MUC15 gene segment and expression vector construction and expression vector transfection method thereof
By constructing and transfecting the MUC15 gene expression vector, the lack of research on triglyceride and fatty acid synthesis in buffalo mammary epithelial cells was addressed, resulting in an increase in milk fat content and a significant enhancement in the mRNA expression of related genes in buffalo milk.
Patent Information
- Application Number
- CN202511752386.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-26
- Publication Date
- 2026-02-27
AI Technical Summary
Existing technologies lack research on the effects of the MUC15 gene on the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells, which affects the improvement of milk fat content in buffalo milk.
A MUC15 gene expression vector was constructed and transfected into buffalo mammary epithelial cells. By adding prolactin to simulate the lactation environment, the mRNA expression level of related genes was detected, and the effect on gene expression was analyzed using real-time quantitative PCR technology.
It significantly improved the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells, increased the milk fat content in buffalo milk, and detected significant changes in the expression levels of related gene mRNAs.
Smart Images

Figure CN121574992A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, specifically to a MUC15 gene fragment, its expression vector construction, and a method for transfecting the expression vector. Background Technology
[0002] As an important source of milk, buffalo dairy products have significant economic and nutritional value worldwide. Buffalo milk is rich in nutrients such as milk fat, milk protein, lactose, and minerals, making it highly sought after in the market. Furthermore, buffalo milk is a crucial raw material for producing dairy products such as cheese, yogurt, and butter, thus possessing significant economic value.
[0003] Milk fat percentage is a key factor reflecting the quality of buffalo milk, and triglycerides are the main component of milk fat. Improving milk fat synthesis in buffalo milk is crucial for studying its economic benefits. However, at the molecular level, there is a lack of research on the influence of the MUC15 gene on triglyceride formation and fatty acid formation. Summary of the Invention
[0004] The purpose of this invention is to provide a method for constructing an expression vector of the MUC15 gene fragment and transfecting the expression vector, with the aim of using buffalo mammary epithelial cells containing the MUC15 gene fragment to synthesize triglycerides and fatty acids.
[0005] To achieve the above objectives, the present invention provides a MUC15 gene fragment that affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells, the nucleotide sequence of which is shown in SEQ ID No. 1: ATGTTGACTTCAGCCAAAATTCTGTTGATTTCAATTTTGTCTAGTTTACTATTGTTTGGAAGCCATGGGGAAGAAAGTCAAAAAACAAACACAACAGAAAGCACTGCAGAAGACTTAAAAACAGGGGGAAATCAATCTGTCCCTTTAGAAAGTAAAGCAAATTTAACCTCAGATAAAGAAAATAGAGAAACCTCCAGCCCCAAAGCAAGTAATTTCCCTTTTGAGGATCCATCAAATAAAACACATGAAACAGGTTTCTACAGTAATCTGTCAACAGACAACTCTTCCAGGAGTCCAAGCCTCATGCCTACACTTTCCCCAAGATCTCCCTCAATCCACAGCTTTGTTTCTAAACTGCCTTGGAACTCATCCATAGCAGATAACAGTCTTCTGCCAGCTTCAGCCCCTCCCAATATCACAGTTTCTGTATCTTCAGAAAACTTTACCCTGTCTTCCATCAATGATACCATGGAAGCGCCTGACAACAGTTCCATTACAGTTAGCAACCTCCCTTCAGGACCAAACACCACATCTGTGACCCCCATGGTAACAGACGGATGGCCTACCACAACCAGAGAGAGCGTGGAGGGGTTTACTGTCTATCAAGAAACAACTTTACATCCCACCCTGAAATTCACCAATAATTCAAAAATCTTTCCAAATACGTCAGACCCCCAAGAAGAGAACAGAAATACAGGAGTGGTGTTTGGGGCCATTTTAGGTGCTATTCTGGGTGCTTCATTGCTTAGTCTTGTTGGCTACCTTTTATGTGGAAAAAGGAAAACAGATTCATTTTCCCATCGGCGACTTTATGACGACAGAAATGAACCAGTTCTGCGATTAGATAATGCACCGGAACCTTATGATGTGAGTTTTGGGAACTCTAGTTATTACAACCCAACTGCAAATGATTCATCTACTTCAGCAGGTGGAGAAAATGTACACGACGGCATTCCTATGGATGACATACCTCCAATTCGTACCTCAGTGTAA。
[0006] Preferably, in the above technical solution, the MUC15 gene is obtained by primer pair amplification, and the primer pair is as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGTTGACTTCAGCCAAAATTCTG-3'; R:5'-AATTCGAAGCTTGAGCTCGAGTTACACTGAGGTACGAAGTGGAGG-3'.
