of 0.5-1.0 mM, and induce at 16-40℃ for 10-20 h. That is, the lower the induction temperature, the longer the induction time. This is the first induction culture of CHS and the first induction culture of CHIL.

[0050] (3) Protein purification

[0051] The CHS first-induction bacterial culture and the CHIL first-induction bacterial culture were transferred to large centrifuge flasks and centrifuged at 4000 rpm for 15 min at 4°C. The supernatant was discarded, and the bacterial cell pellets were retained as CHS first pellet and CHIL first pellet, respectively. The CHS first pellet and CHIL first pellet were resuspended in Buffer A (20 mM Tris-HCl, pH 8.0, 100 mM NaCl) with 1 mM PMSF added, and the CHS first pellet and CHIL first pellet were resuspended separately to obtain CHS first resuspension and CHIL first resuspension, respectively. Cells were lysed using a high-pressure cell disruptor at 15000 psi (pounds per square inch) for 2 min. The lysate was aliquoted into 50 mL high-pressure centrifuge tubes and centrifuged at 20000 ×g for 45 min at 4°C. The supernatant obtained was CHS first supernatant and CHIL first supernatant, and the pellets were CHS second pellet and CHIL second pellet, respectively.

[0052] Take 2 mL of Ni 2+-NTA (nickel NTA affinity chromatography medium, abbreviated as nickel column): Equilibrate the nickel column with 20 mL of Buffer A (20 mM Tris-HCl, pH 8.0, 100 mM NaCl). Repeat the first supernatant of CHS and the first supernatant of CHIL twice each to obtain CHS flow-through buffer 1 and CHIL flow-through buffer 1. Flow through the nickel column with 40 mL of Buffer A (20 mM Tris-HCl, pH 8.0, 100 mM NaCl) containing 25 mM imidazole to remove impurities and obtain CHS flow-through buffer 2 and CHIL flow-through buffer 2. Flow through the nickel column with 30 mL of Buffer A (20 mM Tris-HCl, pH 8.0, 100 mM NaCl) containing 250 mM imidazole to elute proteins and obtain CHS eluent and CHIL eluent, respectively. Finally, wash the nickel column with 20 mL of ultrapure water and store the nickel column at 4°C.

[0053] Take the above CHS first supernatant, CHS second precipitate, CHS flow-through buffer 1, CHS flow-through buffer 2, and CHS elution buffer samples. Scrape a small amount of solid with a pipette tip and add 30 μL of Buffer A (20 mM Tris-HCl, pH 8.0, 100 mM NaCl). Take 40 μL of each liquid and mix with 10 μL of 5× loading buffer. Heat in a 99℃ metal bath for denaturation for 10 min, then centrifuge at 13000 rpm for 10 min. Perform SDS-PAGE electrophoresis at 200 V for 35 min. After electrophoresis, stain the PAGE gel with SDS-PAGE rapid staining solution and destain with tap water. A clear band of CHS protein at around 43 kDa was observed, indicating successful protein expression and good purity. Further experiments can be carried out. See the specific CHS protein expression and purification diagram. Figure 3 .

[0054] The following samples were collected: CHIL first supernatant, CHIL second precipitate, CHIL flow-through buffer 1, CHIL flow-through buffer 2, and CHIL elution buffer. The samples were then subjected to SDS-PAGE electrophoresis according to the above procedure. A clear band of CHIL protein at approximately 25 kDa was observed, indicating successful protein expression and good purity. Further experiments can proceed. See the detailed CHIL protein expression and purification diagram below. Figure 4 .

