Preparation method and application of tryptophanol

Abstract

The invention provides a preparation method and application of tryptophan, and the preparation method comprises the step of preparing tryptophan by using tryptophan and NRPS gene overexpression algae strains. According to the preparation method and the application of the tryptophan, the tryptophan is successfully reduced by using the NRPS gene overexpression algal strain to obtain the tryptophan, so that the synthesis difficulty is effectively reduced, and the pollution to the environment is reduced; meanwhile, the NRPS gene in the NRPS gene overexpression algal strain is in an overexpression state, more tryptophan can be utilized to generate tryptophan alcohol, and the synthesis efficiency is effectively improved; in addition, when the prepared tryptophanol is applied to the plant growth process, plant growth can be effectively promoted.

Description

Technical Field

[0001] This application relates to the field of chemical preparation technology, and in particular to a method for preparing tryptophan and its application. Background Technology

[0002] Tryptophan is a natural organic compound with applications in drug development, biotechnology, and clinical medicine. Current methods for preparing tryptophan are complex and costly; optimizing these methods will bring significant market benefits. Summary of the Invention

[0003] In view of this, the purpose of this application is to provide a method for preparing tryptophan and its application, so as to solve the above-mentioned technical problems.

[0004] In a first aspect, this application provides a method for preparing tryptophan, comprising: preparing tryptophan using an algal strain that overexpresses tryptophan and the NRPS gene.

[0005] Furthermore, the preparation of tryptophan alcohol using algal strains overexpressing tryptophan and NRPS genes includes:

[0006] Tryptophan was added to the culture medium, and an algal strain overexpressing the NRPS gene was inoculated and cultured in the medium to obtain tryptophanol.

[0007] Furthermore, the preparation of tryptophan alcohol using algal strains overexpressing tryptophan and NRPS genes includes:

[0008] NRPS gene overexpressing algal strains were inoculated and cultured in a culture medium to obtain NRPS gene overexpressing algal strain cultures.

[0009] The protein of the NRPS-overexpressing algal strain was isolated and purified from the NRPS gene overexpressing algal culture;

[0010] Tryptophan and NRPS-overexpressing algal protein were used as reaction substrates for in vitro enzymatic reactions to obtain tryptophanol.

[0011] Furthermore, the catalytic enzymes for in vitro enzymatic reactions include reduced coenzyme II.

[0012] Furthermore, the reaction solution for the in vitro enzymatic reaction also includes Tris-HCl buffer, ATP, MgCl2, and coenzyme A.

[0013] Furthermore, the culture medium was a phosphorus-deficient f / 2 artificial seawater medium.

[0014] Furthermore, the NRPS gene-overexpressing algal strains were cultured under alternating light and dark conditions, with the light intensity in the light-conditioning environment being 90 μmol / m². -2 s -1.

[0015] Furthermore, the culture temperature for the algal strain overexpressing the NRPS gene was (20±1)℃.

[0016] Furthermore, the NRPS gene overexpressing algal strain was constructed using the following method:

[0017] Primers were designed based on the CDS sequence of the NRPS gene, and PCR amplification was performed. After purification of the amplification product, the enzyme digestion product was recovered and ligated with the pYT28 plasmid to obtain the NRPS gene overexpression vector pYT28-NRPS.

[0018] The NRPS gene overexpression vector pYT28NRPS was transformed into E. coli containing the pTA-Mob plasmid. The pYT28NRPS was then transferred into diatom cells via E. coli conjugation, resulting in an NRPS gene overexpressing algal strain.

[0019] A second aspect of this application provides an application of tryptophan, wherein tryptophan prepared according to the method for preparing tryptophan according to the first aspect is used to prepare a plant growth regulator to promote plant growth.

[0020] As can be seen from the above, this disclosure provides a method for preparing tryptophan and its application. Tryptophan is successfully reduced using an algal strain that overexpresses the NRPS gene. Compared with existing synthesis methods, this method effectively reduces the difficulty of synthesis and is environmentally friendly, reducing pollution. At the same time, the NRPS gene in the algal strain is overexpressed, which allows for the utilization of more tryptophan to generate tryptophan, effectively improving the synthesis efficiency. Furthermore, applying the prepared tryptophan to plant growth can effectively promote plant growth. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in this application or related technologies, the drawings used in the description of the embodiments or related technologies will be briefly introduced below. Obviously, the drawings described below are only embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The images are laser confocal microscopy images of algal cells overexpressing NRPS in reaction product 1. A is the fluorescence image of eGFP at an excitation wavelength of 488 nm, B is the autofluorescence image of chloroplasts at an excitation wavelength of 568 nm, C is a bright-field microscopy image, and D is the copolymerization result of the two wavelengths.

