ACSL3 gene segment and expression vector construction and expression vector transfection method thereof

By constructing and transfecting the ACSL3 gene expression vector, the problem of low efficiency in the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells was solved, thereby increasing the milk fat content of buffalo milk.

CN121575008APending Publication Date: 2026-02-27GUANGXI ZHUANG AUTONOMOUS REGION BUFFALO INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511751587.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

There is limited research on the effects of the ACSL3 gene on triglyceride and fatty acid synthesis in buffalo mammary epithelial cells, resulting in low efficiency of buffalo milk fat synthesis.

Method used

An ACSL3 gene expression vector was constructed and transfected into buffalo mammary epithelial cells. By adding prolactin to simulate the lactation environment, and combined with real-time quantitative PCR to detect gene expression levels, the synthesis of triglycerides and fatty acids was promoted.

Benefits of technology

It significantly increased the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells, thereby increasing the milk fat content in buffalo milk.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575008A_ABST
    Figure CN121575008A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology, in particular to an ACSL3 gene segment, an expression vector construction method thereof and an expression vector transfection method thereof, the nucleotide sequence of the ACSL3 gene segment influencing buffalo mammary epithelial cell triglyceride and fatty acid synthesis is shown as SEQ No.1, the ACSL3 gene segment is obtained by amplifying a primer pair, and the primer pair has a nucleotide sequence shown as SEQ No.2. The primer pair is specifically as follows: F: 5 '-AGTCCGGACTCAGATCTCGAGATGAATAACCAGGGTCTACAA-3', F: 5 '-AG: 5'-AG: 5 '-AG: 5'-AG: 5 '-AG: 5'-AG: 5 ' And R: 5 '-AATTCGAAGCTTGAGCTATGAGCTATTTTCTTCCATATTCGCTCA-3'. Compared with the prior art, the ACSL3 gene fragment influencing the synthesis of the buffalo mammary epithelial cell triglyceride and fatty acid is obtained, and a pEGFP-C1-ACSL3 eukaryotic expression vector is constructed and transfected to the buffalo mammary epithelial cell, so that the synthesis of the triglyceride by the buffalo mammary epithelial cell is promoted, and the milk fat content in buffalo milk is increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to an ACSL3 gene fragment, its expression vector construction, and a method for transfecting the expression vector. Background Technology

[0002] As an important source of milk, buffalo dairy products have significant economic and nutritional value worldwide. Buffalo milk is rich in nutrients such as milk fat, milk protein, lactose, and minerals, making it highly sought after in the market. Furthermore, buffalo milk is a crucial raw material for producing dairy products such as cheese, yogurt, and butter, thus possessing significant economic value.

[0003] Milk fat percentage is a key factor reflecting the quality of buffalo milk, and triglycerides are the main component of milk fat. Improving milk fat synthesis in buffalo milk is crucial for studying its economic benefits. However, at the molecular level, there is a lack of research on the influence of the ACSL3 gene on triglyceride formation and fatty acid formation. Summary of the Invention

[0004] The purpose of this invention is to provide an ACSL3 gene fragment, its expression vector construction, and a method for transfecting the expression vector, with the aim of using buffalo mammary epithelial cells to synthesize triglycerides and fatty acids from the ACSL3 gene fragment.

[0005] To achieve the above objectives, the present invention provides an ACSL3 gene fragment that affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells, the nucleotide sequence of which is shown in SEQ ID No. 1:

[0006] Preferably, in the above technical solution, the ACSL3 gene is obtained by primer pair amplification, and the primer pair is as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGAATAACCACGGGTCTTCAAA-3'; R:5'-AATTCGAAGCTTGAGCTCGAGCTATTTTCTTCCATACATTCGCTCA-3'.

[0007] A method for constructing an ACSL3 gene expression vector, the method is as follows: S1, pEGFP-C1 was digested with XhoI restriction endonuclease to obtain the digested pEGFP-C1 vector; S2, PCR amplification was performed using buffalo mammary gland tissue cDNA as a template to obtain PCR products. Electrophoresis was used to detect that the PCR products contained the target fragment. The target fragment was then recovered by gel extraction to obtain the target DNA fragment. S3, the target DNA fragment is ligated with the enzyme-digested pEGFP-C1 vector and transformed into Escherichia coli DH5α competent cells, then cultured and extracted to obtain the ACSL3 gene expression vector.

