Application of overexpression level transfer gene glycerophosphate diester phosphodiesterase gene GlpQ in improving fertility of male silkworms

By overexpressing the GlpQ1 gene in silkworms, the technical problem of improving silkworm fertility, especially the insufficient mating and fertilization ability, was solved. This resulted in a significant enhancement of the mating and fertilization ability of male silkworms, promoting testis development and sperm bundle formation.

CN121592679APending Publication Date: 2026-03-03GERMPLASM INNOVATION GRAND SCIENCE CENTER OF WESTERN CHINA (CHONGQING) SCIENCE CITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511329714.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

In existing technologies, the glycerol phosphate diesterase (GlpQ) gene in silkworms is insufficient in improving fertility, especially in terms of mating and fertilization capabilities.

Method used

By overexpressing the horizontally transferred glycerophosphate phosphodiesterase gene GlpQ in silkworms, and then injecting the GlpQ1 overexpression vector mixed with the pHA3PIG helper plasmid into silkworm embryos, individuals of the GlpQ1-OE group were screened out, thus achieving overexpression of the GlpQ1 gene.

Benefits of technology

Overexpression of the GlpQ1 gene significantly enhanced the mating and fertilization ability of male silkworms, improved testis development and sperm bundle formation, increased the reproductive vitality of male silkworms, and enhanced the survival ability of the species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121592679A_ABST
    Figure CN121592679A_ABST
Patent Text Reader

Abstract

The invention discloses an application of an overexpression level transfer gene GlpQ in improving the fertility of male silkworms, and the nucleotide sequence of the GlpQ is shown as SEQ ID NO.3. After the GlpQ1 gene is overexpressed, the reproductive activity of the male silkworms is obviously enhanced, the number of female silkworms capable of mating with each male silkworm on average is obviously increased, and the reproductive activity of the male silkworms is obviously improved. Correspondingly, the number of female silkworms capable of being fertilized by the male silkworms is also obviously increased, the testis development process can be promoted, the gene may act on the testis outer membrane to promote the increase of the testis volume and act on the seminal vesicle to promote sperm formation, and therefore the gene can be used for the fertility of the male silkworms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of overexpression of the horizontally transferred gene glycerophosphate phosphodiesterase gene GlpQ in improving the fertility of male silkworms. Background Technology

[0002] Horizontal gene transfer (HGT), as an important mechanism of cross-species inheritance, is a crucial pathway for the transfer of genetic material across species and plays a significant role in biological evolution. Notably, this non-vertical inheritance pattern frequently occurs in insects, a representative group within the phylum Arthropoda, and these heterologous genetic materials are often closely related to the ecological adaptation and functional evolution of insects.

[0003] Members of the glycerophosphate-diesterase (GDPD) family, to which GlpQ belongs, are widely distributed in the biological world, but their functions have shown significant differentiation throughout evolution, involving fundamental life processes such as homeostasis regulation, lipid remodeling regulation, and transmembrane signal transduction. However, the GlpQ gene exhibits significant species-specific functional heterogeneity. As a model organism of Lepidoptera, the silkworm's GlpQ gene has a unique evolutionary background. Phylogenetic analysis shows that this gene was acquired through the atypical HGT pathway and underwent a specific duplication event in the genome. Therefore, a systematic study of the silkworm's glycerophosphate-diesterase (GlpQ) is urgently needed. Summary of the Invention

[0004] In view of this, one objective of the present invention is to provide an application of overexpression of the horizontally transferred gene glycerophosphate phosphodiesterase gene GlpQ in improving the fertility of male silkworms; another objective of the present invention is to provide a method for improving the fertility of male silkworms.

[0005] To achieve the above objectives, the present invention provides the following technical solution: 1. Application of overexpression of the horizontally transferred gene glycerol phosphate diesterase gene GlpQ in improving the fertility of male silkworms, wherein the nucleic acid sequence of the glycerol phosphate diesterase GlpQ is shown in SEQ ID NO.3.

[0006] Preferably, in this invention, improving the fertility of male silkworms means increasing the number of female moths that the male moths mate with.

[0007] Preferably, the improvement of male silkworm fertility is achieved by increasing the density of sperm bundles in the testes.

[0008] Preferably, the method of improving the fertility of male silkworms involves increasing the volume of the testes or the number of sperm bundles.

[0009] 2. A method for improving the fertility of male silkworms, wherein the transgenic male silkworms obtained by overexpressing the horizontally transferred glycerophosphate phosphodiesterase gene GlpQ in male silkworms are male silkworms with improved fertility; the nucleic acid sequence of the glycerophosphate phosphodiesterase GlpQ is shown in SEQ ID NO.3.

