Indel molecular marker, primer and kit of citron and application of Indel molecular marker, primer and kit in identification of citron

Abstract

The invention belongs to the technical field of molecular marker development and molecular detection, and particularly relates to an Indel molecular marker of citron, a primer, a kit and application of the Indel molecular marker to citron identification. According to the Indel molecular marker based on the citron, the primer and the kit, the citron and other citron citrus varieties can be quickly, accurately and effectively distinguished, and the Indel molecular marker, the primer and the kit can be used for identifying the authenticity of the citron and nursery stocks. Meanwhile, a primer for detecting the Indel molecular marker has high quality and high specificity and has no dependence on the quality of an amplification reagent, so that amplification can be performed by using relatively low 2 * Taq plus master mix, the identification cost is saved, and technical support is provided for protection of the variety and further development of the industry.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker development and molecular detection technology, specifically relating to an Indel molecular marker, primers, and reagent kit for citron and their application in the identification of citron. Background Technology

[0002] Rutaceae family, Citrus genus ( Citrus ) includes citrus ( Microacrumen ), grapefruit ( Cephalocitrus ) and citron ( Citrophorum There are three basic species. Among them, lemon is a hybrid offspring of citron and sour orange.

[0003] In recent years, lemon tea has become a best-selling category in the tea beverage industry. The raw materials used to make lemon tea typically include citrus varieties such as 'Guangdong Fragrant Lemon,' 'Eureka,' 'Fimina,' 'Werner,' and 'Filo,' promoting the rapid development of citrus planting areas. However, most varieties and supporting technologies are still in the early stages of development, resulting in a large and disorganized variety mix. Particularly in seedling production, companies source scions from diverse sources, and informal and illegal introduction methods still account for a significant proportion of seedling production, posing a serious threat to the healthy and sustainable development of the industry.

[0004] Currently, morphological markers are commonly used for preliminary identification of seedlings. This method relies on tree characteristics such as leaf shape, fruit shape, and tree form, combined with selection based on growth habits and physiological features. However, the available morphological markers are limited, easily influenced by the environment, and only applicable to varieties with significant genetic differences. Furthermore, it cannot accurately identify seedlings in the early stages. Therefore, there is an urgent need for an accurate, economical, and efficient method for identifying citrus seedlings of the Citrus genus. Summary of the Invention

[0005] The purpose of this invention is to provide an Indel molecular marker, primers, and kit for citron, and their application in the identification of citron. The Indel molecular marker can quickly and efficiently distinguish citron from other citron varieties.

[0006] This invention provides an Indel molecular marker for citron, wherein the Indel molecular marker is a 66bp insertion variant located at 489260bp on chromosome 1 of the citron genome, and the insertion sequence is shown in SEQ ID NO:9.

[0007] Preferably, the nucleotide sequence containing the Indel molecular marker is shown in SEQ ID NO:7.

[0008] The present invention also provides a primer for amplifying the Indel molecular marker described in the above technical solution, wherein the nucleotide sequences of the forward primer and the reverse primer are shown in SEQ ID NO:5 or SEQ ID NO:6, respectively.

[0009] The present invention also provides the application of the Indel molecular marker or the primer described in the above technical solution in the preparation of citron detection reagent.

[0010] Preferably, the detection reagent includes a kit.

[0011] The present invention also provides a citron detection kit, comprising PCR amplification reagents and primers as described in the above technical solution.

[0012] The present invention also provides the application of the Indel molecular marker, the primer, or the citron detection kit described in the above-mentioned technical solutions in the identification of citron.

[0013] This invention also provides a method for identifying citron, comprising the following steps: The genomic DNA of the sample to be tested was amplified using primers to obtain PCR amplification products; The PCR amplification products were detected by gel electrophoresis to obtain gel electrophoretic amplification bands; The results are determined based on the size of the amplified bands in the gel electrophoresis: When the gel electrophoresis amplification band is 294bp, the sample to be tested is citron; When the gel electrophoresis amplification band is 230bp, the sample to be tested is a citrus variety other than citron. The nucleotide sequences of the forward and reverse primers are shown in SEQ ID NO:5 or SEQ ID NO:6, respectively.