[0055] The CHS eluent and CHIL eluent were concentrated to 1 mL using 10 kDa concentration tubes, resulting in CHS concentrated protein and CHIL concentrated protein, respectively. The CHS protein concentration was approximately 7 mg / mL and the CHIL protein concentration was approximately 10 mg / mL, as determined by Bradford chromatography. A Superdex 200 Increase was connected to a rapid protein HPLC system, and Buffer A (20 mM Tris-HCl, pH 8.0, 100 mM NaCl) was pumped in at a flow rate of 0.4 mL / min until the UV absorption (280 nm) and conductivity baseline stabilized, with an equilibrium volume of 25 mL. After the procedure was completed, the CHS concentrated protein and CHIL concentrated protein were centrifuged at 12000 ×g for 10 min at 4 °C. The centrifuged concentrated protein was stored in a loading loop using a sampler. 25 mL of Buffer A (20 mM Tris-HCl, pH 8.0, 100 mM NaCl) was pumped in at a flow rate of 0.4 mL / min to allow the protein in the loading loop to flow through the Superdex 200 Increase. The flow of protein was monitored in real time using a UV detector (280 nm). The outflowing liquid was collected in 0.5 mL volumes. The UV absorbance monitoring graph of the CHS concentrated protein is shown below. Figure 5 As shown in the figure, the UV absorbance monitoring graph of CHIL concentrated protein is as follows. Figure 6 As shown. Proteins were collected based on the elution position of the UV absorbance values, with samples obtained in 0.5 mL units. The concentrated sample and the 0.5 mL collected sample were then subjected to SDS-PAGE processing, following the same steps as above. The SDS-PAGE image of the 0.5 mL collected protein sample is shown below. Figure 7 As shown, the SDS-PAGE image of the protein sample collected in 0.5 mL of CHIL is as follows. Figure 8 As shown. The remaining 0.5 mL of sample was flash-frozen in liquid nitrogen and stored at -80°C for later use.

[0056] The specific steps for identifying the enzyme activity of S3, CHS, and CHIL proteins are as follows: Using naringenin as a substrate, the in vitro functions of the target proteins CHS and CHIL were determined. The negative control without added protein was named CK-No Pr; the negative control without added substrate was named CK-No Sub; and the positive control was named NAR-STD (using naringenin standard samples as positive controls). Figure 9The in vitro enzyme activity reaction system was carried out in Tris HCl buffer containing p-coumaroyl-CoA, malonyl-CoA, and CHS protein, or simultaneously containing CHS and CHIL protein, at 35°C. The reaction was terminated by adding glacial acetic acid and methanol. After high-speed centrifugation, the supernatant was used for liquid chromatography-mass spectrometry (LC-MS). The supernatant was separated by a reverse-phase C18 column (Agilent® ZORBX SB-C18, 5 μm 4.6 × 150 mm) using an Agilent 1260 high-performance liquid chromatography (HPLC) system combined with a 6460 triple quadrupole LC-MS system. The sample was analyzed by electrospray ionization (ESI) in positive ion mode. The column temperature was maintained at 30°C, and the flow rate was 1 mL / min. A binary gradient system consisting of solvent A (methanol) and solvent B (water containing 0.1% formic acid) was used to provide a linear gradient from 30% A and 70% B to 80% A and 20% B within 20 minutes. Calibration was performed using a standard solution of a reference compound.

[0057] Figure 10 for Figure 9 Datafication, in Figure 10 In the figure, WT represents the unmutated wild-type protein. Figure A shows the proportion of the two products generated in the enzyme activity system with simultaneous addition of CHIL and CHS to the total product in the system with simultaneous addition of CHIL and CHS. Figure B shows the proportion of the two products generated in the enzyme activity system with CHS to the total product in the system with simultaneous addition of CHS. Figure C uses different data processing methods, with the total product obtained by simultaneous addition of CHS and CHIL enzyme activity as a control. The total product of both systems is divided by the total product of the enzyme activity system with simultaneous addition of CHS and CHIL, and the data of the main product is plotted.

[0058] The results showed that the enzyme activity of the main product obtained by simultaneously adding CHS and CHIL to the reaction system was twice that of the main product obtained by adding CHS only. Furthermore, with the simultaneous addition of CHS and CHIL, the proportion of the main product naringenin in the total product reached as high as 88%, with byproducts at 12%. However, with only CHS added, the proportion of the main product naringenin in the total product was only about 73%, with byproducts at 27%. This indicates that the addition of CHIL to the system doubled the enzyme activity of CHS and improved the product specificity of the CHS enzyme.

[0059] The preparation of the S4 and CHS-CHIL complex is detailed in the steps below: According to the carrier construction method described in step S2 (1), CHSThe gene fragment was constructed into the MCS2 cloning site of pETDuet-AtCHIL to obtain the recombinant plasmid pETDuet-AtCHIL-AtCHS. After successful sequencing, the recombinant plasmid was transformed into E. coli Rosetta (DE3) competent cells. According to the protein expression and purification steps described in steps (2) and (3) of S2, a protein complex with high purity was obtained by affinity column chromatography and molecular sieving.