[0010] Preferably, in this invention, the overexpression involves injecting an overexpression vector containing the horizontal transfer gene glycerophosphate phosphodiesterase gene GlpQ1 and the pHA3PIG helper plasmid into silkworm embryos at a mass ratio of 1:1, and then screening for transgenic individuals.

[0011] The beneficial effects of this invention are as follows: This invention reveals the molecular mechanism by which the GlpQ1 gene affects the reproductive capacity of male silkworms through transgenic manipulation. Comparative analysis of the body weight, egg production, and lifespan of silkworms in the WT group and the GlpQ1-OE group showed no significant difference, indicating that the GlpQ1 gene does not affect basic nutritional metabolic processes such as lipid and carbohydrate metabolism in silkworms. Through mating behavior experiments, it was found that when the GlpQ1 gene was overexpressed, the reproductive vitality of male silkworms was significantly enhanced, with a significant increase in the average number of female silkworms that each male could mate with, and a significant increase in the number of female silkworms that could be fertilized by the male. This result suggests that after the GlpQ1 gene is horizontally transferred to lepidopteran insects, it enhances the species' survival ability by increasing mating capacity: participating in and influencing the mating and reproductive processes of male silkworms, and significantly enhancing their mating and fertilization abilities.

[0012] A systematic observation and comparative analysis of the testes and sperm bundles in the WT and GlpQ1-OE groups was conducted. The results showed that GlpQ1 gene overexpression led to a certain degree of testicular enlargement, a significant increase in the number of sperm bundles, and a marked increase in the number of seminal vesicles within the testes. Subsequently, immunofluorescence experiments were used to further analyze the expression of the GlpQ1 gene within the testes. The GlpQ1 gene was expressed throughout the entire testicular tissue, but the expression level varied in different regions. Compared to other regions, the outer membrane showed a higher gene expression level, and the GlpQ1-OE group exhibited a higher GlpQ1 gene expression level in the outer membrane of the testes compared to the WT group. Furthermore, the GlpQ1 gene showed a higher expression level in the seminal vesicles. These results suggest that the silkworm GlpQ1 gene can promote testicular development, and that this gene may promote testicular volume increase by acting on the outer membrane and sperm formation by acting on the seminal vesicles. In summary, the GlpQ1 gene's promoting effect on male silkworm mating and fertilization may be achieved by promoting testicular development and sperm bundle formation. Attached Figure Description

[0013] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration: Figure 1 To obtain and identify GlpQ1 transgenic overexpression mutants (A: Schematic diagram of GlpQ1 overexpression vector; B: Red fluorescence screening of GlpQ1 overexpression positive silkworms; C: RT-qPCR detection of GlpQ1 gene expression; D: Western blot detection of GlpQ1 expression in silkworms).

[0014] Figure 2 The effects of the GlpQ1 gene on the weight and egg production of silkworms (A: weight of fifth-instar females (n=40); B: weight of fifth-instar males (n=40); C: egg production statistics of female moths (n=11)).

[0015] Figure 3 Statistics on the number of matings between WT and GlpQ1-OE male moths (A: Representative image of the number of matings between male moths; B: Statistics on the number of female moths mated by each male moth).

[0016] Figure 4 Statistics on the number of fertilization rings for WT and GlpQ1-OE (A: Representative image of the number of fertilization rings; B: Statistical count of female moths fertilized by each male moth; C: Total effective mating period of male moths).

[0017] Figure 5 A representative image showing the size of the testes of a pupa at 1 day old.

[0018] Figure 6 Statistics on testis size and sperm bundle count at different stages for WT and GlpQ1-OE groups (paraffin sections of testis during the migratory stage, representative images and statistical charts comparing sperm bundle count at 4 days of pupa and adult).

[0019] Figure 7 Analysis of GlpQ1 gene expression levels in the testes of WT and GlpQ1-OE worms (A: Difference in GlpQ1 gene expression levels detected by RT-qPCR; B: Difference in GlpQ1 expression levels detected by Western Blot).

[0020] Figure 8 Immunofluorescence analysis of GlpQ1 gene in WT and GlpQ1-OE testes (yellow arrow: outer membrane of testis; white arrow: seminal vesicle; A: scale bar 80 μm; B: scale bar 40 μm).

[0021] Figure 9 The effect of the GlpQ1 gene on adult lifespan (A: lifespan of male moths; B: lifespan of female moths).