[0007] A method for constructing a MUC15 gene expression vector, the method being as follows: S1, pEGFP-C1 was digested with XhoI restriction endonuclease to obtain the digested pEGFP-C1 vector; S2, PCR amplification was performed using buffalo mammary gland tissue cDNA as a template to obtain PCR products. Electrophoresis was used to detect that the PCR products contained the target fragment. The target fragment was then recovered by gel extraction to obtain the target DNA fragment. S3, the target DNA fragment is ligated with the enzyme-digested pEGFP-C1 vector and transformed into Escherichia coli DH5α competent cells, then cultured and extracted to obtain the MUC15 gene expression vector.
[0008] Preferably, in the above technical solution, in step S2, the step of obtaining PCR products by PCR amplification using buffalo mammary gland tissue cDNA as a template, the PCR reaction system during PCR amplification consists of 5 μL cDNA template, 10 μL 5×PrimeSTAR GXL Buffer, 4 μL dNTP Mixture, 4 μL PrimeSTAR GXL DNA Polymerase, 2 μL upstream primer, 2 μL downstream primer, and 26 μL ddH2O.
[0009] Preferably, in the above technical solution, the upstream primer and the downstream primer are as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGTTGACTTCAGCCAAAATTCTG-3'; R:5'-AATTCGAAGCTTGAGCTCGAGTTACACTGAGGTACGAAGTGGAGG-3'.
[0010] Preferably, in the above technical solution, in step S2, the step of obtaining PCR products by PCR amplification using buffalo mammary gland tissue cDNA as a template, the PCR reaction program during PCR amplification is 98℃ denaturation for 10s, 60℃ annealing for 15s, and 68℃ extension for 1min, and the above reaction program is performed for 35 cycles.
[0011] A method for transfecting a MUC15 gene expression vector into buffalo mammary epithelial cells, the method comprising: S1, well-grown buffalo mammary epithelial cells are seeded into DMEM / F12 complete medium in a cell culture plate, and the cell culture plate is placed in an incubator to culture until the cell density reaches 78-83%. The culture conditions of the incubator are set to 5% CO2 and 37.5℃. The DMEM / F12 complete medium consists of 10% FBS, 1µg / mL hydrocortisone, 5µg / mL insulin, 5µg / mL bovine transferrin, 10ng / mL epidermal growth factor, and 10ng / mL prolactin. S2, when the cell density reaches 78-83%, the MUC15 overexpression vector is transfected into buffalo mammary epithelial cells using Lipofectamine 3000.
[0012] According to the above technical solution, the addition of progesterone to the cell culture medium in the prior art cannot simulate the lactation environment, while the addition of prolactin to the cell culture medium in this application can simulate the lactation environment, which is more conducive to the culture of buffalo mammary epithelial cells.
[0013] A method for detecting the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells, the method being as follows: S1, MUC15 overexpression vector was transfected into buffalo mammary epithelial cells. The transfected buffalo mammary epithelial cells were collected, total RNA was extracted, and the total RNA was reverse transcribed to obtain cDNA. S2, using cDNA as a template, real-time quantitative PCR amplification was performed, and the experimental results were processed using GraphPad Prism 10 software to obtain the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells.
[0014] Preferably, in the above technical solution, the reverse transcription system includes 1 μg RNA template, 10 μL 2xTS ReactionMix, 1 μL TansScript RT / RI Enzyme Mix, 1 μL gDNA Remover, and 1 μL Anchored Oligo(dT) Primer.
[0015] Preferably, in the above technical solution, the reaction system for real-time quantitative PCR amplification includes 1 μL cDNA template, 10 μL 2xPerfectStart Green qPCR SuperMix, 0.4 μL upstream primer, 0.4 μL downstream primer, and 8.2 μL RNase water.
[0016] Preferably, in the above technical solution, the reaction conditions for real-time quantitative PCR amplification are denaturation at 94℃ for 5s, annealing at 60℃ for 30s, extension at 72℃ for 10s, and the above reaction is performed for 40 cycles.