[0060] The results are as follows Figure 11 and Figure 12 As shown in the molecular sieve image, the CHS-CHIL complex has two peaks. Analysis of the SDS-PAGE results indicates that... Figure 11 The first peak is the CHS-CHIL complex, while the second peak mainly contains the CHIL protein.

[0061] Select Figure 11 The CHS-CHIL complex protein, which was the first peak in the protein, was screened for crystallization using conventional methods. The protein was concentrated to 10 mg / mL. After trying various temperatures and different buffer systems, CHS-CHIL complex protein crystals were finally obtained at 20 °C by gas-phase diffusion drop method with 0.5 μL of protein and 0.5 μL of crystallization solution (0.2 M trimethylamine-N-oxide hydrate, 0.1 M Tris pH 8.5, 20% (w / v) polyethylene glycol monomethyl ether 2000).

[0062] S5. Mutant design, CHS and CHIL protease activity detection and analysis, please refer to the following steps: (1) The structure of the CHS-CHIL complex protein crystal obtained in step S4 above was analyzed. X-ray diffraction experiments were performed using the Shanghai Synchrotron Radiation Facility, and high-resolution diffraction data were collected. By comparing the structure of CHIL in the CHS-CHIL complex crystal structure with that of Arabidopsis thaliana type IV chalcone isomerase (AtCHIL) (PDB ID 4DOK), it was found that the main difference lies in the position of β-Hairpin (e.g., Figure 13 (As shown). It was found that the H36 residue located in AtCHIL β-Hairpin may affect the position and orientation of residue F220 through hydrophobic interactions with the residue (e.g.). Figure 14 (As shown).

[0063] (2) Further comparison of the amino acid sequences of CHS from different species revealed that amino acid residues V215, L219, and F220 of AtCHS and residue H36 of AtCHIL are highly conserved in plants (e.g. Figure 15(As shown). Furthermore, the 1999 study on the structure of alfalfa CHS also showed that the F220 site was defined as one of the key residues for forming the active site of CHS, providing van der Waals interactions for substrate binding and further participating in the catalytic process.

[0064] (3) Further study the important role of amino acid 36 of AtCHIL and amino acids 215, 219, 220 and 271 of AtCHS in the catalytic process. The relevant point mutations in step S5 (2) above were introduced by overlap PCR, and primers were designed (as shown in Table 2).

[0065] The steps of the two rounds of PCR reaction at CHIL are as shown in step S2 (1) above, wherein the first round of PCR reaction is as follows: CHIL upstream primer of fragment gene (SEQ ID NO.1) CHIL -F (SEQ ID NO.7) and the R primer for the mutation site (see Table 2 for details) were cloned and recovered as fragment 1. CHIL Downstream primer of fragment gene (SEQ ID NO.1) CHIL -R (SEQ ID NO.8) and the F primer for the mutation site (see Table 2 for details) were cloned and recovered as fragment 2. A second round of PCR was then performed using... CHIL upstream primer of fragment gene (SEQ ID NO.1) CHIL -F (SEQ ID NO.7) and downstream primer CHIL -R (SEQ ID NO. 8) was used as a primer, and the recovered fragments 1 and 2 were added as templates for gene amplification; the two rounds of PCR reactions for AtCHS were performed in the same manner as those for AtCHIL, and the results showed that both AtCHS and AtCHIL amplification were successful. Figure 16 ).

[0066] Table 2. Primer sequence list for mutant PCR

[0067]

[0068] (4) Following the steps shown in (1) of step S2 above, the AtCHIL and AtCHS related mutants were constructed into the pETDuet-1 vector to obtain mutant homologous recombination vectors, and sent to Sangon Biotech for sequencing. The sequencing results were correct.

[0069] Following steps (2) and (3) of S2 above, the successfully sequenced homologous recombination vector was transferred into Rosetta (DE3) competent cells for mutant protein expression and purification. The results are as follows: Figure 17 As shown, this indicates that protein expression was successful.