[0023] Figure 2The results of high performance liquid chromatography (HPLC) for reaction product 1 are shown. CK is the control group, which is an algal strain transformed without the empty vector of the PtNRPS1 gene. PtNRPS1 is the detection result of reaction product 1.

[0024] Figure 3 The results are NMR spectra, where A is the proton NMR spectrum and B is the carbon NMR spectrum.

[0025] Figure 4 This is the result of mass spectrometry identification.

[0026] Figure 5 The results of ultra-high performance liquid chromatography analysis of reaction product 2 are shown, where "tryptophanol" is the tryptophanol standard, WT is the control group, and PtNRPS1-OE is reaction product 2.

[0027] Figure 6 The graph shows the effect of different concentrations of tryptophan on the growth of algae, with the vertical axis representing cell density and the horizontal axis representing culture time.

[0028] Figure 7 The graph shows the growth-promoting effect of different concentrations of 3-indoleacetic acid on algal strains, with the vertical axis representing cell density and the horizontal axis representing culture time.

[0029] Figure 8 The results show the total carbon content in algae after treatment with 20 pg / L tryptophan and 5000 ng / L 3-indoleacetic acid. The vertical axis represents the carbon percentage (C Percentage), and the horizontal axis represents time.

[0030] Figure 9 The results show the total nitrogen content in algae after treatment with 20 pg / L tryptophan and 5000 ng / L 3-indoleacetic acid. The vertical axis represents the nitrogen percentage (N Percentage), and the horizontal axis represents time.

[0031] Figure 10 The figure shows the effect of 20 pg / L tryptophanol on gene expression in algal nitrogen metabolism pathways. s represents transcriptome sequencing results, and q represents quantitative PCR analysis results. Nitrite, Carbamoyl phosphate, Ammonium ion, Carbon dioxide, Cyanic acid, Hydrogencarbonate, Nitric acid, Formamide, Ammonia, L-Glutamate, and L-Glutamine are all represented. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with specific embodiments and the accompanying drawings.

[0033] It should be noted that, unless otherwise defined, the technical or scientific terms used in the embodiments of this application should have the ordinary meaning understood by one of ordinary skill in the art to which this application pertains. The terms "first," "second," and similar terms used in the embodiments of this application do not indicate any order, quantity, or importance, but are merely used to distinguish different components. Terms such as "comprising" or "including" mean that the element or object preceding the word encompasses the elements or objects listed after the word and their equivalents, without excluding other elements or objects. Terms such as "connected" or "linked" are not limited to physical or mechanical connections, but can include electrical connections, whether direct or indirect. Terms such as "upper," "lower," "left," and "right" are only used to indicate relative positional relationships; when the absolute position of the described object changes, the relative positional relationship may also change accordingly.

[0034] Tryptophan is a natural organic compound with applications in drug development, biotechnology, and clinical medicine. Current methods for preparing tryptophan are complex and costly; optimizing these methods will bring significant market benefits.

[0035] Based on the above, this disclosure provides a method for preparing tryptophanol, which can effectively synthesize tryptophanol, specifically including:

[0036] Tryptophanol was prepared using algal strains overexpressing tryptophan and NRPS genes.

[0037] Non-ribosomal peptide synthases (NRPS) are large, multifunctional enzymes primarily derived from bacteria and fungi, such as antibiotics and siderophores, as secondary metabolites. This disclosure demonstrates the successful reduction of tryptophan to tryptophanol using an algal strain overexpressing the NRPS gene. Compared to existing synthetic methods, this significantly reduces the difficulty of synthesis and is environmentally friendly, minimizing pollution. Furthermore, the overexpression of the NRPS gene in the overexpressing algal strain allows for the utilization of more tryptophan to generate tryptophanol, effectively improving synthetic efficiency.

[0038] Specifically, tryptophan can be prepared from algal strains overexpressing the tryptophan and NRPS genes using either in vivo or in vitro culture methods. In vivo culture involves directly metabolizing the NRPS gene-overexpressing algal strains within the body to obtain tryptophan, while in vitro culture requires in vitro enzymatic reactions.