[0017] Preferably, in the above technical solution, in the step of performing real-time quantitative PCR amplification using cDNA as a template, the primer sequences for the real-time quantitative PCR amplification are as follows: The real-time quantitative PCR primer pairs for the MUC15 gene include F: TCCCACCCTGAAATTCACCA and R: CTGTCGTCATAAAGTCGCCG; The real-time quantitative PCR primer pairs for the SREBP1 gene include F: TACCTGCAGCTTCTCCATCA and R: CCTTCTCACACATTGCCAGG. The real-time quantitative PCR primer pairs for the PPARα gene include F: CCCTCTTTGTGGCTGCTATCA and R: GCATCCGACTCCGTCTTCTTG. The real-time quantitative PCR primer pairs for the PPARG gene include F: GAGCCTTCCAACTCCCTCAT and R: TTCTCCTTCTCGGCCTGTG; The real-time quantitative PCR primer pairs for the FASN gene include F: CAACTCAACGGAAACCTGCA and R: CACCTCCACCACCTTCATCT. The real-time quantitative PCR primer pairs for the DGAT1 gene include F: CTCTGTGCCTGGTCATTGTG and R: GTAGGAGAACAGCTTGGGGA. The real-time quantitative PCR primer pairs for the DGAT2 gene include F: CGGTGGGTGCAGAAGAAGTT and R:ATGATTTGGTCCATCCTCCTC. The real-time quantitative PCR primer pairs for the PLIN2 gene include F: ACATCTACTCAGTGTTTCGCA and R: GTAGGAGAACAGCTTGGGGA. The real-time quantitative PCR primer pairs for the PLIN3 gene include F: AGAGCTACTTCGTGCGTCTG and R: AGTTTCTCCTGACCCTCCAC. The real-time quantitative PCR primer pairs for the PNPLA2 gene include F: CTAGGCATCTCTCTGACCCG and R: CCGTGATGGTGTTCTTGAGC; The real-time quantitative PCR primer pairs for the LXRs gene include F: GCGGGAGGAGTGTGTCTTAT and R: CCAGCTTCTCAATCATGCCC. The real-time quantitative PCR primer pairs for the CPT1A gene include F: ACCATGCGTTACTCCCTGAA and R: GTCATCCGTGCAAAGTCTCC; The real-time quantitative PCR primer pairs for the GPAM gene include F: GCAGTCGAGTACAAGAGGCA and R: TTTCAGCAGCACCCATCCAG; The real-time quantitative PCR primer pairs for the GAPDH gene include F: GCAAGTTCCACGGCACAG and R: GGTTCACGCCCATCACAA.
[0018] Application of the MUC15 gene, as described above, which affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells.
[0019] Compared with the prior art, the beneficial effects of this application are as follows: (1) For the first time, a MUC15 gene fragment that affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells is provided, and a pEGFP-C1-MUC15 eukaryotic expression vector is constructed. The expression vector is successfully transfected into buffalo mammary epithelial cells, promoting the synthesis of triglycerides in buffalo mammary epithelial cells and increasing the milk fat content in buffalo milk.
[0020] (2) A method is provided for detecting the expression of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells. Specifically, the mRNA expression levels of SREBP1, FASN, PPARG, DGAT1, DGAT2, PLIN2, PLIN3, GPAM, LXR, PNPLA2 and CPT1A genes are significantly increased, while the mRNA expression level of PPARA gene is significantly decreased. Attached Figure Description
[0021] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings.