[0022] Figure 10The expression level of the GlpQ1 gene in silkworm 796 (variety name) and its hybrids was detected by RT-qPCR.

[0023] Figure 11 The effect of the GlpQ1 gene on the mating ability of silkworm 796 (A: representative images of mating and fertilization circles of 796×WT male moths; B: representative images of mating and fertilization circles of 796×GlpQ1-OE male moths; C: statistics of mating circles of 796×WT and 796×GlpQ1-OE male moths; D: statistics of fertilization circles of 796×WT and 796×GlpQ1-OE male moths).

[0024] Figure 12 The effects of the GlpQ1 gene on testis size and sperm bundle number in 796 pupae (A: Difference in testis size between 796×WT and 796×GlpQ1-OE pupae at 2 days; B: Representative images of sperm bundle number in 796×WT pupae at 2 days; C: Representative images of sperm bundle number in 796×GlpQ1-OE pupae at 2 days; D: Statistical analysis of sperm bundle number in 796×WT and 796×GlpQ1-OE pupae at 2 days). Detailed Implementation

[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0026] Example 1: Preparation of GlpQ1 transgenic overexpression mutant The construction of the GlpQ1 overexpression vector involves the following steps: Primers were designed based on the full-length GlpQ1 gene sequence, and homologous arms were added to both ends of the primers. PCR amplification was then performed. The primer sequences are as follows: GlpQ1-1180-F: 5'-TGTTAGAGGATTGGTGGATCCATGAAAATCTTCGGGCTGTT-3' (SEQ IDNO.1); GlpQ1-1180-R: 5'-TTATGATCTAGAGTCGCGGCCGCCTAATGATGATGATGATGATGTTTCAAACAAGGTCCTCG-3' (SEQ ID NO. 2); Using SEQ ID NO.1 and SEQ ID NO.2 as primers and silkworm cDNA as a template, PCR amplification was performed. The amplification product was recovered to obtain the GlpQ1 gene, the sequence of which is shown in SEQ ID NO.3, for later use.

[0027] The vector pSL1180 was double-digested with BamHI and NotHI, the digested backbone vector was recovered, and then homologous recombination was performed with the recovered GlpQ1 gene to obtain the A4-PSL1180-GlpQ1 recombinant vector.

[0028] Using the recombinant A4-PSL1180-GlpQ1 as a template, amplification was performed using homologous recombination primers. The specific primers are as follows: pBack-GlpQ1-F: 5'-TATCGATACGCGTACGGCGCCGCCGTGAGTTAGCTCACTCATTA-3' (SEQ ID NO.4); pBack-GlpQ1-R: 5'-AGATCGGCCGGCCTAGGCGCGCCAAGCTTTAAGTACATTGATGA-3' (SEQ ID NO. 5).

[0029] The amplification product was recombined with the piggyBac vector digested with AscⅠ to obtain the recombinant plasmid piggBac[A4-GlpQ1].

[0030] Using embryo microinjection technology, the GlpQ1 overexpression vector ( Figure 1 A) and pHA3PIG helper plasmid were mixed in equal mass ratios of 1:1 and injected into silkworm embryos. Transgenic individuals with glowing red eyes were selected in the G1 generation. Figure 1 (B), which was named GlpQ1-OE. Subsequently, the expression of the GlpQ1 gene at both the transcriptional and protein levels was detected. Quantitative fluorescence analysis used SW22934 as an internal control. Specific primers are shown in Table 1. Table 1. Primers for quantitative fluorescence detection Primer name Primer direction Primer sequence (5'→3') Amplification product length SW22934 Forward TTCGTACTGCTCTTCTCGT (SEQ ID NO.6) 174bp Reverse CAAAGTTGATAGCAATTCCCT (SEQ ID NO.7) GlpQ1-qPCR Forward ACATGACAACGAACTGAGTTTG (SEQ ID NO.8) 222bp Reverse TCTTGAAACGTAGGAATCGTGA (SEQ ID NO.9) RNA and total protein were extracted from the midgut of silkworms in the 5th instar, 3 days after hatching, from both the WT and GlpQ1-OE groups. The expression level of the GlpQ1 gene was detected by RT-qPCR and Western Blot. The results showed that, compared with the WT group, the GlpQ1-OE group exhibited significant overexpression of the GlpQ1 gene at both the transcriptional and protein levels. Figure 1 (CD). In summary, GlpQ1 overexpression was obtained.