[0008] Preferably, in the above technical solution, in step S2, the step of obtaining PCR products by PCR amplification using buffalo mammary gland tissue cDNA as a template, the PCR reaction system during PCR amplification consists of 5 μL cDNA template, 10 μL 5×PrimeSTAR GXL Buffer, 4 μL dNTP Mixture, 4 μL PrimeSTAR GXL DNA Polymerase, 2 μL upstream primer, 2 μL downstream primer, and 26 μL ddH2O.

[0009] Preferably, in the above technical solution, the upstream primer and the downstream primer are as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGAATAACCACGGGTCTTCAAA-3'; R:5'-AATTCGAAGCTTGAGCTCGAGCTATTTTCTTCCATACATTCGCTCA-3'.

[0010] Preferably, in the above technical solution, in step S2, the step of obtaining PCR products by PCR amplification using buffalo mammary gland tissue cDNA as a template, the PCR reaction program during PCR amplification is 98℃ denaturation for 10s, 60℃ annealing for 15s, and 68℃ extension for 1min, and the above reaction program is performed for 35 cycles.

[0011] A method for transfecting an ACSL3 gene expression vector into buffalo mammary epithelial cells, the method comprising: S1, well-grown buffalo mammary epithelial cells are seeded into DMEM / F12 complete medium in a cell culture plate, and the cell culture plate is placed in an incubator to culture until the cell density reaches 78-83%. The culture conditions of the incubator are set to 5% CO2 and 37.5℃. The DMEM / F12 complete medium consists of 10% FBS, 1µg / mL hydrocortisone, 5µg / mL insulin, 5µg / mL bovine transferrin, 10ng / mL epidermal growth factor, and 10ng / mL prolactin. S2, when the cell density reaches 78-83%, ACSL3 overexpression vector is transfected into buffalo mammary epithelial cells using Lipofectamine 3000.

[0012] According to the above technical solution, the addition of progesterone to the cell culture medium in the prior art cannot simulate the lactation environment, while the addition of prolactin to the cell culture medium in this application can simulate the lactation environment, which is more conducive to the culture of buffalo mammary epithelial cells.

[0013] A method for detecting the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells, the method being as follows: S1, ACSL3 overexpression vector was transfected into buffalo mammary epithelial cells. The transfected buffalo mammary epithelial cells were collected, total RNA was extracted, and the total RNA was reverse transcribed to obtain cDNA. S2, using cDNA as a template, real-time quantitative PCR amplification was performed, and the experimental results were processed using GraphPad Prism 10 software to obtain the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells.

[0014] Preferably, in the above technical solution, the reverse transcription system includes 1 μg RNA template, 10 μL 2xTS ReactionMix, 1 μL TansScript RT / RI Enzyme Mix, 1 μL gDNA Remover, and 1 μL Anchored Oligo(dT) Primer.

[0015] Preferably, in the above technical solution, the reaction system for real-time quantitative PCR amplification includes 1 μL cDNA template, 10 μL 2xPerfectStart Green qPCR SuperMix, 0.4 μL upstream primer, 0.4 μL downstream primer, and 8.2 μL RNase water.

[0016] Preferably, in the above technical solution, the reaction conditions for real-time quantitative PCR amplification are denaturation at 94℃ for 5s, annealing at 60℃ for 30s, extension at 72℃ for 10s, and the above reaction is performed for 40 cycles.