[0039] In some embodiments, the preparation of tryptophan alcohol using algal strains overexpressing tryptophan and NRPS genes includes:

[0040] Tryptophan was added to the culture medium, and an algal strain overexpressing the NRPS gene was inoculated and cultured in the medium to obtain tryptophanol.

[0041] Adding tryptophan directly to the culture medium of algal strains overexpressing the NRPS gene allows the algae to effectively reduce the tryptophan in the culture medium to tryptophan alcohol through the growth and metabolism of the NRPS gene-overexpressing algae. This process is called in vivo culture and is relatively simple, effectively reducing the difficulty of preparing tryptophan alcohol.

[0042] In some embodiments, the preparation of tryptophan alcohol using algal strains overexpressing tryptophan and NRPS genes includes:

[0043] NRPS gene overexpressing algal strains were inoculated and cultured in a culture medium to obtain NRPS gene overexpressing algal strain cultures.

[0044] The protein of the NRPS-overexpressing algal strain was isolated and purified from the NRPS gene overexpressing algal culture;

[0045] Tryptophan and NRPS-overexpressing algal protein were used as reaction substrates for in vitro enzymatic reactions to obtain tryptophanol.

[0046] First, an algal strain overexpressing the NRPS gene was cultured in a culture medium to obtain an NRPS gene overexpressing algal culture. Then, the NRPS overexpressing algal protein was isolated and purified, and then used to perform an in vitro enzymatic reaction. In the in vitro enzymatic reaction, under the action of a catalytic enzyme, the NRPS overexpressing algal protein reacted with tryptophan, reducing tryptophan to tryptophanol. This process is the in vitro culture process.

[0047] In some embodiments, the catalytic enzyme for the in vitro enzymatic reaction is reduced coenzyme II. In the in vitro enzymatic reaction, reduced coenzyme II (NADPH) provides electrons for the reduction reaction of NRPS overexpressed algal protein with tryptophan, thereby reducing the carboxyl group on tryptophan to a hydroxyl group, thus achieving the reduction of tryptophan.

[0048] In some embodiments, the reaction solution for the in vitro enzymatic reaction further includes Tris-HCl buffer, ATP, MgCl2, and CoA. In the in vitro enzymatic reaction, adenosine triphosphate (ATP) acts as a donor for adenosine monophosphate (AMP) to activate tryptophan; coenzyme A (CoA) is used to thiolate the thiol-modified domain of the NRPS-overexpressing algal protease; NADPH provides an electron pair, allowing the carboxyl group on tryptophan to first gain two electrons to be reduced to an aldehyde, and then gain two electrons to be reduced to an alcohol, thereby preparing tryptophanol.

[0049] In some embodiments, the culture medium is a phosphorus-deficient f / 2 artificial seawater medium. Whether tryptophanol is obtained through in vitro or in vivo culture, the culture medium for NRPS gene-overexpressing algal strains is a phosphorus-deficient f / 2 artificial seawater medium.

[0050] In some embodiments, whether in vitro or in vivo culture, the culture conditions for the NRPS gene-overexpressing algal strains are: alternating culture under light and dark conditions, wherein the light intensity under the light conditions is 90 μmol / m². -2 s -1 Specifically, after culturing continuously under light for 12 hours, the culture medium is switched to darkness for 12 hours, and then switched back to light for 12 hours, alternating in this cycle until the NRPS protein is expressed in large quantities in the NRPS gene-overexpressing algal strain. During the culture of the NRPS gene-overexpressing algal strain, the growth of the NRPS gene-overexpressing algae is observed daily, and the culture medium is shaken to prevent the algae from settling to the bottom. The production of NRPS protein is monitored using laser confocal microscopy during the culture process until the NRPS protein is expressed in large quantities.

[0051] In some embodiments, whether in vitro or in vivo culture, the culture temperature of the NRPS gene-overexpressing algal strain is (20±1)℃.

[0052] In some embodiments, algal strains overexpressing the NRPS gene are constructed using the following methods:

[0053] (1) Primers were designed based on the CDS sequence of the NRPS gene and PCR amplification was performed. After purification of the amplification product, the enzyme digestion product was recovered and ligated with the pYT28 plasmid to obtain the NRPS gene overexpression vector pYT28-NRPS.

