Nucleic acid aptamer a4-ca2 with high affinity for vibrio parahaemolyticus and applications thereof

By performing chimeric allosteric modification on the original aptamer A4 to form a double-stranded complementary hairpin structure, the binding affinity and stability of nucleic acid aptamer A4-CA2 with Vibrio parahaemolyticus were improved, solving the problem of insufficient affinity in the existing technology and achieving high-sensitivity detection.

CN121574991BActive Publication Date: 2026-04-21OCEAN UNIV OF CHINA
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
OCEAN UNIV OF CHINA
Filing Date
2026-01-26
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing technologies lack sufficient affinity for nucleic acid aptamers against Vibrio parahaemolyticus, limiting detection sensitivity and practicality.

Method used

The original aptamer A4 was modified using chimeric allosteric technology to form a more stable double-stranded complementary hairpin structure. Through the synergistic effect of key base fragments, the binding potential and stability of the aptamer to the target were improved.

Benefits of technology

It significantly improved the affinity of nucleic acid aptamer A4-CA2 for Vibrio parahaemolyticus, reducing the affinity dissociation constant to 76.5 nM, and exhibited good specificity, making it suitable for the specific detection of Vibrio parahaemolyticus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574991B_ABST
    Figure CN121574991B_ABST
Patent Text Reader

Abstract

This invention discloses a nucleic acid aptamer A4-CA2 with high affinity for Vibrio parahaemolyticus and its applications, belonging to the field of nucleic acid aptamer technology. The nucleotide sequence of the nucleic acid aptamer A4-CA2 with high affinity for Vibrio parahaemolyticus is shown in SEQ ID NO.2. The invention also discloses the application of the nucleic acid aptamer A4-CA2 in the detection of Vibrio parahaemolyticus and in the preparation of products for detecting Vibrio parahaemolyticus. The nucleic acid aptamer A4-CA2 of this invention has an affinity dissociation constant of 76.5 nM with Vibrio parahaemolyticus, exhibiting high affinity. It shows no significant binding to Escherichia coli, Staphylococcus aureus, Aeromonas salmonidae, and Bacillus cereus, demonstrating good specificity and making it suitable for the specific detection of Vibrio parahaemolyticus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a nucleic acid aptamer A4-CA2 with high affinity for Vibrio parahaemolyticus and its application, belonging to the field of nucleic acid aptamer technology. Background Technology

[0002] Vibrio parahaemolyticus, a Gram-negative halophilic bacterium widely distributed in nearshore environments and seafood, is a significant foodborne pathogen globally. Humans are primarily infected through the ingestion of contaminated seafood (such as shellfish, shrimp, and crab), leading to acute gastroenteritis with symptoms including diarrhea, vomiting, and fever. In severe cases, it can cause sepsis and even death. With increasingly frequent global seafood trade and changes in marine environments, the risk of outbreaks of Vibrio parahaemolyticus-related foodborne illnesses persists, posing a significant threat to human health. Therefore, establishing rapid, accurate, and sensitive detection technologies is crucial for ensuring food safety and effectively controlling the spread of disease.

[0003] Aptamers are single-stranded DNA or RNA molecules obtained through in vitro screening (SELEX) techniques, capable of binding to targets with high affinity and specificity. Aptamers possess significant advantages such as ease of chemical synthesis and modification, high stability, minimal batch-to-batch variability, and a broad target range, and have been widely used as recognition elements in various biosensors. While there are reports on aptamers targeting Vibrio parahaemolyticus, the reported aptamers exhibit insufficient affinity for the target, specifically in terms of affinity dissociation constants. K d The value is in the μM range, which limits its detection sensitivity and practicality. Summary of the Invention

[0004] In view of the above-mentioned prior art, the present invention provides a nucleic acid aptamer A4-CA2 with high affinity for Vibrio parahaemolyticus and its application, which belongs to the field of nucleic acid aptamer technology.

[0005] This invention is achieved through the following technical solution:

[0006] A nucleic acid aptamer A4-CA2 with high affinity for Vibrio parahaemolyticus, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0007] The application of the nucleic acid aptamer A4-CA2, which has a high affinity for Vibrio parahaemolyticus, in the detection of Vibrio parahaemolyticus.

[0008] The application of the nucleic acid aptamer A4-CA2, which has a high affinity for Vibrio parahaemolyticus, in the preparation of products for detecting Vibrio parahaemolyticus.

[0009] The nucleic acid aptamer A4-CA2 of this invention has an affinity dissociation constant of 76.5 nM with Vibrio parahaemolyticus, exhibiting high affinity; it shows no significant binding to Escherichia coli, Staphylococcus aureus, Aeromonas salmonidae, and Bacillus cereus, demonstrating good specificity and making it suitable for the specific detection of Vibrio parahaemolyticus.