[0014] Preferably, the PCR amplification system comprises the following components: 10.0 µL of 2×Taq Mix, 0.5 µL of 10 mmol / L forward primer, 0.5 µL of 10 mmol / L reverse primer, 1.0 µL of genomic DNA template, and 8.0 µL of ddH2O.

[0015] Preferably, the PCR amplification program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 10 min.

[0016] Beneficial effects: This invention provides an Indel molecular marker for citron, specifically a 66bp insertion variant located at 489260bp on chromosome 1 of the citron genome, as shown in SEQ ID NO:9. Furthermore, this invention provides primers and a kit for detecting this Indel molecular marker. Based on this citron Indel molecular marker, primers, and kit, citron can be rapidly and accurately distinguished from other citron varieties, and can be used to identify the authenticity of citron and its seedlings. Simultaneously, the primers for detecting the Indel molecular marker in this invention possess high quality and high specificity, and are not dependent on the quality of the amplification reagents; therefore, a relatively inexpensive 2×Taq plus master mix can be used for amplification, saving identification costs. Furthermore, the Indel molecular marker and primers of this invention can be easily and quickly applied to research or production practices of related citron varieties, providing an effective method and approach for identifying 'citron' seedlings and laying a solid foundation for this work. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0018] Figure 1 The image shows the leaf morphology of 11 citrus varieties from Example 1. Figure 2 This is a diagram showing the results of using IGV2.10.3 software to visualize and verify mutation information in Example 1; Figure 3 This is a gel electrophoresis image of the amplified cells after amplification with the three pairs of InDel primers in Example 1; Figure 4 This is a diagram showing the visualization of InDel-3 variant information using GeneDoc software in Example 1. Figure 5 The image shows the identification results of 11 citrus germplasms from Example 2 using the InDel-03 primers. Detailed Implementation

[0019] This invention provides an Indel molecular marker for citron, wherein the Indel molecular marker is a 66bp insertion variant located at 489260bp on chromosome 1 of the citron genome, and the insertion sequence is shown in SEQ ID NO:9.

[0020] As one embodiment, the present invention includes the nucleotide sequence of the Indel molecular marker as shown in SEQ ID NO:7.

[0021] The present invention also provides a primer for amplifying the Indel molecular marker described in the above technical solution, wherein the nucleotide sequences of the forward primer and the reverse primer are shown in SEQ ID NO:5 or SEQ ID NO:6, respectively.

[0022] The present invention also provides the application of the Indel molecular marker or the primer described in the above technical solution in the preparation of citron detection reagent.

[0023] As one implementation method, the detection reagent includes a kit.

[0024] This invention also provides a citron detection kit, comprising PCR amplification reagents and the primers described in the above-described technical solution. This invention does not specifically limit the source and composition of the PCR amplification reagents; they can be prepared conventionally as needed and purchased through conventional commercial channels.

[0025] The present invention also provides the application of the Indel molecular marker, the primer, or the citron detection kit described in the above-mentioned technical solutions in the identification of citron.

[0026] This invention also provides a method for identifying citron, comprising the following steps: The genomic DNA of the sample to be tested was amplified using primers to obtain PCR amplification products; The PCR amplification products were detected by gel electrophoresis to obtain gel electrophoretic amplification bands; The results are determined based on the size of the amplified bands in the gel electrophoresis: When the gel electrophoresis amplification band is 294bp, the sample to be tested is citron; When the gel electrophoresis amplification band is 230bp, the sample to be tested is a citrus variety other than citron. The nucleotide sequences of the forward and reverse primers are shown in SEQ ID NO:5 or SEQ ID NO:6, respectively.

[0027] In one implementation, the sample to be tested can be genomic DNA from a citrus variety, which can be extracted from leaves, fruit, or root tissue. This invention does not specifically limit the extraction method of the genomic DNA; conventional genomic DNA extraction methods in the art can be used.

[0028] In one embodiment, the PCR amplification system of the present invention comprises the following components: 10.0 µL of 2×Taq Mix, 0.5 µL of 10 mmol / L forward primer, 0.5 µL of 10 mmol / L reverse primer, 1.0 µL of genomic DNA template, and 8.0 µL of ddH2O. In another embodiment, the PCR amplification program of the present invention is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 10 min.

[0029] In one embodiment, the gel electrophoresis detection of the present invention can be agarose gel electrophoresis detection; in another embodiment, the agarose gel electrophoresis detection of the present invention can be 2.5% agarose gel electrophoresis detection.