[0054] (2) The NRPS gene overexpression vector pYT28NRPS was transferred into Escherichia coli containing pTA-Mob plasmid. pYT28NRPS was then transferred into diatom cells via E. coli to obtain NRPS gene overexpression algal strains.

[0055] The diatom is *Phaeodactylum tricornutum*. The specific implementation process of step (1) is as follows:

[0056] The NRPS gene of *Phaeodactylum tricornutum* was obtained from the GeneBank database. Analysis showed that the CDS sequence of the NRPS gene was 4104 bp long and encoded a protein containing 1367 amino acids.

[0057] Specific primers were designed based on the CDS sequence of the *Phaeodactylum tricornutum* NRPS gene. The sequences are as follows:

[0058] NRPS-F1:

[0059] GCATCACCATCACCATCACGGATCCATGACTCAGGACGAGCCGAAGTG;

[0060] NRPS-R1:

[0061] GGAGTCCAAGTCCAGCTAATTAAGCTTTTAGGCGGGCTCGTCTCGAGG.

[0062] Total RNA was extracted from *Phaeodactylum tricornutum*, and cDNA was obtained by reverse transcription. Using cDNA as a template, the obtained cDNA was amplified by high-fidelity enzyme PCR using the specific primers mentioned above. The amplification product was NRPS. The amplification product was then recovered, purified, and cloned into the pYT28 vector digested with BamHI to obtain the pYT28-NRPS recombinant plasmid, which was sent to a sequencing company for sequence confirmation.

[0063] Transforming the correctly sequenced pYT28-NRPS recombinant plasmid into E. coli EPI300 containing the pTA-Mob plasmid successfully constructed the NRPS gene overexpression vector.

[0064] The specific implementation process of step (2) is as follows:

[0065] The algae *Phaeodactylum tricornutum* were spread on 50% L1 solid plates and cultured for 4 days before being collected in L1 liquid medium. Simultaneously, *E. coli* containing pYT28-NRPS and pTA-Mob plasmids were inoculated into LB liquid medium and cultured to the logarithmic growth phase. After centrifugation and discarding the supernatant, the bacteria were resuspended in SOC liquid medium. The algae and bacteria were then mixed and spread on 50% L1 and 5% LB solid media, incubated at 30°C, and then placed in a full-light incubator. The algae collected from the L1 liquid plates were then spread onto 50% L1 solid plates and cultured at 18°C ​​for approximately 30 days, with daily conditions of 16 hours of light and 8 hours of darkness, yielding yellowish-brown algal spots, which were NRPS gene overexpressing algal strains.

[0066] It should be noted that the NRPS gene overexpressing algal strain disclosed herein was constructed with reference to the patent application document with publication number CN117587040A, and the specific method will not be described in detail here.

[0067] The technical effects of this disclosure will be illustrated below through specific embodiments.

[0068] Example 1

[0069] A phosphorus-deficient f / 2 artificial seawater culture medium was prepared, with 10 mM tryptophan added. The medium was then inoculated with an NRPS-overexpressing algal strain and cultured alternately under light and dark conditions. The light intensity under the light conditions was 90 μmol / m². -2 s -1 The culture time was 12h, then it was transferred to a dark environment for 12h, and then transferred to a light environment for culture, and this cycle was repeated. The culture temperature in both the light and dark environments was controlled at (20±1)℃. The growth of the algal strains overexpressing the NRPS gene was observed every day and the culture medium was shaken to prevent the algae from sinking to the bottom. Laser confocal microscopy was used to monitor the culture process until the NRPS protein was expressed in large quantities and the reaction product 1 was obtained.

[0070] The results of laser confocal microscopy detection of NRPS protein overexpression are attached. Figure 1 As shown.

[0071] Reaction product 1 was detected by high-performance liquid chromatography (HPLC) at a detection wavelength of 236 nm. Mobile phase A was deionized water containing 0.1% trifluoroacetic acid, and mobile phase B was acetonitrile containing 0.1% trifluoroacetic acid. The elution gradient was 0 min 5% B, 10 min 100% B, 14 min 100% B, 14.1 min 5% B, and 18 min 5% B. A standard curve was established with tryptophan concentration on the x-axis and peak area on the y-axis. The HPLC results are as follows: Figure 2 As shown, the retention time of the substrate tryptophan was 10.7 min, while product 1 (PtNRPS1) showed an additional chromatographic peak at 10.3 min. A large amount of this product peak was obtained after separation and purification. The product peak was dissolved in deuterated CD3OD after rotary evaporation to remove the solvent and thorough drying. The structure of the compound was identified by nuclear magnetic resonance spectroscopy. The proton and carbon spectra are shown below. Figure 3 As shown; simultaneously, mass spectrometry detection is as follows Figure 4 As shown, the molecular weight of the compound was measured to be 191.1171 Da, and comprehensive analysis indicates that the compound is tryptophanol.