[0031] Example 2: Measurement of body weight and egg production of female moths The method for measuring weight in five-year-olds is as follows: 1) After the fifth instar, feed a small amount of mulberry leaves. About 30 minutes after feeding, four small white dots can be seen on both sides of the eighth and ninth abdominal segments of the female, and a distinct small white dot can be seen at the junction of the eighth and ninth abdominal segments of the male. This can be used to distinguish the sex of the fifth instar silkworm. 2) From the first day of the fifth instar until the larvae emerge from the cocoon, ensure that each group receives the same amount of mulberry leaves daily. Measure the weight of both male and female larvae in the WT group and the GlpQ1-OE group at the same time each day and record the results accurately. The results are as follows: Figure 2 As shown in A and B.

[0032] The method for detecting the number of eggs laid by female moths is as follows: 1) Within 24 hours of the moth transformation, female moths from the WT group and the GlpQ1-OE group were mated with wild-type male moths under light for 6 hours. 2) Place the female moths in a dark place to lay eggs for 48 hours, take photos to record and count the number of eggs laid by the female moths. The results are as follows: Figure 2 As shown in Figure C. The above results indicate that GlpQ1 is involved in the metabolism of various glycerophosphate diesters in organisms. Given the close relationship between lipid metabolism and the growth and development of organisms, it was initially hypothesized that this gene might affect two key physiological indicators in silkworms: body weight and egg production, by influencing their lipid metabolism pathways. To verify this hypothesis, the differences in body weight during the fifth instar larval stage and egg production during the adult stage were compared between the GGlpQ1-OE group and the WT group. Compared with WT, there were no statistically significant differences in body weight of fifth instar larvae and egg production of female moths after GlpQ1 gene overexpression (P>0.05).

[0033] Example 3: Determination of male moth mating and fertilization capacity Within 24 hours of emergence, 15 male moths from the WT group and 15 male moths from the GlpQ1-OE group were randomly selected and mated with wild-type female moths within 24 hours of emergence. The mating time was 6 hours. Male moths were defined as capable of mating with female moths autonomously within 10 minutes and not separating within 6 hours. The number of female moths that each male moth could mate with was counted.

[0034] After the female moth lays her eggs, the eggs are placed at room temperature. After about 8-9 days, the eggs turn green. The number of green circles that each male moth can turn after mating is used as a statistical indicator of fertilization capacity. The number of green circles that each male moth can fertilize is counted.

[0035] The results showed that male silkworm moths in the GlpQ1-OE group were more active and mated in a shorter time. It was hypothesized that this gene might affect the mating ability of male moths through some mechanism. To test whether this hypothesis was correct, a behavioral experiment on male moth mating was designed. The experimental results are as follows: Figure 3 As shown in the figure. The results showed that the average number of female moths mated by each male moth in the GlpQ1-OE group was 19, which was significantly higher than the 11 female moths mated by each male moth in the WT group. This result confirms the previous hypothesis that the number of female moths that male moths can mate with significantly increases after GlpQ1 gene overexpression (P<0.001).

[0036] Subsequently, this study counted the number of female moths that could be fertilized by each male moth. The experimental results are as follows: Figure 4As shown, overexpression of the GlpQ1 gene significantly enhanced the fertilization capacity of male moths (P<0.001). Specifically, in the WT group, each male moth could fertilize an average of five female moths, while in the GlpQ1-OE group, each male moth could fertilize an average of 10 female moths. Furthermore, overexpression of the GlpQ1 gene also significantly prolonged the effective mating time of male moths (P<0.001).

[0037] Example 4: Measurement of testicular size and sperm bundle number 1) Testicular size measurement The period from the migratory stage to day 2 of the pupa is a critical time for testis development. Therefore, testes from day 1 of the pupa were selected for size measurement. The extracted testes were immersed in 1×PBS buffer, and the surface-adhering fat bodies were carefully removed with tweezers. The size difference of the testes in the WT group and the GlpQ1-OE group was recorded under an optical microscope. The results are as follows: Figure 5 As shown in the figure. The results showed that the testes of the GlpQ1-OE group were significantly larger one day after pupation, which initially suggests that the GlpQ1 gene is involved in the testis development process.