[0017] Preferably, in the above technical solution, in the step of performing real-time quantitative PCR amplification using cDNA as a template, the primer sequences for the real-time quantitative PCR amplification are as follows: The real-time quantitative PCR primer pairs for the ACSL3 gene include F:CTTCTGTGAGACCAGGGCAG and R:TACAGTGATGATGTGCCGCA. The real-time quantitative PCR primer pairs for the SREBP1 gene include F: TACCTGCAGCTTCTCCATCA and R: CCTTCTCACACATTGCCAGG. The real-time quantitative PCR primer pairs for the PPARG gene include F: GAGCCTTCCAACTCCCTCAT and R: TTCTCCTTCTCGGCCTGTG. The real-time quantitative PCR primer pairs for the DGAT1 gene include F:CTCTGTGCCTGGTCATTGTGCG and R:GTAGGAGAACAGCTTGGGGA. The real-time quantitative PCR primer pairs for the PLIN3 gene include F: AGAGCTACTTCGTGCGTCTG and R: AGTTTCTCCTGACCCTCCAC. The real-time quantitative PCR primer pairs for the ELOVL1 gene include F: CCCAGTACTACTTCCTGCCC and R: TGGCCTTGACTTTGGTGGTA. The real-time quantitative PCR primer pairs for the ELOVL6 gene include F: CCTTTGTCTTTGGTGGTCGG and R: GGCCTTTGGTCATCACAGTG. The real-time quantitative PCR primer pairs for the GAPDH gene include F:GCAAGTTCCACGGCACAG and R:GGTTCACGCCCATCACAA.

[0018] Application of the ACSL3 gene, as described above, which affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells.

[0019] Compared with the prior art, the beneficial effects of this application are as follows: (1) For the first time, an ACSL3 gene fragment that affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells is provided, and a pEGFP-C1-ACSL3 eukaryotic expression vector is constructed. The expression vector is successfully transfected into buffalo mammary epithelial cells, promoting the synthesis of triglycerides in buffalo mammary epithelial cells and increasing the milk fat content in buffalo milk.

[0020] (2) A method is provided to detect the expression of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells. Specifically, the mRNA expression levels of SREBP1, PPARG, DGAT1 and PLIN3 genes are significantly increased, while the mRNA expression levels of ELOVL1 and ELOVL6 genes are significantly decreased. Attached Figure Description

[0021] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings.

[0022] Figure 1 Figure A shows the electrophoresis diagram of the buffalo ACSL3 gene PCR product, and Figure B shows the electrophoresis diagram of the pEGFP-C1-ACSL3 recombinant plasmid digestion product. In the figures, M represents the make lane and P represents the product fragment lane. Figure 2 This is a diagram of the CDS sequence and encoding amino acid sequence of buffalo ACSL3; Figure 3 A is a diagram of buffalo mammary epithelial cells before transfection (4×, bright field); Figure 3 B is a figure of buffalo mammary epithelial cells (10×, bright field) transfected with pEGFP-C1-ACSL3 plasmid for 48 h; Figure 3 C is a diagram of buffalo mammary epithelial cells (4×, green fluorescence) transfected with pEGFP-C1-ACSL3 plasmid for 48 h; Figure 3 Figure D shows buffalo mammary epithelial cells (10×, green fluorescence) transfected with pEGFP-C1-ACSL3 plasmid for 48 hours. Figure 4 The bar chart shows the relative mRNA expression levels between the Ad-ACSL3 group and the Ad-pEGFP-C1 group. * indicates P < 0.05, and ** indicates P < 0.01. Figure 5This is a bar chart showing the relative mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells in the Ad-ACSL3 and Ad-pEGFP-C1 groups. * indicates P<0.05, and ** indicates P<0.01. Detailed Implementation

[0023] The technical solutions in the embodiments of this invention are clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0024] This study aimed to construct the pEGFP-C1-ACSL3 eukaryotic expression vector and investigate the effects of ACSL3 overexpression on triglyceride and fatty acid synthesis in buffalo mammary epithelial cells. The pEGFP-C1-ACSL3 vector plasmid was transfected into buffalo mammary epithelial cells. ACSL3 expression was observed using fluorescence microscopy and real-time quantitative PCR. Triglyceride levels in the cells were measured. The effects of ACSL3 gene expression on genes related to triglyceride and fatty acid synthesis were detected using real-time quantitative PCR. (1) Materials and reagents The buffalo mammary epithelial cells were obtained from the Guangxi Zhuang Autonomous Region Buffalo Research Institute; The pEGFP-C1 empty vector was purchased from Sangon Biotech (Shanghai) Co., Ltd. The In-Fusion Snap Assembly Master Mix and the high-fidelity PCR enzyme (PrimeSTAR® GXL DNA Polymerase) were purchased from TAKARA. XhoI restriction endonuclease and Lipofectamine 3000 transfection reagent were purchased from Thermo Fisher Scientific. The agarose gel DNA recovery kit (DP209), the endotoxin-free plasmid miniature extraction kit (DP123), and the RNA extraction kit (DP451) were purchased from Tiangen Biotech (Beijing) Co., Ltd. The TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix TransScript kit and the PerfectStart® Green qPCR SuperMix dye-based real-time PCR premix (AQ601-01-V2) were purchased from Beijing TransGen Biotech Co., Ltd. DMEM / F12 culture medium was purchased from Gibco. Example 1