[0072] Example 2

[0073] (1) Culture of algal strains overexpressing NRPS gene

[0074] Phosphorus-deficient f / 2 artificial seawater medium was prepared, and NRPS-overexpressing algal strains were inoculated into the medium. The cultures were then alternated between light and dark environments, with the light intensity in the light environment being 90 μmol / m². -2 s -1 The culture period was 12 hours, followed by 12 hours in darkness, and then 12 hours in light, alternating between the two environments. The culture temperature was maintained at (20±1)℃ in both light and dark environments. The growth of the NRPS gene-overexpressing algal strain was observed daily, and the culture medium was shaken to prevent the algae from settling. Laser confocal microscopy was used for monitoring during the culture process until NRPS protein was highly expressed, yielding the NRPS gene-overexpressing algal culture. The NRPS gene-overexpressing algal protein was isolated and purified from the culture using an algal protein extraction kit, and the protein concentration was determined using the Coomassie Brilliant Blue method.

[0075] (2) Construction of in vitro enzyme-catalyzed reaction system

[0076] Prepare 1 mL of in vitro enzymatic reaction solution, which includes 50 mM Tris-HCl buffer (pH 7.5), 10 mM ATP, 10 mM MgCl2, 0.5 mM CoA, 1 mM NADPH, 10 mM tryptophan and 0.5 mM NRPS overexpressing algal protein, and incubate at 37 °C for 12 h to obtain reaction product 2.

[0077] (3) Constructing a control group for the enzyme reaction system

[0078] Prepare 1 mL of in vitro enzymatic reaction solution, which includes 50 mM Tris-HCl buffer (pH 7.5), 10 mM ATP, 10 mM MgCl2, 0.5 mM CoA, 1 mM NADPH, 10 mM tryptophan and 0.5 mM NRPS overexpression algal protein that has been inactivated by high temperature. Incubate at 37 °C for 12 h to obtain the control group.

[0079] (4) The reaction product 2 and the control group were analyzed by ultra-high performance liquid chromatography (UPLC).

[0080] Reaction product 2 was extracted three times with equal volumes of ethyl acetate. The organic phases were then combined and centrifuged at 15000g for 30 min to remove protein precipitate, yielding the corresponding analytical solution. The control group was prepared using the same method to obtain the corresponding analytical solution. UPLC analysis was then performed on reaction product 2 and the analytical solutions from the control group. The detection wavelength for UPLC analysis was 236 nm. Mobile phase A was deionized water containing 0.1% trifluoroacetic acid, and mobile phase B was acetonitrile containing 0.1% trifluoroacetic acid. The elution gradient was 0 min 5% B, 10 min 100% B, 14 min 100% B, 14.1 min 5% B, and 18 min 5% B. A standard curve was established with tryptophan concentration as the x-axis and peak area as the y-axis. The analytical results are shown below. Figure 5 As shown.

[0081] like Figure 5 As shown, in the control group (WT), the retention time of the substrate tryptophan was 7.1 min, while the reaction product 2 (PtNRPS1-OE) had an additional product peak at 6.9 min, which was consistent with the retention time of tryptophan at 6.9 min. This indicates that tryptophan was generated in reaction product 2, that is, tryptophan was successfully synthesized in vitro by enzymatic reaction.

[0082] Auxins were the first plant hormones discovered, with indole-3-acetica acid (IAA) being the most important. Other auxins include 4-chloro-IAA, 5-hydroxy-IAA, 1-naphthaleneacetic acid (NAA), and indolebutyric acid. For terrestrial higher plants, auxins regulate stem growth rate, inhibit lateral buds, and promote root development, making them valuable in agriculture. Furthermore, increasing research indicates that auxins also promote the growth of aquatic plants such as algae. However, for terrestrial plants, adding indoleacetic acid or other auxins to soil or spraying them directly onto the plant often yields good results with small dosages. In contrast, for aquatic algae, due to their low biomass per unit volume, large amounts of liquid culture medium (seawater or freshwater) are often required, resulting in significantly higher auxin usage.