[0022] Figure 1Figure A shows the electrophoresis diagram of the PCR product of the buffalo MUC15 gene, and Figure B shows the electrophoresis diagram of the enzyme digestion product of the pEGFP-C1-MUC15 recombinant plasmid. In the figures, M represents the make lane and P represents the product fragment lane. Figure 2 This is a diagram of the CDS sequence and encoding amino acid sequence of buffalo MUC15; Figure 3 A is a diagram of buffalo mammary epithelial cells before transfection (4×, bright field); Figure 3 B is a figure of buffalo mammary epithelial cells (10×, bright field) transfected with pEGFP-C1-MUC15 plasmid for 48 h; Figure 3 Figure C shows buffalo mammary epithelial cells (4×, green fluorescence) transfected with pEGFP-C1-MUC15 plasmid for 48 hours. Figure 3 Figure D shows buffalo mammary epithelial cells (10×, green fluorescence) transfected with pEGFP-C1-MUC15 plasmid for 48 hours. Figure 4 This is a bar chart showing the relative mRNA expression levels between the Ad-MUC15 group and the Ad-pEGFP-C1 group. * indicates P < 0.05, and ** indicates P < 0.01. Figure 5 This is a bar chart showing the relative mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells in the Ad-MUC15 and Ad-pEGFP-C1 groups. * indicates P<0.05, and ** indicates P<0.01. Figure 6 This is a bar chart showing the relative triglyceride content in the Ad-MUC15 group and the Ad-pEGFP-C1 group, where * indicates P<0.05 and ** indicates P<0.01. Detailed Implementation
[0023] The technical solutions in the embodiments of this invention are clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0024] This study aimed to construct the pEGFP-C1-MUC15 eukaryotic expression vector and investigate the effects of MUC15 overexpression on triglyceride and fatty acid synthesis in buffalo mammary epithelial cells. The pEGFP-C1-MUC15 vector plasmid was transfected into buffalo mammary epithelial cells. MUC15 expression was observed using fluorescence microscopy and detected by real-time quantitative PCR. Triglyceride levels in the cells were measured using triglyceride assays. The effects of the MUC15 gene on the expression of genes related to triglyceride and fatty acid synthesis were detected by real-time quantitative PCR.
[0025] (1) Materials and reagents The buffalo mammary epithelial cells were obtained from the Guangxi Zhuang Autonomous Region Buffalo Research Institute; The pEGFP-C1 empty vector was purchased from Sangon Biotech (Shanghai) Co., Ltd. The In-Fusion Snap Assembly Master Mix and the high-fidelity PCR enzyme (PrimeSTAR® GXL DNA Polymerase) were purchased from TAKARA. XhoI restriction endonuclease and Lipofectamine 3000 transfection reagent were purchased from Thermo Fisher Scientific. The agarose gel DNA recovery kit (DP209), the endotoxin-free plasmid miniature extraction kit (DP123), and the RNA extraction kit (DP451) were purchased from Tiangen Biotech (Beijing) Co., Ltd. The TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransScript kit and the PerfectStart® Green qPCR SuperMix dye-based real-time PCR premix (AQ601-01-V2) were purchased from Beijing TransGen Biotech Co., Ltd. DMEM / F12 medium was purchased from Gibco. The triglyceride test kit (S0219S) was purchased from Shanghai Beyotime Biotechnology Co., Ltd. Example 1
[0026] The specific steps for cloning the coding region of the MUC15 gene and constructing the overexpression vector are as follows: Using seamless cloning technology, pEGFP-C1 was used as the backbone vector, XhoI was selected as the restriction enzyme site, and the CDS sequence of buffalo MUC15 (XM_006072815.3) predicted by NCBI was used as a template. Primers for constructing the pEGFP-C1-MUC15 vector were designed using CE Design V1.02 software. The primers for constructing the pEGFP-C1-MUC15 vector are as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGTTGACTTCAGCCAAAATTCTG-3', as shown in SEQ ID No. 2; R:5'-AATTCGAAGCTTGAGCTCGAGTTACACTGAGGTACGAAGTGGAGG-3' as shown in SEQ ID No. 3.
[0027] PCR amplification was performed using buffalo mammary gland tissue cDNA as a template. The PCR reaction volume was 50 μL. Element Dosage cDNA template 5μL 5×PrimeSTAR GXL Buffer 10μL dNTP Mixture 4μL PrimeSTAR GXL DNA Polymerase 1μL upstream primer 2μL Downstream primer 2μL <![CDATA[ddH2O]]> 26μL PCR reaction program: denaturation at 98℃ for 10s, annealing at 60℃ for 15s, extension at 68℃ for 1min, 35 cycles.
[0028] 5 μL of PCR product was subjected to 1% agarose gel electrophoresis for detection. The results are as follows: Figure 1 As shown in (A).
[0029] from Figure 1 (A) It can be seen that the product fragment contained a single DNA band of approximately 1000 bp, consistent with the predicted fragment size. Therefore, using buffalo mammary gland tissue cDNA as a template and the above primer pair under the above PCR conditions, PCR amplification was performed, and the target fragment of the expected size was amplified.