[0025] The cloning of the ACSL3 gene coding region and the construction of the pEGFP-C1-ACSL3 vector plasmid are as follows: Using seamless cloning technology, pEGFP-C1 was used as the backbone vector, XhoI was selected as the restriction enzyme site, and the CDS sequence of buffalo ACSL3 predicted by NCBI (XM_006072815.3) was used as a template. Primers for constructing the pEGFP-C1-ACSL3 vector were designed using CE Design V1.02 software. The primers for constructing the pEGFP-C1-ACSL3 vector are as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGAATAACCACGGGTCTTCAAA-3', as shown in SEQ ID NO.2; R:5'-AATTCGAAGCTTGAGCTCGAGCTATTTTCTTCCATACATTCGCTCA-3' as shown in SEQ ID NO.3.

[0026] PCR amplification was performed using buffalo mammary gland tissue cDNA as a template. The PCR reaction volume was 50 μL. Element Dosage cDNA template 5μL 5×PrimeSTAR GXL Buffer 10μL dNTP Mixture 4μL PrimeSTAR GXL DNA Polymerase 1μL upstream primer 2μL Downstream primer 2μL <![CDATA[ddH2O]]> 26μL PCR reaction program: denaturation at 98℃ for 10s, annealing at 60℃ for 15s, extension at 68℃ for 1min, 35 cycles.

[0027] 5 μL of PCR product was subjected to 1% agarose gel electrophoresis for detection. The results are as follows: Figure 1 As shown in (A).

[0028] from Figure 1 (A) It can be seen that the product fragment contained a single DNA band of approximately 2200 bp, consistent with the predicted fragment size. Therefore, using buffalo mammary gland tissue cDNA as a template and the above primer pair under the above PCR conditions, PCR amplification was performed, and the target fragment consistent with the expected fragment size was amplified.

[0029] After gel recovery of the target fragment, the product was ligated into the pEGFP-C1 vector and transformed into E. coli DH5α competent cells. After screening and selection, the pEGFP-C1-ACSL3 recombinant plasmid was extracted and digested with enzymes. The digested products were then detected by 1% agarose gel electrophoresis. The electrophoresis results are shown below. Figure 1 As shown in (B).

[0030] from Figure 1(B) It can be seen that after the recombinant plasmid was digested with enzymes, the digestion product was detected by 1% agarose gel electrophoresis. The product fragment showed two single DNA bands. One fragment was about 2200 bp in size and the other fragment was about 5000 bp in size. The size of about 2200 bp is consistent with the predicted target fragment size.

[0031] The sequencing was commissioned to Sangon Biotech (Shanghai) Co., Ltd. After alignment with the template sequence, the complete CDS sequence and encoding amino acid sequence of buffalo ACSL3 were obtained, as follows: Figure 2 As shown, from Figure 2 It can be seen that the ACSL3 sequence of this buffalo is 2163 bp long and encodes 720 amino acids. Example 2

[0032] The specific steps for culturing and transfecting pEGFP-C1-ACSL3 buffalo mammary epithelial cells are as follows: The cell culture medium was DMEM / F12 complete medium, which consisted of 10% FBS, 1µg / mL hydrocortisone, 5µg / mL insulin, 5µg / mL bovine transferrin, 10ng / mL epidermal growth factor, and 10ng / mL prolactin.

[0033] Overexpression vector group: Well-grown buffalo mammary epithelial cells were evenly seeded into 6-well and 24-well cell culture plates and cultured in an incubator at 37.5°C with 5% CO2 for 24 hours. When the cell density reached about 80%, the pEGFP-C1-ACSL3 recombinant plasmid was transfected using Lipofectamine 3000. Three replicate wells were set up, and the transfected substance was named Ad-ACSL3.