[0083] Currently, only terrestrial higher plant growth regulators have been used to promote algal growth, and there are no reports of algae-specific growth regulators. Discovering plant growth regulators that require lower dosages, are more efficient, and have more environmentally friendly synthesis pathways will be more beneficial to the sustainable development of aquaculture.

[0084] Based on the above, the tryptophan prepared using any of the above embodiments in this disclosure can be used to prepare plant growth regulators, which can be used to promote plant growth, especially showing a significant promoting effect on the growth of aquatic algae. To further study the regulatory effect of tryptophan prepared in this disclosure on plant growth, diatoms will be used as an example to compare its growth-promoting effect with that of the most typical higher plant growth regulator, 3-indoleacetic acid.

[0085] Experiment 1: Treatment of algal cells with tryptophan

[0086] Prepare f / 2 artificial seawater and inoculate wild-type diatoms in it for culture. Culture in this artificial seawater is carried out under alternating light and dark conditions, with the light intensity in the light conditions being 90 μmol / m². -2 s -1 The diatoms were cultured for 12 hours, followed by 12 hours in darkness. The temperature in both light and dark environments was controlled at (20±1)℃. The diatom growth was observed daily, and the culture flasks were shaken to prevent the algae from settling to the bottom, until the diatoms reached their logarithmic growth phase. The algal cells were collected by centrifugation, and f / 2 artificial seawater containing 5 pg / L, 10 pg / L, 20 pg / L, 40 pg / L, 60 pg / L, 80 pg / L, and 100 pg / L tryptophan was prepared, resulting in multiple groups of f / 2 artificial seawater with different tryptophan concentrations. The algal cells were then diluted to 5 × 10⁻⁶ using the aforementioned f / 2 artificial seawater with different tryptophan concentrations. 6 / mL, and then the algal cells in each group were cultured, specifically, alternately cultured in light and dark environments, with the light intensity in the light environment being 90 μmol / mL. -2 s -1 The culture time was 12 hours, followed by 12 hours of culture in darkness. The culture temperature in both light and dark environments was controlled at (20±1)℃. The absorbance of each culture group at 680 nm was measured at 0 h, 24 h, 48 h, 72 h, and 96 h. The number of algal cells in each culture group was calculated using the following formula: y=100x+1.12(R 2 =99.08), where x is the OD 680 Absorbance value, y is the algal cell concentration (10 5 (cells / mL).

[0087] Experiment 2: Treatment of algal cells with 3-indoleacetic acid

[0088] F / 2 artificial seawater was prepared, and wild-type diatoms were inoculated into it for culture. The culture conditions and temperature were the same as in Experiment 1, and will not be repeated here. Algal cells were collected by centrifugation, and f / 2 artificial seawater containing 0.1 ng / L, 1 ng / L, 10 ng / L, 100 ng / L, 5000 ng / L, 20000 ng / L, 40000 ng / L, and 100000 ng / L 3-indoleacetic acid (3-IAA) was prepared to obtain multiple groups of f / 2 artificial seawater with different 3-IAA concentrations. The algal cells were diluted to 5 × 10⁻⁶ using the aforementioned f / 2 artificial seawater with different 3-IAA concentrations. 6 / mL, and then the algal cells in each group were cultured again. The culture conditions and temperature were the same as in Experiment 1, and will not be repeated here. Similarly, the absorbance values ​​of each group of cultures at 680nm were measured at 0h, 24h, 48h, 72h, and 96h, and then calculated according to y=100x+1.12(R 2 The formula (99.08) is used to calculate the number of algal cells.

[0089] Experimental results

[0090] The effects of tryptophan on algal growth are as follows: Figure 6 As shown, the effects of 3-indoleacetic acid on diatom cells are as follows: Figure 7 As shown. From Figure 6 and Figure 7 The results show that different concentrations of tryptophan and 3-indoleacetic acid (3-IAA) have a consistent effect on algal cells: low concentrations promote algal cell growth, while high concentrations inhibit it. Tryptophan showed the highest growth-promoting rate at a final concentration of 20 pg / L (5.86%), while 3-IAA showed the highest rate at a final concentration of 5000 ng / L (10.66%). This indicates that tryptophan can effectively promote algal growth at a significantly lower dosage than existing growth regulators.