[0010] The nucleic acid aptamer A4-CA2 of this invention is obtained by modifying the original aptamer A4. The modification method is as follows: First, the Vibrio parahaemolyticus aptamer is obtained by cell-SELEX screening and truncation as the original aptamer. Then, chimeric allosteric modification is performed on key base fragments. The loop region of the hairpin structure participates in pairing, and the original single-stranded loop is reduced to form a longer double-stranded complementary region, improving the overall stability of the structure. The modification method of this invention has dual advantages: on the one hand, by adding key base fragments, the binding potential of the aptamer to the target is effectively improved without secondary screening; on the other hand, the chimeric potential of the bases is used for chimerism, making the aptamer structure more stable. Compared with the limitations of traditional aptamer modification methods such as truncation or mutation, this invention reconstructs the recognition element through "chimeric allosteric modification" technology, transforming the hairpin structure of the original aptamer into a hairpin structure containing a more stable double-stranded structure, providing a new path for bacterial aptamer modification.

[0011] This invention targets the original aptamer with a hairpin structure and employs a chimeric allosteric enhancement strategy to transform it into a more stable hairpin structure with complementary double-strand regions. Through the synergistic effect of key bases, the stability and binding affinity of the aptamer are significantly improved, which is of great significance for the detection of Vibrio parahaemolyticus.

[0012] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Attached Figure Description

[0013] Figure 1 Affinity test results for the original aptamer A4.

[0014] Figure 2 Secondary structure prediction of the original aptamer A4.

[0015] Figure 3 Results of affinity determination for modified aptamer A4-CA2.

[0016] Figure 4 Secondary structure prediction of the modified aptamer A4-CA2.

[0017] Figure 5 Laser confocal fluorescence image of modified aptamer A4-CA2 binding to Vibrio parahaemolyticus.

[0018] Figure 6 Results of affinity determination for modified aptamer A4-CA3.

[0019] Figure 7 Prediction of the secondary structure of the modified aptamer A4-CA3.

[0020] Figure 8 : A comparison of the binding of blank samples, random sequences, and modified aptamer A4-CA2 to Vibrio parahaemolyticus.

[0021] Figure 9 Fluorescence intensity diagrams of different concentrations of random sequences after interaction with Vibrio parahaemolyticus.

[0022] Figure 10 : Specific binding analysis of modified aptamer A4-CA2 based on flow cytometry. Detailed Implementation

[0023] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.

[0024] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0025] This invention employs flow cytometry combined with fluorescence labeling technology to determine the affinity of aptamers for targets. Flow cytometry is a biological technique used to study the characteristics of cells and biological particles. By analyzing the average fluorescence intensity of positive bacteria, the binding ability of the bacteria is indirectly assessed. A higher average fluorescence intensity indicates a greater number of molecules bound to the cell surface, indicating a stronger binding ability. Software analysis can further determine the affinity dissociation constant of the aptamer for the target (…). K d The test conditions were as follows: Flow rate-medium; Events to display=10,000; Number of SIT Flushes=1; FSC-Voltage=327.9, Threshold=9,000; SSC-Voltage=402.2, Threshold=5,000; Experimental group: positive bacteria group; Control group: negative bacteria blank tube.

[0026] Example 1: Determination of Affinity and Prediction of Secondary Structure of Primitive Aptamer A4

[0027] Since the hairpin structure is a widely existing basic conformation in aptamers, this invention aims to modify and optimize aptamers with this structure in order to further improve the structural stability of aptamers and enhance their affinity.

[0028] This invention selects an aptamer A4, which has a typical hairpin structure and targets Vibrio parahaemolyticus, as the original aptamer. Its nucleotide sequence is shown in SEQ ID NO.1, as follows (direction 5'-3'):

[0029] CAACGAAACAGTGACTCGTTG; a total of 21 bases.

[0030] The affinity of primitive aptamer A4 was determined. The results of the affinity determination of primitive aptamer A4 are as follows: Figure 1 As shown in the figure. The results indicate that the original aptamer A4 exhibits good affinity for Vibrio parahaemolyticus and is suitable for subsequent experiments.

[0031] The secondary structure of primitive aptamer A4 was predicted using the online tool "The UNAFold web server". Results: The predicted secondary structure of primitive aptamer A4 is as follows: Figure 2 As shown.

[0032] Example 2: Modification of the original aptamer

[0033] To obtain an improved aptamer with higher affinity, the original aptamer A4 was modified and optimized using the chimeric key sequence principle. A chimeric allosteric transformation was performed between the original aptamers A14 and C15 to obtain an improved sequence containing twice the key sequence; the modified aptamer was named A4-CA2.

[0034] The nucleotide sequence of the modified aptamer A4-CA2 is shown in SEQ ID NO.2, as shown below (direction 5'-3'):

[0035] CAACGAAACAGTGATTCAGTGACTCGTTG; a total of 29 bases.