[0034] Overexpression vector control group: Well-grown buffalo mammary epithelial cells were evenly seeded into 6-well and 24-well culture plates and cultured in an incubator at 37.5°C and 5% CO2 for 24 hours. When the cell density reached about 80%, the pEGFP-C1 plasmid was transfected with Lipofectamine 3000. Three replicate wells were set up, and the transfected substance was named Ad-pEGFP-C1.

[0035] The transfection status of the overexpression vector group was observed using a fluorescence microscope before and 48 hours after transfection. Figure 3 (A) Figure 3 (B) Figure 3 (C) and Figure 3 As shown in (D). Figure 3 (A) is a diagram of buffalo mammary epithelial cells before transfection (4×, bright field); Figure 3(B) is a diagram of buffalo mammary epithelial cells (10×, bright field) transfected with pEGFP-C1-ACSL3 plasmid for 48 h. Figure 3 (C) is a diagram of buffalo mammary epithelial cells (4×, green fluorescence) transfected with pEGFP-C1-ACSL3 plasmid for 48 h; Figure 3 (D) is a diagram of buffalo mammary epithelial cells (10×, green fluorescence) transfected with pEGFP-C1-ACSL3 plasmid for 48 h. Figure 3 (C) and Figure 3 (D) It can be seen that most buffalo mammary epithelial cells fluoresced green under a fluorescence microscope 48 h after transfection, indicating that pEGFP-C1-ACSL3 has good transfection efficiency and can be used for the next experiment. Example 3

[0036] The effects of ACSL3 overexpression on the mRNA expression of triglyceride and fatty acid synthesis-related genes are as follows: Cells were collected 48 hours after transfection, and total RNA was extracted. RNA concentration and integrity were detected by electrophoresis, followed by reverse transcription experiments. The reverse transcription system was as follows: Element Dosage RNA template 1μg 2xTS Reaction Mix 10μL TansScript RT / RI Enzyme Mix 1μL gDNA Remover 1μL Anchored Oligo(dT) Primer 1μL cDNA was prepared by reacting at 42°C for 30 min and then stored at -80°C.

[0037] qPCR primers for genes related to triglyceride and fatty acid synthesis were designed using Primer 3.0 online software. The primer sequences are shown in Table 1.

[0038] The qPCR reaction volume is 20 μL: Element Dosage cDNA template 1μL 2xPerfectStart Green qPCR SuperMix 10μL upstream primer 0.4μL Downstream primer 0.4μL Rnase water 8.2μL qPCR reaction conditions: 94℃ denaturation for 5s, 60℃ annealing for 30s, 72℃ extension for 10s, 40 cycles.

[0039] The specific primers for real-time quantitative PCR of each gene are as follows:

[0040] The reason for selecting the above genes as ACSL3 overexpression for triglyceride and fatty acid synthesis-related gene mRNAs is as follows: (1) SREBP1 is a subtype of the SREBP family. It plays an important role in the comprehensive regulation of lipid synthesis in bovine mammary epithelial cells by regulating key enzymes. SREBP1 is a key positive regulator in milk fat synthesis; (2) PPARG is mainly responsible for lipid catabolism. In goats, PPARG enhances the synthesis of monounsaturated fatty acids by controlling stearoyl-CoA desaturase. Lipopolysaccharide (LPS) can inhibit milk fat synthesis in MAC-T cells by upregulating miR-27a-3p, which targets the PPARG gene; (3) The role of fatty acid synthase (FASN) in de novo fatty acid synthesis has been well confirmed. FASN plays an important role in the entire process of milk fat formation in goat mammary epithelial cells. Inhibiting the expression of FASN will significantly reduce the content of TAG in goat mammary epithelial cells. (4) DGAT1 mRNA and protein expression were significantly higher during lactation than during dryness, indicating that DGAT1 is related to dairy cow lactation. Immunofluorescence was used to detect the expression sites of DGAT1 in mammary gland tissue. The results showed that DGAT1 was mainly expressed in the acinar epithelial cells of lactating mammary glands, further proving that DGAT1 participates in the regulation of milk fat synthesis and is related to TAG synthesis induced by milk fat synthesis precursors. Overexpression of DGAT1 and DGAT2 in the liver led to an increase of 2.0-fold and 2.4-fold in liver triglyceride content, respectively. (5) PLIN3 mRNA expression in dairy cow mammary gland tissue was significantly higher during lactation than during dryness, suggesting that PLIN3 expression may be related to dairy cow lactation. TAG detection results showed that after PLIN3 overexpression, the TAG content in dairy cow mammary epithelial cells increased significantly, and the number of lipid droplets increased; after PLIN3 silencing, the intracellular TAG content decreased. These results indicate that PLIN3 can positively regulate milk fat synthesis. (6) Long-chain fatty acid elongases ELOVL6 and ELOVL1 play key roles in cellular lipid metabolism. They affect cell membrane composition, signaling pathways, and cell function by regulating the chain length and unsaturation of fatty acids. Among them, ELOVL1 is mainly responsible for the synthesis of very long-chain fatty acids (VLCFA, chain length C22-C26), which are key components of sphingolipids and cell membranes. Overexpression of ELOVL6 in bovine adipocytes also showed a decrease in the ratio of C14:0 and C16:0 fatty acids, while the ratio of stearic acid (C18:0) and arachidonic acid (C20:4n6) increased. The absence of ELOVL6 blocked the synthesis of oleic acid (C18:1n-9).