[0030] After gel recovery of the target fragment, the product was ligated into the pEGFP-C1 vector and transformed into E. coli DH5α competent cells. After screening and selection, recombinant plasmids were extracted and identified by enzyme digestion. The results are as follows: Figure 1 As shown in (B).
[0031] from Figure 1 (B) It can be seen that after the recombinant plasmid was digested with enzymes, the product was detected by 1% agarose gel electrophoresis. Two single DNA bands appeared in the product fragment. One fragment was about 1000 bp in size and the other fragment was about 5000 bp in size, which was consistent with the predicted fragment size.
[0032] The sequence was commissioned to Sangon Biotech (Shanghai) Co., Ltd. After sequencing and alignment with the template sequence, the complete CDS sequence and encoding amino acid sequence of buffalo MUC15 were obtained. Figure 2 As shown, from Figure 2 It can be seen that the sequence of the buffalo MUC15 is 993bp long and encodes 330 amino acids. Example 2
[0033] The specific steps for culturing and transfecting buffalo mammary epithelial cells are as follows: The cell culture medium was DMEM / F12 complete medium, which consisted of 10% FBS, 1µg / mL hydrocortisone, 5µg / mL insulin, 5µg / mL bovine transferrin, 10ng / mL epidermal growth factor, and 10ng / mL prolactin.
[0034] Overexpression vector group: Well-grown buffalo mammary epithelial cells were evenly seeded into 6-well and 24-well cell culture plates and cultured in an incubator at 37.5°C and 5% CO2 for 24 h. When the cell density reached about 80%, the pEGFP-C1-MUC15 recombinant plasmid was transfected with Lipofectamine 3000. Three replicate wells were set up, and the transfected substance was named Ad-MUC15.
[0035] Overexpression vector control group: Well-grown buffalo mammary epithelial cells were evenly seeded into 6-well and 24-well culture plates and cultured in an incubator at 37.5°C and 5% CO2 for 24 hours. When the cell density reached about 80%, the pEGFP-C1 plasmid was transfected with Lipofectamine 3000. Three replicate wells were set up, and the transfected substance was named Ad-pEGFP-C1.
[0036] The transfection status of the overexpression vector group was observed using a fluorescence microscope before and 48 hours after transfection. Figure 3 (A) Figure 3 (B) Figure 3 (C) and Figure 3 As shown in (D). Figure 3 (A) is a diagram of buffalo mammary epithelial cells before transfection (4×, bright field); Figure 3 (B) is a diagram of buffalo mammary epithelial cells (10×, bright field) transfected with pEGFP-C1-MUC15 plasmid for 48 h; Figure 3 (C) is a diagram of buffalo mammary epithelial cells (4×, green fluorescence) transfected with pEGFP-C1-MUC15 plasmid for 48 h; Figure 3 (D) is a diagram of buffalo mammary epithelial cells (10×, green fluorescence) transfected with pEGFP-C1-MUC15 plasmid for 48 h. Figure 3 (C) and Figure 3 (D) It can be seen that most of the buffalo mammary epithelial cells after transfection emitted green fluorescence, indicating that pEGFP-C1-MUC15 had good transfection efficiency and can be used for the next step of the experiment. Example 3
[0037] The effects of MUC15 overexpression on the mRNA expression of genes related to triglyceride and fatty acid synthesis are as follows: Cells were collected 48 hours after transfection, and total RNA was extracted. RNA concentration and integrity were detected by electrophoresis, followed by reverse transcription experiments. The reverse transcription system was as follows: Element Dosage RNA template 1μg 2xTS Reaction Mix 10μL TansScript RT / RI Enzyme Mix 1μL gDNA Remover 1μL Anchored Oligo(dT) Primer 1μL cDNA was prepared by reacting at 42°C for 30 min and then stored at -80°C.
[0038] qPCR primers for genes related to triglyceride and fatty acid synthesis were designed using Primer 3.0 online software. The primer sequences are shown in Table 1.
[0039] The qPCR reaction volume is 20 μL: Element Dosage cDNA template 1μL 2xPerfectStart Green qPCR SuperMix 10μL upstream primer 0.4μL Downstream primer 0.4μL Rnase water 8.2μL qPCR reaction conditions: 94℃ denaturation for 5s, 60℃ annealing for 30s, 72℃ extension for 10s, 40 cycles.