[0070] The AtCHIL mutant protein and AtCHS mutant protein obtained above were subjected to enzyme activity tests. The enzyme activity test steps and data processing methods were the same as in step S3 above. The enzyme activity data of wild-type AtCHS or wild-type AtCHIL were added at the same time as "1" for data normalization.

[0071] The results are as follows Figure 18 As shown, these mutated amino acid residues have different side chain sizes and charges. Replacing the 36th position of AtCHIL with valine (H36V), charged residues (H36D and H36E), or polar residues (H36Y and H36N) severely impairs the function of AtCHIL, while replacing it with hydrophobic amino acid residues (H361, H36F, and H36W) results in a product distribution similar to that of the wild-type CHIL. Replacing histidine with methionine or leucine (H36M or H36L) significantly increased the content of naringenin, with increases of 39% and 79% respectively, and its proportion in the total product also increased from 88% to 91% or 95%. Enzyme activity assays of the H36E / F37T double mutant showed that the H36E / / F37T double mutant significantly increased enzyme activity by about 18%. However, enzyme activity assays of replacing the 220th position of AtCHS with alanine (F220A), the 271st position with alanine (F271A), or the V215A / L219A double mutant showed that the function of AtCHS was severely impaired, making it impossible to synthesize naringenin and the main product.

[0072] (5) Further testing was conducted on rice CHS (nucleotide sequence: NM_001423410.1, 1197bp, amino acid sequence: NP_001410339.1), maize CHS (nucleotide sequence: NM_001148774.1, 1203bp, amino acid sequence: NP_001142246.1), and soybean CHS (nucleotide sequence: NM_001353380.1, 1170bp, amino acid sequence: NP_001340309.1) using the AtCHIL H36L mutant. Following the method shown in step S1 above, the CHS of rice, maize, and soybean were constructed into the pETDuet-1 vector using the primer sequences shown in Table 3, respectively, to obtain homologous recombination vectors of rice, maize, and soybean, and sent to Sangon Biotech for sequencing. The sequencing results were correct.

[0073] Then, following steps S2 (2) and (3) above, the obtained homologous recombinant vectors of rice, corn and soybean were transformed into Escherichia coli Rosetta (DE3) for mutant protein expression and purification, and purified rice CHS protein (OsCHS), corn CHS protein (ZmCHS) and soybean CHS protein (GmCHS) were obtained respectively.

[0074] Table 3 Primer sequence list for constructing CHS homologous recombination vectors from rice, maize, and soybean.

[0075] Following the method shown in step S3 above, the AtCHIL H36L mutant protein was subjected to enzyme activity tests with OsCHS, ZmCHS and GmCHS proteins, respectively.

[0076] The results are as follows Figure 19 As shown, the Arabidopsis thaliana AtCHIL H36L mutant significantly enhanced the enzyme activity of CHS in different species compared to those without the AtCHIL H36L mutant.

[0077] (6) Further mutations were performed on the histidine residues at the β-hairpin sites of Ginkgo CHIL (amino acid sequence as shown in SEQ ID NO.47) and rice CHIL (amino acid sequence XP_015616444.1, as shown in SEQ ID NO.48). Following the method shown in step S5 (3) above, H38L and H41L mutants were generated at the corresponding sites of Ginkgo and rice CHIL, respectively. Using the primer sequences shown in Table 4, Ginkgo and rice CHIL were constructed into the pETDuet-1 vector, respectively, to obtain homologous recombination vectors of Ginkgo and rice, which were then sent to Sangon Biotech for sequencing. The sequencing results were correct.

[0078] Table 4. Primer sequence list for constructing homologous recombination vectors and mutants of Ginkgo CHS and CHIL, and rice CHIL.

[0079] As shown in steps (2) and (3) of S2 above, the obtained Ginkgo and rice homologous recombinant vectors were transformed into Escherichia coli Rosseta (DE3) for protein expression and purification, and purified unmutated Ginkgo CHIL protein (GbCHIL), mutant Ginkgo CHIL protein (GbCHIL H41L), unmutated Ginkgo CHS protein (GbCHS), unmutated rice CHIL protein (OsCHIL), and mutant rice CHIL protein (OsCHIL H38L) were obtained respectively.