[0041] The relative expression levels of mRNAs of genes related to triglyceride and fatty acid synthesis were analyzed and plotted using GraphPad Prism 10 software. A t-test was used to analyze the significance of the experimental data, with * indicating P < 0.05 and ** indicating P < 0.01 as the significance level. Specifically, the mRNA expression levels of buffalo mammary epithelial cells overexpressing the ACSL3 plasmid (Ad-ACSL3 group) and buffalo mammary epithelial cells transfected with the pEGFP-C1 empty vector plasmid (Ad-pEGFP-C1 group) were compared as follows: Figure 4 The results show the mRNA expression levels of various related genes. Figure 5 As shown.

[0042] from Figure 4 As can be seen, compared with buffalo mammary epithelial cells transfected with the empty pEGFP-C1 vector plasmid, the mRNA expression levels of triglyceride and fatty acid synthesis-related genes in buffalo mammary epithelial cells overexpressing the ACSL3 plasmid (Ad-ACSL3 group) were significantly increased (P<0.01), indicating that transfection with the ACSL3 gene can significantly promote the mRNA expression of triglyceride and fatty acid synthesis-related genes in buffalo mammary epithelial cells.

[0043] As shown in Table 5, the mRNA expression levels of SREBP1, PPARG, DGAT1, and PLIN3 genes were significantly increased in the Ad-ACSL3 group (P<0.05), while the mRNA expression levels of ELOVL1 and ELOVL6 genes were significantly decreased (P<0.01).

[0044] This invention can be implemented in various ways and is not limited to the embodiments described. Those skilled in the art will understand that the invention can be implemented in other specific ways without changing the technical concept or essential features. Therefore, it should be understood that the embodiments described above are exemplary and not intended to limit the invention.

Claims

1. An ACSL3 gene fragment that affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells, characterized in that, The nucleotide sequence of the ACSL3 gene fragment is shown in SEQ ID No.

1.

2. The ACSL3 gene fragment affecting triglyceride and fatty acid synthesis in buffalo mammary epithelial cells as described in claim 1, characterized in that, The ACSL3 gene fragment was obtained by amplification using primer pairs, which are as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGAATAACCACGGGTCTTCAAA-3'; R:5'-AATTCGAAGCTTGAGCTCGAGCTATTTTCTTCCATACATTCGCTCA-3'.

3. A method for constructing an ACSL3 gene expression vector, characterized in that, The method is as follows: S1, pEGFP-C1 was digested with XhoI restriction endonuclease to obtain the digested pEGFP-C1 vector; S2, PCR amplification was performed using buffalo mammary gland tissue cDNA as a template to obtain PCR products. Electrophoresis was used to detect that the PCR products contained the target fragment. The target fragment was then recovered by gel extraction to obtain the target DNA fragment. S3, the target DNA fragment is ligated with the enzyme-digested pEGFP-C1 vector and transformed into Escherichia coli DH5α competent cells, then cultured and extracted to obtain the ACSL3 gene expression vector.