[0040] The specific primers for real-time quantitative PCR of each gene are as follows:
[0041] The reason for selecting the above genes as MUC15 overexpression of genes related to triglyceride and fatty acid synthesis is as follows: (1) SREBP1 is a subtype of the SREBP family. It plays an important role in the comprehensive regulation of lipid synthesis in dairy cow mammary epithelial cells by regulating key enzymes. SREBP1 is a key positive regulator in milk fat synthesis; (2) Peroxisome proliferator-activated receptor α (PPARα) is a member of the transcription factor nuclear receptor superfamily. Transcription factors control the transcriptional regulation of nutrient sensing and metabolic pathways, especially fatty acid transport and FAO; (3) PPARG is mainly responsible for lipid catabolism. In goats, PPARG enhances the synthesis of monounsaturated fatty acids by controlling stearoyl-CoA desaturase. Lipopolysaccharide (LPS) can inhibit the synthesis of milk fat in MAC-T cells by upregulating miR-27a-3p targeting the PPARG gene; (4) The role of fatty acid synthase (FASN) in de novo fatty acid synthesis has been well confirmed. FASN plays an important role in the entire process of milk fat formation in goat mammary epithelial cells. Inhibiting the expression of FASN will significantly reduce the content of TAG in goat mammary epithelial cells. (5) The expression of DGAT1 mRNA and protein is significantly higher during lactation than during dry period, indicating that DGAT1 is related to lactation in dairy cows. The expression site of DGAT1 in mammary tissue was detected by immunofluorescence method. The results showed that DGAT1 is mainly expressed in the acinar epithelial cells of lactating mammary glands, further proving that DGAT1 participates in the regulation of milk fat synthesis and is related to the TAG synthesis induced by milk fat synthesis precursors. Overexpression of DGAT1 and DGAT2 in the liver led to an increase of 2.0-fold and 2.4-fold in liver triglyceride content, respectively. (6) PLIN2 binds to the surface of liver lipid droplets (LD), and its expression level is related to TAG content. Parallel studies of alternating Plin2-null models have confirmed that the absence of PLIN2 leads to a decrease in liver lipid levels in fed mice. (7) The expression of PLIN3 mRNA in the mammary gland tissue of lactating cows is significantly higher than that in the dry period, suggesting that the expression of PLIN3 may be related to lactation in cows. TAG detection results show that after PLIN3 overexpression, the TAG content in the mammary epithelial cells of cows increases significantly and the number of lipid droplets increases; after PLIN3 silencing, the intracellular TAG content decreases. This result indicates that PLIN3 can positively regulate milk fat synthesis. (7) Increased expression of hepatic PNPLA2 may be the main compensatory event for visceral fat deposition, which is related to leptin hormone associated with increased adipose tissue. (8) Liver X receptors (LXRs) are ligand-activated transcription factors in the nuclear receptor superfamily. LXR agonists also induce genes that promote lipid synthesis, including sterol response element-binding protein (SREBP1-c) and fatty acid synthase (FAS). Induction of these genes in the liver leads to increased hepatic triglyceride synthesis, hypertriglyceridemia, and hepatic steatosis.(9) Overexpression of CPT1A reduces lipid accumulation through the PPARα / CD36 axis; knockdown of CPT1A significantly increases the mRNA expression of adipogenesis genes and promotes lipid deposition in preadipocytes of goat muscle. (10) GPAM is a key enzyme in the animal lipid metabolism pathway, catalyzing the initial and irreversible step in glycerol lipid biosynthesis. Complete knockout of the GPAM gene in bovine mammary epithelial cells (BMECs) using CRISPR / Cas9 technology showed that the levels of triglycerides (TGs) and cholesterol (CHOL) in mammary epithelial cells were significantly reduced after complete GPAM deletion. At the same time, the content of medium-chain saturated fatty acid caprylic acid in mammary epithelial cells was significantly increased.
[0042] The relative expression levels of mRNAs of genes related to triglyceride and fatty acid synthesis were analyzed and plotted using GraphPad Prism 10 software. A t-test was used to analyze the significance of the experimental data, with * indicating P < 0.05 and ** indicating P < 0.01 as the significance level. Specifically, the mRNA expression levels of buffalo mammary epithelial cells overexpressing the MUC15 plasmid (Ad-MUC15 group) and buffalo mammary epithelial cells transfected with the pEGFP-C1 empty vector plasmid (Ad-pEGFP-C1 group) were compared as follows: Figure 4 The results show the mRNA expression levels of various related genes. Figure 5 As shown.