[0038] 2) HE staining of the testes Testicular tissue samples were collected during the migratory phase, with three biological replicates per group. Immediately after collection, the testes were thoroughly cleaned in 1×PBS buffer, and the fatty bodies attached to the testicular surface were completely detached using forceps. The samples were then transferred to 4% paraformaldehyde fixative (pH 7.4) and fixed at 4°C for 24 h. While remaining submerged in the fixative, the samples were transported via cold chain to Ningbo Yangming Medical Laboratory, where paraffin embedding and section preparation were performed by professional pathologists. Sections from the largest cross-section of the testes were selected; subsequently, these sections were stained with hematoxylin and eosin (HE), and the difference in sperm bundle density between the WT and GlpQ1-OE groups was statistically analyzed. Results are as follows: Figure 6 As shown, HE staining analysis revealed that the density of sperm bundles in the testes of the GlpQ1-OE group was significantly increased compared to the WT group. Further observation showed that this phenotype persisted during the 4-day pupal stage and the adult stage.

[0039] Example 5: Gene expression of GlpQ1 in the testis To further investigate the reasons why the GlpQ1 gene affects the mating and fertilization ability of male silkworms, the expression of this gene in the testes of adult silkworms was examined. RNA from the GlpQ1 overexpression mutant was extracted as a template, reverse transcribed to obtain cDNA, and then the expression level of the GlpQ1 gene was detected by RT-qPCR using the obtained cDNA as a template. The results are as follows: Figure 7 As shown in Figure A. The results showed that, at the transcriptional level, the gene expression level in the GlpQ1-OE group was increased by about 20-fold compared with the WT group; in addition, the GlpQ1-OE group also showed significant overexpression at the protein level compared with the WT group.

[0040] Within 24 hours of moth emergence, three pairs of testes were collected from male moths in both the WT and GlpQ1-OE groups. These testes were immersed in pressurized MilliQ water to remove surface-adhering fat bodies. Total protein was extracted from the male moth testes, yielding 20 μg of testicular protein. Western blotting of the testes was performed using GlpQ1 primary antibody and Cy3-labeled goat anti-rabbit as a fluorescent secondary antibody. The results are as follows: Figure 7 As shown in B.

[0041] To further investigate the reasons why the GlpQ1 gene affects testicular and sperm bundle development, spatial expression profiling of testicular tissue during the migratory phase was performed using tissue immunofluorescence. The specific steps are as follows: a. Dewaxing of paraffin sections: The sections were immersed in xylene I solution (10 min), xylene II solution (10 min), anhydrous ethanol (5 min), 90% ethanol (2 min), 70% ethanol solution (2 min), and ultrapure water (2 min) in sequence. b. Antigen retrieval: Heat sodium citrate solution (0.364 g citric acid + 200 mL ultrapure water, pH=6.0) in the microwave for 2 min. Then, immerse the slide completely in the solution and let it stand for 7 min 30 s. Remove the slide and heat sodium citrate solution in the microwave for 20 s. Put the slide back in the solution and let it stand for another 7 min 30 s. Finally, rinse with 1×PBS solution and air dry the slide. Tissue region enclosure: Use an immunohistochemical pen to draw lines around the tissue to ensure that the tissue is completely enclosed; d. Perforation: Immerse the sample in PBS permeation working solution containing 0.2% Triton X-100 (5 min × 3 times), followed by washing with PBS buffer (5 min × 1 time). e. Blocking: Add immunofluorescence blocking solution (prepared with 1×PBS solution containing 10% fetal sheep serum and 1% BSA) to the glass slide and block at room temperature for 2 h; f. Primary antibody incubation: Discard the blocking solution, add GlpQ1 primary antibody (prepared with 1×PBS solution and 1% BSA added), antibody dilution ratio 1:500 (v / v), incubate at 4℃ for 12-16 h; g. Washing: Rinse three times with 1×PBS solution, 10 min each time; h. Fluorescent secondary antibody labeling: Add fluorescent secondary antibody (cy3-labeled goat anti-rabbit). The fluorescent secondary antibody is prepared with 1×PBS solution and 1% BSA is added to it. The antibody dilution ratio is 1:500 (v / v). From this step onwards, keep the entire process away from light. i. Washing: Rinse three times with 1×PBS solution, 15 min each time; j. Nuclear staining localization: Add DAPI staining solution and stain at room temperature for 30 min; k. Washing: Rinse three times with 1×PBS solution, 15 min each time; 1. Sample sealing: Add 1-2 drops of anti-fluorescence quencher, cover with a glass slide, and seal the edges of the slide with colorless transparent nail polish; m. Observation: Observe and photograph under a fluorescence microscope. The results are as follows: Figure 8 As shown.