[0080] Then, following the method shown in step S3 above, enzyme activity tests were performed on the GbCHIL H41L mutant protein and the GbCHS protein, and on the OsCHIL H38L and the OsCHS protein obtained in step (5) above.

[0081] The results are as follows Figure 20 As shown, the Ginkgo GbCHIL H41L mutant protein significantly enhanced the activity of Ginkgo Glucose CHS compared to GbCHIL, significantly enhancing CHIL-mediated CHS regulation with an activity increase of 14%, both of which were higher than the CHS activity of the untreated GbCHIL protein. Similarly, the Rice OsCHIL H38L mutant protein significantly enhanced the activity of Rice CHS compared to OsCHIL, both of which were higher than the CHS activity of the untreated OsCHIL protein, and also significantly enhanced CHIL-mediated CHS regulation with an activity increase of 20%.

[0082] In some other specific embodiments, the histidine residues located on the β-hairpin can be mutated using corn CHIL (amino acid sequence NP_001151452.1, as shown in SEQ ID NO. 61), soybean CHIL (amino acid sequence NP_001242041.2, as shown in SEQ ID NO. 62), or wheat CHIL (amino acid sequence XP_044388066.1, as shown in SEQ ID NO. 63), respectively. Enzyme activity tests are then performed with the corresponding ZmCHS, GmCHS, and TaCHS proteins of the respective species. The results are consistent with... Figure 20 Similarly, the mutant proteins all exhibited significant enhancing activity for the corresponding species' CHS, and extremely significant enhancing activity for the corresponding species' CHS without the added mutants.

[0083] In other specific embodiments, *Selaginella tamariscina* CHIL (amino acid sequence XP_024522917.1, as shown in SEQ ID NO. 64), *Limonium sinense* CHIL (amino acid sequence PTQ28039.1, as shown in SEQ ID NO. 65), *Moss simonii* CHIL (amino acid sequence XP_024374172.1, as shown in SEQ ID NO. 66), CHIL2 (amino acid sequence XP_024366584.1, as shown in SEQ ID NO. 67), *Adiantum capillus-veneris* CHIL (amino acid sequence QDF63002.1, as shown in SEQ ID NO. 68), or *Tomato* CHIL (amino acid sequence XP_010321455.1, as shown in SEQ ID NO. 69) can be used to mutate the histidine residues on β-hairpin, and then perform enzyme activity tests with the corresponding species' CHS proteins. The results are consistent with... Figure 20 Similarly, the mutant proteins all exhibited significant enhancing activity for the corresponding species' CHS, and extremely significant enhancing activity for the corresponding species' CHS without the added mutants.

[0084] In summary, located The amino acids in -hairpin, especially the H36 amino acid residue, are crucial for CHIL to regulate CHS activity. Among them, the H36L mutation significantly enhances the function of wild-type CHIL (unmutated CHIL protein) in various plants, confirming its conserved regulatory role in chalcone biosynthesis.

[0085] Therefore, it can be concluded that this application provides a chalcone isomerase that enhances chalcone synthase activity and its application. Type IV chalcone isomerase can bind to chalcone synthase, regulating its activity and product specificity. This is achieved by targeting the chalcone isomerase located on... Mutating the amino acids of -hairpin, especially the H36 amino acid residue, can significantly increase the yield of naringenin in the total product, raising the content of naringenin in the total product to 90% or more. This can be used in the field of biosynthesis for the industrial-scale production of flavonoid compounds.

[0086] The terminology and expressions used herein are for descriptive purposes only, and the invention should not be limited to these terms and expressions. The use of these terms and expressions does not imply the exclusion of any illustrative and descriptive equivalents (or parts thereof), and it should be recognized that various modifications that may exist should also be included within the scope of the claims. Other modifications, variations, and substitutions may also exist. Accordingly, the claims should be considered to cover all such equivalents.

[0087] Similarly, it should be noted that although the present invention has been described with reference to the specific embodiments described above, those skilled in the art should recognize that the above embodiments are only used to illustrate the present invention, and various equivalent changes or substitutions can be made without departing from the spirit of the present invention. Therefore, any changes or modifications to the above embodiments within the scope of the essential spirit of the present invention will fall within the scope of the claims of the present invention.