4. The method for constructing an ACSL3 gene expression vector as described in claim 3, characterized in that, In step S2, the step of obtaining PCR products by PCR amplification using buffalo mammary gland tissue cDNA as a template, the PCR reaction system for PCR amplification consists of 5 μL cDNA template, 10 μL 5×PrimeSTAR GXL Buffer, 4 μL dNTP Mixture, 4 μL PrimeSTAR GXL DNA Polymerase, 2 μL upstream primer, 2 μL downstream primer, and 26 μL ddH2O.

5. The method for constructing an ACSL3 gene expression vector as described in claim 4, characterized in that, The upstream and downstream primers are as follows: F:5'-AGTCCGGACTCAGATCTCGAGATGAATAACCACGGGTCTTCAAA-3'; R:5'-AATTCGAAGCTTGAGCTCGAGCTATTTTCTTCCATACATTCGCTCA-3'.

6. The method for constructing an ACSL3 gene expression vector as described in claim 3, characterized in that, In step S2, the step of obtaining PCR products by PCR amplification using buffalo mammary gland tissue cDNA as a template, the PCR reaction program during PCR amplification is 98℃ denaturation for 10s, 60℃ annealing for 15s, and 68℃ extension for 1min, and the above reaction program is performed for 35 cycles.

7. A method for transfecting ACSL3 gene expression vector into buffalo mammary epithelial cells, characterized in that, The method includes: S1, well-grown buffalo mammary epithelial cells are seeded into DMEM / F12 complete medium in a cell culture plate, and the cell culture plate is placed in an incubator to culture until the cell density reaches 78-83%. The culture conditions of the incubator are set to 5% CO2 and 37.5℃. The DMEM / F12 complete medium consists of 10% FBS, 1µg / mL hydrocortisone, 5µg / mL insulin, 5µg / mL bovine transferrin, 10ng / mL epidermal growth factor, and 10ng / mL prolactin. S2, when the cell density reaches 78-83%, ACSL3 overexpression vector is transfected into buffalo mammary epithelial cells using Lipofectamine 3000.

8. A method for detecting the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells, characterized in that, The method is as follows: S1, ACSL3 overexpression vector was transfected into buffalo mammary epithelial cells. The transfected buffalo mammary epithelial cells were collected, total RNA was extracted, and the total RNA was reverse transcribed to obtain cDNA. S2, using cDNA as a template, real-time quantitative PCR amplification was performed, and the experimental results were processed using GraphPad Prism 10 software to obtain the mRNA expression levels of genes related to triglyceride and fatty acid synthesis in buffalo mammary epithelial cells.

9. The method for detecting the mRNA expression levels of triglyceride and fatty acid synthesis-related genes in buffalo mammary epithelial cells as described in claim 8, characterized in that, In the step of real-time quantitative PCR amplification using cDNA as a template, the primer sequences for real-time quantitative PCR amplification are as follows: The real-time quantitative PCR primer pairs for the ACSL3 gene include F:CTTCTGTGAGACCAGGGCAG and R:TACAGTGATGATGTGCCGCA. The real-time quantitative PCR primer pairs for the SREBP1 gene include F: TACCTGCAGCTTCTCCATCA and R: CCTTCTCACACATTGCCAGG. The real-time quantitative PCR primer pairs for the PPARG gene include F: GAGCCTTCCAACTCCCTCAT and R: TTCTCCTTCTCGGCCTGTG. The real-time quantitative PCR primer pairs for the DGAT1 gene include F:CTCTGTGCCTGGTCATTGTGCG and R:GTAGGAGAACAGCTTGGGGA. The real-time quantitative PCR primer pairs for the PLIN3 gene include F: AGAGCTACTTCGTGCGTCTG and R: AGTTTCTCCTGACCCTCCAC. The real-time quantitative PCR primer pairs for the ELOVL1 gene include F: CCCAGTACTACTTCCTGCCC and R: TGGCCTTGACTTTGGTGGTA. The real-time quantitative PCR primer pairs for the ELOVL6 gene include F: CCTTTGTCTTTGGTGGTCGG and R: GGCCTTTGGTCATCACAGTG. The real-time quantitative PCR primer pairs for the GAPDH gene include F:GCAAGTTCCACGGCACAG and R:GGTTCACGCCCATCACAA.

10. The application of the ACSL3 gene, as described in any one of claims 1-2, which affects the synthesis of triglycerides and fatty acids in buffalo mammary epithelial cells.