[0043] from Figure 4 As can be seen, compared with the buffalo mammary epithelial cells transfected with the empty pEGFP-C1 vector plasmid, the mRNA expression level of the Ad-MUC15 group (Ad-MUC15 group) was significantly higher than that of the Ad-pEGFP-C1 group (P<0.01), indicating that transfection with the MUC15 gene can significantly promote the mRNA expression of genes related to triglyceride and fatty acid synthesis.
[0044] As shown in Table 5, the mRNA expression levels of SREBP1, FASN, PPARG, DGAT1, DGAT2, PLIN2, PLIN3, GPAM, LXR, PNPLA2, and CPT1A genes were significantly increased in the Ad-MUC15 group (P<0.01), while the mRNA expression level of the PPARA gene was significantly decreased (P<0.01). Example 4
[0045] The triglyceride levels in buffalo mammary epithelial cells transfected with the MUC15 overexpression plasmid and the pEGFP-C1 empty vector plasmid were detected, as follows: After transfecting buffalo mammary epithelial cells with the MUC15 overexpression plasmid and the pEGFP-C1 empty vector plasmid for 48 h, cell culture medium was collected. The triglyceride assay kit (S0219S) was used according to the instructions, with standards diluted in cell culture medium, and a standard curve was plotted. Samples were measured at 570 nm. GraphPad Prism 10 software was used to analyze and plot the experimental results. A t-test was used to analyze the significance of the experimental data, with * indicating P < 0.05 and ** indicating P < 0.01 as the significance level. The relative triglyceride content of buffalo mammary epithelial cells transfected with the MUC15 overexpression plasmid (Ad-MUC15 group) and buffalo mammary epithelial cells transfected with the pEGFP-C1 empty vector plasmid (Ad-pEGFP-C1 group) is shown below. Figure 6 As shown.
[0046] from Figure 6 It can be seen that the triglyceride content in the Ad-MUC15 group was significantly higher than that in the Ad-pEGFP-C1 group (P<0.01).
[0047] This invention can be implemented in various ways and is not limited to the embodiments described. Those skilled in the art will understand that the invention can be implemented in other specific ways without changing the technical concept or essential features. Therefore, it should be understood that the embodiments described above are exemplary and not intended to limit the invention.
Claims
1. A MUC15 gene fragment that affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells, characterized in that, The nucleotide sequence of the MUC15 gene fragment is shown in SEQ ID No.
1.
2. The MUC15 gene fragment affecting triglyceride and fatty acid synthesis in buffalo mammary epithelial cells as described in claim 1, characterized in that, The MUC15 gene fragment was obtained by amplification using primer pairs, which are as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGTTGACTTCAGCCAAAATTCTG-3'; R:5'-AATTCGAAGCTTGAGCTCGAGTTACACTGAGGTACGAAGTGGAGG-3'.
3. A method for constructing a MUC15 gene expression vector, characterized in that, The method is as follows: S1, pEGFP-C1 was digested with XhoI restriction endonuclease to obtain the digested pEGFP-C1 vector; S2, PCR amplification was performed using buffalo mammary gland tissue cDNA as a template to obtain PCR products. Electrophoresis was used to detect that the PCR products contained the target fragment. The target fragment was then recovered by gel extraction to obtain the target DNA fragment. S3, the target DNA fragment is ligated with the enzyme-digested pEGFP-C1 vector and transformed into Escherichia coli DH5α competent cells, then cultured and extracted to obtain the MUC15 gene expression vector.
4. The method for constructing a MUC15 gene expression vector as described in claim 3, characterized in that, In step S2, the step of obtaining PCR products by PCR amplification using buffalo mammary gland tissue cDNA as a template, the PCR reaction system for PCR amplification consists of 5 μL cDNA template, 10 μL 5×PrimeSTAR GXL Buffer, 4 μL dNTP Mixture, 4 μL PrimeSTAR GXL DNA Polymerase, 2 μL upstream primer, 2 μL downstream primer, and 26 μL ddH2O.
5. The method for constructing a MUC15 gene expression vector as described in claim 4, characterized in that, The upstream and downstream primers are as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGTTGACTTCAGCCAAAATTCTG-3'; R:5'-AATTCGAAGCTTGAGCTCGAGTTACACTGAGGTACGAAGTGGAGG-3'.