[0091] Further research was conducted to analyze the total carbon and total nitrogen content of diatoms after treatment with tryptophan.

[0092] Prepare f / 2 artificial seawater and inoculate wild-type diatoms in it for culture. Culture in alternating light and dark environments, with the same conditions and temperatures as in Experiment 1, will not be repeated here. Collect algal cells by centrifugation and prepare f / 2 artificial seawater containing 20 pg / L tryptophan, 5000 ng / L 3-indoleacetic acid, and without these substances. Then, use the aforementioned f / 2 artificial seawater to dilute the obtained algal cells to 5 × 10⁻⁶. 6 / mL, and then continue to culture the algal cells in each group. The culture conditions and temperature were the same as in Experiment 1, and will not be repeated here. After culturing for 24h, 48h, 72h and 96h, the algal cells were collected by centrifugation, vacuum concentrated and dried, and the total carbon and total nitrogen contents were determined using an elemental analyzer (varioISOTOPE, Elementar). At the same time, the algal cells at 1h, 4h, 24h, 48h, 72h and 96h were sent to a gene sequencing company for transcriptome sequencing. The sequencing results were used to perform differential expression analysis (DEGs) using the DESeq2 R package (1.20.0). Significant DEGs were identified using the thresholds |log2(fold change)|≥1 and p<0.05. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases were used to perform functional and pathway enrichment analysis on significant DEGs.

[0093] The results of the total carbon content determination are as follows: Figure 8 As shown, the results of the total nitrogen content determination are as follows: Figure 9 As shown. From Figure 8 and Figure 9 It can be seen that both 20 pg / L tryptophan and 5000 ng / L 3-indoleacetic acid (3-IAA) can increase the total carbon and total nitrogen content in algal cells. At 24 h, tryptophan increased the total carbon and total nitrogen content to 36.42% and 6.21%, respectively. The total carbon content was 1.06 and 1.04 times that of the control group and the 3-IAA treatment group, respectively, and the total nitrogen content was 1.07 and 1.04 times that of the control group and the 3-IAA treatment group, respectively. Therefore, tryptophan can rapidly promote the accumulation of total carbon and total nitrogen in algal cells within a short period of time, thus promoting diatom growth.

[0094] Transcriptome results as follows Figure 10 As shown, numerous genes involved in nitrogen metabolism pathways, such as nitrate transporters (PHATRDRAFT_54101, PHATRDRAFT_26029), nitrate reductase (PHATRDRAFT_54983), nitrite transporters (PHATRDRAFT_46427), nitrite reductases (PHATRDRAFT_8155, PHATRDRAFT_13154), nitrite and sulfite reductases (PHATRDRAFT_27757), and glutamine synthetase 2 (PHATRDRAFT_51092), were significantly upregulated. Therefore, tryptophanol promotes nitrogen absorption and transport, and thus diatom growth, by regulating the upregulation of genes in nitrogen metabolism pathways.

[0095] This invention discloses a method for preparing and applying tryptophan, successfully preparing tryptophan using algal strains overexpressing tryptophan and the NRPS gene. Specifically, tryptophan can be directly synthesized in vivo from NRPS gene-overexpressing algal strains. Simultaneously, since the NRPS gene-overexpressing algal protein has the ability to synthesize tryptophan in vitro, tryptophan can also be prepared in vitro. This involves first culturing NRPS gene-overexpressing algal strains to obtain NRPS gene-overexpressing algal culture, then isolating and purifying the NRPS gene-overexpressing algal protein from the culture, and finally using tryptophan and the NRPS gene-overexpressing algal protein as reaction substrates for an in vitro enzymatic reaction to obtain tryptophan. In this disclosure, whether using in vivo or in vitro culture to obtain tryptophan, compared to existing synthesis methods, it effectively reduces the synthesis difficulty and is environmentally friendly, reducing environmental pollution. Furthermore, the NRPS gene in the NRPS gene-overexpressing algal strains is in an overexpressed state, which can effectively utilize more tryptophan to generate tryptophan, effectively improving the synthesis efficiency. Based on this, the tryptophan prepared in this disclosure has a similar effect on promoting algal growth as 3-indoleacetic acid, and can effectively promote the growth of marine algae, especially marine diatoms. Its main mechanism of action is to promote rapid algal growth by enhancing nitrogen assimilation. At the same time, compared with the typical plant growth regulator 3-indoleacetic acid, the effective concentration of tryptophan is about one ten-thousandth of that of 3-indoleacetic acid, which is much lower than the latter, and has important application value in the field of algae cultivation.