[0042] The results showed that the GlpQ1 gene exhibited spatial expression variability in the testis, being expressed throughout the entire testis tissue, but with varying expression levels in different locations. Overall, the GlpQ1 gene showed higher expression in the outer membrane of the testis, and compared to the WT group, the GlpQ1-OE group showed even higher expression in the outer membrane. This corresponds at the molecular level with the phenotypic characteristic of increased testis volume after GlpQ1 gene overexpression, suggesting that the GlpQ1 gene may participate in testis morphological development by promoting the proliferation of the outer membrane tissue. Furthermore, the expression levels varied in different locations within the testis, with significantly higher fluorescence signal intensity in the seminal vesicles compared to other areas. Compared to the WT group, the GlpQ1-OE group showed more seminal vesicles, which corresponds to the enhanced mating and fertilization capacity of male moths in the GlpQ1-OE group.

[0043] Example 6: The effect of the GlpQ1 gene on adult lifespan To investigate whether the GlpQ1 gene affects the lifespan of adult silkworms, the lifespan of unmated male and female moths was measured. The specific methods are as follows: Within 12 hours after metamorphosis, the survival time of unmated male and female individuals in the WT and GlpQ1-OE groups was observed. The individuals were placed in a clean environment with guaranteed oxygen supply, an ambient temperature of 25±1℃, and a photoperiod of 12L:12D. The experiment was conducted in 36 biological replicates (n=36). The survival status of the individuals was observed and recorded daily at regular intervals. Complete cessation of movement in adults was used as the criterion for death. The survival time of individuals in each group was precisely recorded. The results are as follows: Figure 9 As shown in the figure. The results showed that when the GlpQ1 gene was overexpressed, the lifespan of male moths did not change significantly, but the lifespan of female moths decreased to some extent.

[0044] Example 9: Effects of the GlpQ1 gene on the mating and fertilization ability of silkworm 796 To investigate whether the GlpQ1 gene can enhance the mating and fertilization abilities of practical species, male moths of 796×WT and 796×GlpQ1-OE hybrids were mated with female moths of 796×WT, and the differences in their mating and fertilization abilities were examined. The experimental results are as follows: Figure 11As shown, there was a significant difference in reproductive capacity between the two groups (P<0.05): in the 796×WT group, each male moth could mate with an average of 9 female moths and fertilize an average of 6 female moths, while in the 796×GlpQ1-OE group, each male moth could mate with an average of 16 female moths and fertilize an average of 13 male moths.

[0045] To further investigate the effect of the GlpQ1 gene on 796, the testis size and sperm bundle number of pupae were observed and statistically analyzed after 2 days. The experimental results are as follows: Figure 12 As shown, the results showed that the testes of the pupae in the 796×GlpQ1-OE group were larger at 2 days compared with the 796×WT group; and the number of sperm bundles in the 796×GlpQ1-OE group was significantly higher than that in the 796×WT group at 2 days (P<0.001).

[0046] The above results indicate that hybridization of the GlpQ1-OE mutant with silkworm 796 significantly improves the mating and fertilization ability of male silkworms in silkworm 796. At the same time, the linear correlation between the expression level of the GlpQ1 gene and mating ability further confirms the promoting effect of the GlpQ1 gene on the reproductive capacity of male silkworms.

[0047] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. The application of overexpression of the horizontally transferred gene glycerophosphate diesterase gene GlpQ in improving the fertility of male silkworms, characterized by: The nucleic acid sequence of the glycerophosphate phosphodiesterase GlpQ is shown in SEQ ID NO.

3.

2. The application according to claim 1, characterized in that: Improving the fertility of male silkworms means increasing the number of female moths that male moths mate with.

3. The application according to claim 1, characterized in that: The method to improve the fertility of male silkworms is to increase the density of sperm bundles in the testes.

4. The application according to claim 1, characterized in that: The method aims to improve the fertility of male silkworms by increasing the volume of the testes or the number of sperm bundles.

5. A method for improving the fertility of male silkworms, characterized in that: By overexpressing the horizontally transferred glycerophosphate phosphodiesterase gene GlpQ in male silkworms, the transgenic male silkworms obtained are those with improved fertility; the nucleic acid sequence of the glycerophosphate phosphodiesterase GlpQ is shown in SEQ ID NO.

3.

6. The method for improving the fertility of male silkworms according to claim 5, characterized in that: The overexpression involves injecting an overexpression vector containing the horizontal transfer gene glycerophosphate diesterase gene GlpQ1 and the pHA3PIG helper plasmid into silkworm embryos at a mass ratio of 1:1, and then screening for transgenic individuals.