[0036] The modified aptamer underwent affinity testing and verification. The affinity test results for the modified aptamer A4-CA2 are as follows: Figure 3 As shown, the secondary structure prediction of the modified aptamer A4-CA2 is as follows: Figure 4 As shown in the image, the modified aptamer exhibits approximately 5 times higher affinity and lower free energy compared to the original aptamer. This indicates that chimeric modification not only significantly enhances the aptamer's affinity but also makes the secondary structure more stable. The laser confocal fluorescence image of the modified aptamer A4-CA2 binding to Vibrio parahaemolyticus is shown in the image. Figure 5 As shown in the image, the bacteria exhibit green fluorescence, confirming that the two successfully bound together.

[0037] Example 3: Further modification of the improved aptamer A4-CA2

[0038] The results of Example 2 show that aptamers with higher affinity can be obtained through chimeric allosteric modification. Based on this, further chimerism of key sequences was performed, resulting in an improved sequence containing three times the key sequence after chimerism between A22 and C23. The modified aptamer was named A4-CA3.

[0039] The nucleotide sequence of the modified aptamer A4-CA3 is shown in SEQ ID NO.3, as shown below (direction 5'-3'):

[0040] CAACGAAACAGTGATTCAGTGATTCAGTGACTCGTTG; a total of 37 bases.

[0041] The affinity of the modified aptamer was determined and verified. The affinity test results for the modified aptamer A4-CA3 are as follows: Figure 6 As shown, the secondary structure prediction of the modified aptamer A4-CA3 is as follows: Figure 7 As shown in the figure. The results indicate that the chimeric aptamer has increased affinity for the target.

[0042] The affinity determination results of the original aptamer A4, the modified aptamer A4-CA2, and the modified aptamer A4-CA3 are shown in Table 1.

[0043] Table 1

[0044]

[0045] As shown in Table 1, the chimeric allosteric aptamers exhibit high affinity, with the affinity increasing by up to approximately 4.9 times compared to the original aptamers. Among them, the modified aptamer A4-CA2 demonstrates the most outstanding affinity, achieving an affinity dissociation constant of 76.5 nM with Vibrio parahaemolyticus. This invention formally names it aptamer A4-CA2.

[0046] The binding of aptamer A4-CA2 to Vibrio parahaemolyticus was validated by testing a random sequence (A4-N). A4-N consisted of a random fragment of 29 arbitrary bases (A, C, G, or T) (the same number of bases as A4-CA2). Flow cytometry combined with fluorescent labeling was used to detect the binding of A4-N to Vibrio parahaemolyticus. Results: The binding of blank samples, random sequences, and modified aptamer A4-CA2 to Vibrio parahaemolyticus was compared as follows. Figure 8 As shown, the random sequence does not bind to Vibrio parahaemolyticus; the fluorescence intensity diagrams after interaction of different concentrations of random sequence with Vibrio parahaemolyticus are shown in the figure. Figure 9As shown, no significant change in fluorescence intensity was observed with increasing random sequence concentrations (100, 200, 400, 800, 1000, 1600 nM). This indicates that the affinity of the chimeric aptamers of this invention depends on the "enhancing effect of chimeric alteration," rather than random combination. The chimeric aptamers can achieve recognition of multiple binding sites, thereby enhancing the binding strength with the target.

[0047] Example 4: Specificity determination of modified aptamer A4-CA2

[0048] To verify the specificity of the aptamer, this study used common pathogenic bacteria and dominant spoilage bacteria in aquatic products (including *Escherichia coli*, *Staphylococcus aureus*, *Aeromonas salmonidae*, and *Bacillus cereus*) for specificity testing. Flow cytometry combined with fluorescent labeling was used to detect the specific binding of the modified aptamer A4-CA2 to *Escherichia coli*, *Staphylococcus aureus*, *Aeromonas salmonidae*, and *Bacillus cereus*. The specific binding analysis of the modified aptamer A4-CA2 based on flow cytometry is shown below. Figure 10 As shown in the figure. The experimental results showed that aptamer A4-CA2 did not show significant changes in fluorescence intensity for any of the four bacteria, indicating that the modified aptamer A4-CA2 has a high affinity for Vibrio parahaemolyticus, but does not specifically bind to common pathogenic bacteria.

[0049] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.

Claims

1. A nucleic acid aptamer A4-CA2 with high affinity for Vibrio parahaemolyticus, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

2.

2. The application of the nucleic acid aptamer A4-CA2 with high affinity for Vibrio parahaemolyticus as described in claim 1 in the preparation of products for detecting Vibrio parahaemolyticus.

Citation Information

Patent Citations

  • Nucleic acid aptamer of vibrio parahaemolyticus, application of nucleic acid aptamer, and kit and method for detecting vibrio parahaemolyticus

    CN106916823A

  • Optimized aptamer sequence capable of specifically identifying vibrio parahaemolyticus, and application thereof

    CN110093350A