[0096] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of this application (including the claims) is limited to these examples; within the framework of this application, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of different aspects of the embodiments of this application as described above, which are not provided in the details for the sake of brevity.

[0097] Furthermore, given that details have been set forth to describe exemplary embodiments of this application, it will be apparent to those skilled in the art that embodiments of this application may be practiced without these details or with variations thereof. Therefore, these descriptions should be considered illustrative rather than restrictive.

[0098] To simplify the description and discussion, and to avoid obscuring the embodiments of this application, well-known power / ground connections to other components may or may not be shown in the provided drawings. Furthermore, the apparatus may be shown in block diagram form to avoid obscuring the embodiments of this application, and this also takes into account the fact that the details of implementation of these block diagram apparatuses are highly dependent on the platform on which the embodiments of this application will be implemented (i.e., these details should be fully understood by those skilled in the art). While specific details have been set forth to describe exemplary embodiments of this application, it will be apparent to those skilled in the art that the embodiments of this application may be implemented without these specific details or with variations thereof. Therefore, these descriptions should be considered illustrative rather than restrictive.

[0099] Although this application has been described in conjunction with specific embodiments thereof, many substitutions, modifications, and variations of these embodiments will be apparent to those skilled in the art from the foregoing description. The embodiments of this application are intended to cover all such substitutions, modifications, and variations falling within the broad scope of the appended claims. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the embodiments of this application should be included within the protection scope of this application.

Claims

1. A method for preparing tryptophan, characterized in that, include: Tryptophanol was prepared using algal strains overexpressing tryptophan and NRPS genes.

2. The method for preparing tryptophan according to claim 1, characterized in that, The preparation of tryptophanol using algal strains overexpressing tryptophan and NRPS genes includes: Tryptophan was added to the culture medium, and an algal strain overexpressing the NRPS gene was inoculated and cultured in the medium to obtain tryptophanol.

3. The method for preparing tryptophan according to claim 1, characterized in that, The preparation of tryptophanol using algal strains overexpressing tryptophan and NRPS genes includes: NRPS gene overexpressing algal strains were inoculated and cultured in a culture medium to obtain NRPS gene overexpressing algal strain cultures. The protein of the NRPS-overexpressing algal strain was isolated and purified from the NRPS gene overexpressing algal culture; Tryptophan and NRPS-overexpressing algal protein were used as reaction substrates for in vitro enzymatic reactions to obtain tryptophanol.

4. The method for preparing tryptophan according to claim 3, characterized in that, The catalytic enzymes for in vitro enzymatic reactions include reduced coenzyme II.

5. The method for preparing tryptophan according to claim 4, characterized in that, The reaction solution for in vitro enzymatic reactions also includes Tris-HCl buffer, ATP, MgCl2, and coenzyme A.

6. A method for preparing tryptophan according to any one of claims 1 to 5, characterized in that, The culture medium was phosphorus-deficient f / 2 artificial seawater medium.

7. A method for preparing tryptophan according to any one of claims 1 to 5, characterized in that, The algal strains overexpressing the NRPS gene were cultured under alternating light and dark conditions, with the light intensity in the light-only conditions being 90 μmol / m². -2 s -1 .

8. A method for preparing tryptophan according to any one of claims 1 to 5, characterized in that, The culture temperature for the algal strain overexpressing the NRPS gene was (20±1)℃.

9. A method for preparing tryptophan according to any one of claims 1 to 5, characterized in that, The NRPS gene overexpression algal strain was constructed using the following method: Primers were designed based on the CDS sequence of the NRPS gene, and PCR amplification was performed. After purification of the amplification product, the enzyme digestion product was recovered and ligated with the pYT28 plasmid to obtain the NRPS gene overexpression vector pYT28-NRPS. The NRPS gene overexpression vector pYT28-NRPS was transformed into E. coli containing the pTA-Mob plasmid. The pYT28-NRPS was then transferred into diatom cells via E. coli conjugation, resulting in an NRPS gene overexpressing algal strain.

10. An application of tryptophan, characterized in that, include: Plant growth regulators are prepared using tryptophan prepared by any one of the methods described in claims 1 to 9 to promote plant growth.

Images