Claims

1. A chalcone isomerase that enhances the activity of chalcone synthase, characterized in that, The amino acid sequence of the chalcone isomerase has a mutation H36L at position 36 on the top of β-Hairpin, compared to Arabidopsis thaliana AtCHIL. Alternatively, the amino acid sequence of the chalcone isomerase has a mutation H36M at position 36 on top of β-Hairpin compared to SEQ ID NO.2; Alternatively, the amino acid sequence of the chalcone isomerase has a mutation H36E at position 36 on top of β-Hairpin and a mutation F37T at position 37, compared to SEQ ID NO.2; The amino acid sequence of the Arabidopsis thaliana AtCHIL is shown in SEQ ID NO.

2.

2. The chalcone isomerase for enhancing chalcone synthase activity according to claim 1, characterized in that, The amino acid sequence of the chalcone isomerase is selected from any of the following amino acid sequences, or has at least 80%, 85%, 90%, 95%, 98%, or 99% homology: SEQ ID NO.47, SEQ ID NO.48, SEQ ID NO.61, SEQ ID NO.62, SEQ ID NO.63, SEQ ID NO.64, SEQ ID NO.65, SEQ ID NO.66, SEQ ID NO.67, SEQ ID NO.68 or SEQ ID NO.69; The chalcone isomerase is derived from any one of Arabidopsis thaliana, Ginkgo biloba, rice, corn, soybean, wheat, Selaginella tamariscina, Larix tigrinosa, Bryophytum comosum, Pteris vittata, Pteris thunbergii, tomato, or rice.

3. The chalcone isomerase for enhancing chalcone synthase activity according to any one of claims 1-2, characterized in that, The chalcone isomerase can increase the yield of naringenin.

4. A gene encoding a chalcone isomerase that enhances the activity of chalcone synthase as described in claim 3.

5. A plant individual, plant tissue, or plant cell comprising the encoding gene as described in claim 4.

6. A recombinant vector comprising the coding gene as described in claim 4.

7. A recombinant cell or recombinant bacterium comprising the recombinant vector as described in claim 6.

8. A flavonoid compound, characterized in that, The flavonoid compounds are extracted from the plant individuals, plant tissues, or plant cells as described in claim 5.

9. The use of a chalcone isomerase that enhances chalcone synthase activity as described in any one of claims 1-2 in increasing the content of flavonoid compounds or improving enzyme activity.

10. The application according to claim 9, characterized in that, The specific application is as follows: Step A: Modify the endogenous CHIL gene of the target plant so that the endogenous CHIL gene of the target plant encodes the chalcone isomerase; the modification is mutagenesis or gene editing; Step B: Construct a recombinant vector using the modified endogenous CHIL gene of the target plant from Step A, and transform the recombinant vector into the target plant; The target plants are wheat, rice, barley, oats, corn, sorghum, sugarcane, water bamboo, millet, buckwheat, sorghum, sesame, cotton, soybean, peanut, sweet potato, potato, apple, tobacco, mint, sunflower, cucumber, eggplant, zucchini, pumpkin, winter melon, bitter melon, loofah, cucumber, watermelon, cantaloupe, leek, scallion, onion, leeks, spinach, lettuce, rapeseed, tomato, lettuce, garland chrysanthemum, blueberry, grape, salvia miltiorrhiza, okra, quinoa, purslane, asparagus, and goji berries. Ginseng, Polygonum multiflorum, Angelica sinensis, American ginseng, dragon fruit, kiwifruit, ginkgo, camphor tree, Masson pine, Chinese pine, white pine, Podocarpus macrophyllus, Pinus armandii, Pinus armandii, Dabie Mountain five-needle pine, red pine, red pine, black pine, Huangshan pine, Yunnan pine, golden larch, Scots pine, cedar, cocoa, coffee tree, rubber, coconut, oil palm, areca nut, pepper, sisal, lemongrass, cashew, fern, South China hairy fern, Selaginella tamariscina, Lysimachia christinae, Nephrolepis cordifolia, Acer tectorum, Dryopteris crassirhizoma, Acer tectorum, Acer tectorum, Cibotium barometz, or Dryopteris crassirhizoma.