6. The method for constructing a MUC15 gene expression vector as described in claim 3, characterized in that, In step S2, the step of obtaining PCR products by PCR amplification using buffalo mammary gland tissue cDNA as a template, the PCR reaction program during PCR amplification is 98℃ denaturation for 10s, 60℃ annealing for 15s, and 68℃ extension for 1min, and the above reaction program is performed for 35 cycles.
7. A method for transfecting a MUC15 gene expression vector into buffalo mammary epithelial cells, characterized in that, The method includes: S1, well-grown buffalo mammary epithelial cells are seeded into DMEM / F12 complete medium in a cell culture plate, and the cell culture plate is placed in an incubator to culture until the cell density reaches 78-83%. The culture conditions of the incubator are set to 5% CO2 and 37.5℃. The DMEM / F12 complete medium consists of 10% FBS, 1µg / mL hydrocortisone, 5µg / mL insulin, 5µg / mL bovine transferrin, 10ng / mL epidermal growth factor, and 10ng / mL prolactin. S2, when the cell density reaches 78-83%, the MUC15 overexpression vector is transfected into buffalo mammary epithelial cells using Lipofectamine 3000.
8. A method for detecting the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells, characterized in that, The method is as follows: S1, MUC15 overexpression vector was transfected into buffalo mammary epithelial cells. The transfected buffalo mammary epithelial cells were collected, total RNA was extracted, and the total RNA was reverse transcribed to obtain cDNA. S2, using cDNA as a template, real-time quantitative PCR amplification was performed, and the experimental results were processed using GraphPad Prism 10 software to obtain the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells.
9. The method for detecting the mRNA expression levels of triglyceride and fatty acid synthesis-related genes in buffalo mammary epithelial cells as described in claim 8, characterized in that... In the step of real-time quantitative PCR amplification using cDNA as a template, the primer sequences for real-time quantitative PCR amplification are as follows: The real-time quantitative PCR primer pairs for the MUC15 gene include F: TCCCACCCTGAAATTCACCA and R: CTGTCGTCATAAAGTCGCCG; The real-time quantitative PCR primer pairs for the SREBP1 gene include F: TACCTGCAGCTTCTCCATCA and R: CCTTCTCACACATTGCCAGG. The real-time quantitative PCR primer pairs for the PPARα gene include F: CCCTCTTTGTGGCTGCTATCA and R: GCATCCGACTCCGTCTTCTTG. The real-time quantitative PCR primer pairs for the PPARG gene include F: GAGCCTTCCAACTCCCTCAT and R: TTCTCCTTCTCGGCCTGTG; The real-time quantitative PCR primer pairs for the FASN gene include F: CAACTCAACGGAAACCTGCA and R: CACCTCCACCACCTTCATCT. The real-time quantitative PCR primer pairs for the DGAT1 gene include F: CTCTGTGCCTGGTCATTGTG and R: GTAGGAGAACAGCTTGGGGA. The real-time quantitative PCR primer pairs for the DGAT2 gene include F: CGGTGGGTGCAGAAGAAGTT and R:ATGATTTGGTCCATCCTCCTC. The real-time quantitative PCR primer pairs for the PLIN2 gene include F: ACATCTACTCAGTGTTTCGCA and R: GTAGGAGAACAGCTTGGGGA. The real-time quantitative PCR primer pairs for the PLIN3 gene include F: AGAGCTACTTCGTGCGTCTG and R: AGTTTCTCCTGACCCTCCAC. The real-time quantitative PCR primer pairs for the PNPLA2 gene include F: CTAGGCATCTCTCTGACCCG and R: CCGTGATGGTGTTCTTGAGC; The real-time quantitative PCR primer pairs for the LXRs gene include F: GCGGGAGGAGTGTGTCTTAT and R: CCAGCTTCTCAATCATGCCC. The real-time quantitative PCR primer pairs for the CPT1A gene include F: ACCATGCGTTACTCCCTGAA and R: GTCATCCGTGCAAAGTCTCC; The real-time quantitative PCR primer pairs for the GPAM gene include F: GCAGTCGAGTACAAGAGGCA and R: TTTCAGCAGCACCCATCCAG; The real-time quantitative PCR primer pairs for the GAPDH gene include F: GCAAGTTCCACGGCACAG and R: GGTTCACGCCCATCACAA.
10. The application of the MUC15 gene, as described in any one of claims 1-2, which influences the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells.