Method for efficiently inoculating southern rice black-streaked dwarf virus and application thereof
By detecting the virus using specific primers and an optimized RT-PCR reaction system, combined with controlled feeding conditions and inoculation with white-backed planthoppers with high virus-carrying rates, the problem of unstable inoculation of rice black-streaked dwarf virus in existing technologies has been solved, improving the accuracy and efficiency of rice resistance identification.
Patent Information
- Application Number
- CN202411170486.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-23
- Publication Date
- 2026-03-03
AI Technical Summary
In the existing technology, the artificial inoculation method for Southern Rice Black-Streaked Dwarf Virus is unstable, resulting in insufficient efficiency and accuracy in the identification of resistance in rice germplasm resources. It is impossible to effectively distinguish between different viruses with similar symptoms, which affects the comparability and reproducibility of the identification results.
Rapid detection and quantification were performed using specific primers SRBSDV-S9-F and SRBSDV-S9-R. Virus quantification was conducted using an optimized SYBR Green I-based one-step real-time RT-PCR reaction system. White-backed planthoppers with a virus infection rate exceeding 90% were selected for artificial inoculation. The feeding conditions, such as temperature, humidity, and photoperiod, were controlled to ensure that the virus circulated within the white-backed planthoppers. Inoculation was carried out when the rice plants reached the 2.5-leaf stage.
This method enables efficient inoculation of rice with Southern Rice Black-Streaked Dwarf Virus, improving the accuracy and efficiency of resistance identification and ensuring the stability and comparability of identification results.
Smart Images

Figure SMS_1 
Figure HSA0000299670580000011
Abstract
Description
Technical fields:
[0001] This invention belongs to the field of plant disease technology, specifically relating to an efficient inoculation method for Southern Rice Black-Streaked Dwarf Virus and its application. Background technology:
[0002] Southern rice black-streaked dwarf virus disease (SRBSDVD) is a viral disease caused by Southern rice black-streaked dwarf virus (SRBSDV), which emerged in my country at the beginning of this century. It is transmitted by the migratory white-backed planthopper (WBPH). It can infect rice at all growth stages. Infection during the seedling and early tillering stages results in near-total crop failure; infection during the jointing stage causes approximately 50% yield loss; and infection during the booting stage causes approximately 30% yield loss.
[0003] To date, there are no effective chemical agents for controlling viral diseases. Emergency measures using insecticides to suppress viral transmission are environmentally harmful and costly, and cannot be considered a long-term strategy. Breeding disease-resistant varieties is the most economical and effective method for controlling viral diseases. Identification and evaluation of rice germplasm resources and varietal resistance are the foundation of resistance breeding. Currently, the methods for identifying resistance to Southern Rice Black-Streaked Dwarf Virus (SRBSDVD) mainly include natural disease occurrence and artificial inoculation. The former is greatly affected by environmental factors, requires a long time for identification, and cannot distinguish between different viruses with similar symptoms, affecting the accuracy of the identification results. Artificial inoculation identification conditions are controllable and are basically unaffected by external factors, ensuring the accuracy, comparability, parallelism, and repeatability of the experimental operations. Therefore, rapid, simple, and efficient artificial inoculation methods are the basis for SRBSDVD resistance identification. Since Southern Rice Black-Streaked Dwarf Virus is transmitted through the white-backed planthopper, a high-virus-carrying white-backed planthopper population is key to efficient virus transmission through artificial inoculation. Currently, most artificial inoculation procedures for Southern Rice Black-Streaked Dwarf Virus follow the technical procedures of Qin Bixia et al. (2021). However, this method does not specify the exact parameters for feeding white-backed planthoppers with the virus, resulting in unstable virus-carrying rates in the obtained white-backed planthopper populations and low inoculation efficiency. This significantly affects the efficiency of evaluating and identifying the resistance of rice germplasm resources to Southern Rice Black-Streaked Dwarf Disease. Therefore, it is necessary to provide a new method for feeding white-backed planthoppers with the virus and to improve the SRBSDVD inoculation procedure to address the shortcomings of current technology. Summary of the Invention:
[0004] Purpose of the invention: To address the problems existing in the prior art, this invention provides a method for efficiently inoculating rice with Southern Rice Black-Streaked Dwarf Virus.
[0005] Another objective of this invention is to provide the application of this efficient inoculation method in the identification of resistance to rice black-streaked dwarf disease in southern rice.
[0006] To achieve the above objectives, the present invention is implemented through the following technical solution:
[0007] 1. Rapid detection and quantification of SRBSDV in rice plants suspected of being infected with Southern Rice Black-Streaked Dwarf Disease.
[0008] The primer sequences provided by this invention are as follows:
[0009] SRBSDV-S9-F GAGACCCACCTCCACTGATT
[0010] SRBSDV-S9-R ACGTTTACCACTGCGCCTTC
[0011] Calculate the RNA copy number of the standard and perform 10-fold serial dilutions with nuclease-free water (2.5 × 10⁻⁶). 10 -2.5×10 4 The copies / μL) were amplified using the optimized reaction system and conditions for SYBR Green I-based one-step real-time RT-PCR, and the respective C values were obtained. T The values were analyzed using randomized software to obtain quantitative and standard curves. The logarithm of the initial template copy number in the standard curve was used as the abscissa (x-axis), and the corresponding C... T The value is the ordinate (y-axis);
[0012] The optimal amplification effect was achieved when the concentrations of primers SRBSDV-S9-F and SRBSDV-S9-R were both 300 nM in the SYBR Green I-based one-step real-time RT-PCR reaction system, and the most suitable annealing-extension temperature was 60.0℃. The established standard curve can accurately quantify the SRBSDV RNA copy number in diseased samples.
[0013] 2. Take rice plants infected with SRBSDV from the disease nursery as the source of the virus, remove the dry outer skin to expose the tender stems, and wash them clean with water;
[0014] 3. Take a 5-liter beaker, first spread a thin layer of soil, place the pathogen in the center, and add soil around it to disperse the pathogen as much as possible on the leaves;
[0015] 4. Add water until the soil is just moist, but not waterlogged. Place two layers of filter paper, and gently transfer the second-instar, non-toxic white-backed planthopper larvae into the beaker with a brush. Cover the mouth of the beaker with a 60-mesh insect net.
[0016] 5. Place the poisoned feed beaker in a culture room with a temperature of 25-28℃ and a humidity of 35-45%, with a light cycle of 14 hours of light + 10 hours of darkness, and do not add water during this period;
[0017] 6. After 4 days, gently transfer the white-backed planthopper to a healthy TN1 rice seedling with a brush. Cultivate for 10 days to allow the virus to circulate within the white-backed planthopper.
[0018] 7. Randomly select 50 white-backed planthoppers, test the virus-carrying rate, and select white-backed planthoppers with a virus-carrying rate of over 90% for inoculation;
[0019] 8. When the rice seedlings are at the 2.5-leaf stage, inoculate each seedling with 2 infected insects. Remove the white-backed planthoppers 2 days later and transplant the rice seedlings to the field.
[0020] The method for enabling rice to be efficiently inoculated with Southern Rice Black-Streaked Dwarf Virus is characterized by:
[0021] 1. Using primers
[0022] SRBSDV-S9-F GAGACCCACCTCCACTGATT
[0023] SRBSDV-S9-R ACGTTTACCACTGCGCCTTC
[0024] Identification of the toxic source using real-time RT-PCR;
[0025] 2. The dried outer skin of the poison source must be removed, and then the white-backed planthopper larvae should be fed with fresh, tender stems;
[0026] 3. The soil where the pathogen is placed should not be too moist. Keep the soil moist but not waterlogged. Too much water will cause the white-backed planthopper larvae to die.
[0027] 4. Use second-instar non-toxic white-backed planthoppers for poisoning. Since SRBSDV can only be effectively transmitted after circulating within the white-backed planthopper for two weeks, second-instar larvae are the most suitable for poisoning.
[0028] 5. The optimal temperature for feeding poison is 25-28℃, humidity is 35-45%, and the light cycle is 14 hours of light + 10 hours of darkness;
[0029] 6. The poisoning period is 4 days, and then the white-backed planthoppers are transferred to healthy TN1 rice seedlings with 2.5 leaves and cultivated for 10 days;
[0030] 7. Select white-backed planthoppers with a virus-carrying rate exceeding 90% for inoculation;
[0031] 8. The best inoculation effect is achieved when the rice is 2.5 leaves in age. The inoculation intensity is 2 infected insects inoculated for 2 days. Attached image description:
[0032] Figure 1 Average disease incidence in rice after inoculation with white-backed planthoppers at different virus-carrying rates. Detailed implementation method:
[0033] Implementation Cases
[0034] The inoculation method for Southern Rice Black-Streaked Dwarf Disease in this implementation case includes the following steps:
[0035] 1. Preparation of vaccination tools
[0036] Beaker, insect aspirator, 60-mesh insect net
[0037] 2. Preparation of test materials
[0038] Southern rice black-streaked dwarf virus was collected from Xing'an and other places in Guangxi. Suspected diseased plants of southern rice with 4-5 leaves were collected and detected by RT-PCR using SRBSDV-specific primers SRBSDV-S9-F and SRBSDV-S9-R (Table 1).
[0039] SRBSDV positive plants were artificially inoculated and identified. After confirmation by testing, they were transplanted to the laboratory experimental field to preserve the virus source for feeding experiments.
[0040] Wuyujing No. 3 is a rice variety that can support the growth of white-backed planthopper larvae and complete virus cycles.
[0041] The rice variety to be inoculated is TN1.
[0042] Table 1. Reaction system for real-time quantitative RT-PCR
[0043]
[0044] 3. Determination of the virus-carrying rate of white-backed planthoppers
[0045] Virus carriage rate was measured using a standard Dot-ELISA assay.
[0046] (1) Grinding insects: Randomly collect 50 white-backed planthoppers that have been fed with the virus and transfer them to centrifuge tubes using an insect aspirator; prepare 50 200μl PCR tubes, add 60μl of nitrate coating solution to each tube, grind the white-backed planthoppers into the coating solution with a toothpick, and take two white-backed planthoppers known to carry SRBSDV as positive controls and two non-virus-carrying white-backed planthoppers as negative controls;
[0047] (2) Applying supernatant to nitrocellulose membrane: After mixing, apply 1.5 μl of the supernatant to the nitrocellulose membrane and allow it to air dry naturally indoors;
[0048] (3) Blocking treatment: Pour 15 mL of 2% skim milk powder (prepared with 1×PBST buffer) into the dried nitrocellulose membrane and place it on a shaker at 37℃ and 50 rpm for 30 min.
[0049] (4) After the blocking is completed, discard the skim milk powder, prepare 15 mL of 2% skim milk powder, add 5 μl of SRBSDV-P10 (titer 1:5000) monoclonal antibody, pour the mixed antibody onto the membrane, place it on a shaker at 37℃ and 50 rpm, and incubate for 1.5 h.
[0050] (5) Recover the primary antibody and wash the membrane with 1×PBST buffer 2-3 times, 5 min each time;
[0051] (6) After washing the membrane, prepare 15 mL of 2% skim milk powder, add 5 μl of secondary antibody (Beyotime: HRP-labeled goat anti-mouse lgG (H+L) (titer 1:5000), mix the secondary antibody, pour it onto the membrane, and place it on a shaker at 37℃ and 50 rpm for 1 h.
[0052] (7) The secondary antibody was recovered, and the membrane was washed 2-3 times with 1×PBST buffer, each time for 5 min;
[0053] (8) Pour the prepared colorimetric solution (colorimetric substrate + 10 mL 0.02 mol PBS + 7 mL 30% H2O2) onto the membrane and place it on a shaker at 37°C and 60 rpm for 10-20 min to develop the color.
[0054] (9) Calculate the virus carrying rate: After the nitrocellulose membrane has finished developing color, rinse it with sterile water, let it air dry naturally, and then statistically analyze the color development data to finally calculate the virus carrying rate of the white-backed planthopper.
[0055] 4. Vaccination
[0056] Based on the results of the disease incidence test, the inoculation amount was calculated by inoculating each rice seedling with 2 infected insects. Two days after inoculation, the seedlings were sealed with insect-proof netting.
[0057] 5. Incidence rate statistics
[0058] After removing white-backed planthoppers, the seedlings were transplanted to the cement pond experimental area of the Jiangsu Academy of Agricultural Sciences. No pesticides or antiviral agents were sprayed during the rice's growing season; other cultivation and management followed standard field practices. One month after transplanting, the incidence of Southern Rice Black-Streaked Dwarf Virus (SMRV) was recorded. Compared to healthy plants, diseased plants exhibited: stunted growth, dark green leaves, curled leaf tips, and uneven wrinkles on the upper leaves near the base; aerial roots and high-node branching at the stem nodes during the jointing stage; and longitudinally arranged, milky-white, wart-like protrusions (approximately 1–2 mm in size) on the stem surface, which later turned brownish-black. Each treatment was replicated three times. The average of the replicates was used as the phenotypic value. The incidence rate (number of SMR-infected plants / total number of plants × 100%) was used as the indicator to evaluate resistance to SMRV.
[0059] 6. Results Analysis
[0060] Through six repeated experiments, the virus-carrying rates of the white-backed planthoppers obtained using the method of this invention were 100%, 100%, 98%, 96%, 96%, and 94%, all higher than 90%. Using white-backed planthoppers with a 100% virus-carrying rate, virus-carrying rates of 100%, 95%, 90%, 85%, and 75% were obtained by adding non-virus-carrying white-backed planthoppers. The resulting rice disease incidence rates after inoculation with different virus-carrying rates were 95.56%, 96.67%, 76.67%, 74.44%, and 71.67% (Table 1). Figure 1 When the virus carrier rate is below 90%, the disease incidence in rice decreases significantly. Therefore, the virus carrier rate of the white-backed planthopper used for rice inoculation should be above 90%. Furthermore, when the white-backed planthopper virus carrier rate is greater than 90%, the difference in rice disease incidence among different replicates after inoculation is significantly smaller than the difference among different replicates after inoculation with virus carrier rates of 85% and 75%. Figure 1 The results showed that the higher the virus-carrying rate of white-backed planthoppers during inoculation, the more stable the measured rice disease incidence, and the more accurate the identification results.
[0061] The virus-carrying rate of white-backed planthoppers obtained according to the present invention has met the requirements, which can greatly improve the efficiency and accuracy of identifying rice resistance to Southern Rice Black-Streaked Dwarf Disease.
[0062] Table 1. Average disease incidence in rice after inoculation with white-backed planthoppers at different infection rates.
[0063] Material White-backed planthopper virus-carrying rate average disease incidence in rice TN1 100.00% 95.56% TN1 95.00% 93.33% TN1 90.00% 76.67% TN1 85.00% 74.44% TN1 75.00% 71.67%
Claims
1. A method for efficiently inoculating Southern Rice Black-Streaked Dwarf Virus, characterized in that, The vaccination method includes the following steps: Step 1: Identify the rice virus source carrying Southern Rice Black-Streaked Dwarf Virus using Real-time RT-PCR; Step 2: Feed the non-virulent white-backed planthoppers with rice virus carrying Southern Rice Black-Streaked Dwarf Virus, so that the white-backed planthoppers become infected with the virus. Step 3: Inoculate the target rice with white-backed planthoppers carrying Southern Rice Black-Streaked Dwarf Virus.
2. The inoculation method for Southern Rice Black-Streaked Dwarf Virus according to claim 1, characterized in that, In step one, the primers used to identify the toxic source are: SRBSDV-S9-F GAGACCCACCTCCACTGATT SRBSDV-S9-R ACGTTTACCACTGCGCCTTC.
3. The inoculation method for Southern Rice Black-Streaked Dwarf Disease according to claim 1, characterized in that, In step two, the dried outer skin of the toxin source must be removed, and the white-backed planthopper larvae must be fed with fresh, tender stems.
4. The inoculation method for Southern Rice Black-Streaked Dwarf Virus according to claim 1, characterized in that, In step two, the soil where the pathogen is placed should not be too moist; the soil should be kept moist but not waterlogged.
5. The inoculation method for Southern Rice Black-Streaked Dwarf Virus according to claim 1, characterized in that, In step two, second-instar non-toxic white-backed planthoppers are used as feed for poison.
6. The inoculation method for Southern Rice Black-Streaked Dwarf Virus according to claim 1, characterized in that, In step two, the optimal temperature for feeding the poison is 25-28℃, the humidity is 35-45%, and the light cycle is 14 hours of light + 10 hours of darkness.
7. The inoculation method for Southern Rice Black-Streaked Dwarf Virus according to claim 1, characterized in that, In step two, the poisoning period is 4 days. After poisoning, the white-backed planthoppers are transferred to healthy TN1 rice seedlings with 2.5 leaves and cultivated for 10 days.
8. The inoculation method for Southern Rice Black-Streaked Dwarf Virus according to claim 1, characterized in that, In step three, white-backed planthoppers with a virus-carrying rate of over 90% are selected for inoculation.
9. The inoculation method for Southern Rice Black-Streaked Dwarf Disease according to claim 1, characterized in that, In step three, the rice to be inoculated is inoculated when it is 2.5 leaves old, and the inoculation intensity is 2 infected insects inoculated for 2 days.
10. The application of the inoculation method for Southern Rice Black-Streaked Dwarf Disease according to any one of claims 1-9, characterized in that, It can be applied to any one or a combination of the following applications: 1) Application in the identification and evaluation of resistance to rice black-streaked dwarf virus in southern China; 2) Application in breeding rice varieties with resistance to rice black-streaked dwarf disease in southern China; 3) Application in the evaluation of pesticides for the control of rice black-streaked dwarf disease in southern China.