[0030] In the method described in this invention, the primers have high quality and high specificity, so amplification can be performed using a relatively inexpensive 2×Taq plus master mix (each mix tube contains 1 mL, costs 15 yuan, and can identify 100 samples), thus saving identification costs.

[0031] This invention develops a unique InDel molecular marker for the citron variety based on genome resequencing data. This marker can be used to identify the origin of citron seedlings, providing an accurate, economical, and efficient germplasm identification method. The InDel molecular marker and related methods described in this invention can effectively distinguish citron from other citrus varieties, providing technical support for the protection of this variety and the further development of the industry.

[0032] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0033] Example 1 InDel primer design and screening of effective primers 1. Material Selection The 'Xiangyuan' citron and 10 other citron varieties from the Citrus Germplasm Resource Nursery of the Institute of Tropical and Subtropical Economic Crops, Yunnan Academy of Agricultural Sciences, were used as test materials (Table 1). Figure 1 (where numbers 1 to 11 correspond one-to-one with the citrus varieties represented by the numbers in Table 1). Genomic DNA was extracted from leaf tissues of citrus varieties using the CTAB method. The extracted DNA from 'Citrus' and 'Guangdong Fragrant Lemon' was purified to meet the quality requirements for resequencing.

[0034] Table 1 Summary of information on 11 citrus varieties of citrus

[0035] 2. InDel-labeled primer pair design and screening of effective primer pairs Using the published 'Citrus medica' genome (CPBD: Citrus Pan-genome to Breeding Database, http: / / citrus.hzau.edu.cn / ) as the reference genome, bioinformatics methods were employed to analyze the resequencing data of 'Guangdong fragrant lemon'. FastQC software was used for quality control and filtering of the raw resequencing data, removing adapter sequences and low-quality reads. Then, BWA software was used to align the quality-controlled reads to the 'Citrus medica' genome. GATK 4.2.0 software was used for whole-genome InDel variant detection and gvcf file merging and filtering. The vcf files containing InDel information were sorted according to InDel fragment size to determine variant information, and IGV 2.10.3 software was used for further visualization to verify the variant information. Figure 2 ).

[0036] Based on the genomic variation sequences of 'Citrus medica' and 'Guangdong Fragrant Lemon', three pairs of specific, high-quality primers were designed (Table 2). The primers were synthesized by Qingke Biotechnology Co., Ltd., and then InDel-labeled primer pairs were used for effectiveness screening. PCR amplification was performed on 'Citrus medica' and 'Guangdong Fragrant Lemon', and the amplified bands were detected by electrophoresis. High-quality, specific InDel markers for 'Citrus medica' were selected as candidate effective source identification primers.

[0037] Table 2. Information on InDel primers used for genetic identification of 'citron'

[0038] The specific operating steps are as follows: The PCR reaction system consisted of 20 µL of components: 10.0 µL 2× Taq Mix, 0.5 µL F (forward primer 10 mmol / L), 0.5 µL R (reverse primer 10 mmol / L), 1.0 µL DNA (template 300 ng / L), and 8.0 µL ddH2O.

[0039] The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 10 min, and storage at 4℃.

[0040] After amplification according to the above PCR reaction system and procedure, 8 μL of the PCR amplification product was electrophoresed in a 2.5% agarose gel (0.5×TBE buffer), and the results were observed under a gel imaging system after development by Goldview (Guangzhou Jianyang Biotechnology Co., Ltd.). Figure 3 As shown.

[0041] InDel-1, InDel-2, and InDel-3 all effectively distinguished 'citron' from 'Guangdong fragrant lemon'. However, the InDel-1 primer pair amplified only 2 out of 4 'citron' samples. The InDel-3 primer pair exhibited more pronounced characteristic bands and a longer inserted feature fragment compared to the InDel-2 primer pair, thus more significantly differentiating the two. Based on the test results, only one effective primer pair, InDel-3, was ultimately determined to differentiate 'citron' from 'Guangdong fragrant lemon'.

[0042] Simultaneously, the InDel-3 site was cloned and its sequence analyzed, as follows: The Escherichia coli clone strain DH5α was purchased from TransGenBiotech; the blunt-ended cloning vector pClone007 Blunt Simple Vector Kit was purchased from Tsingke.

[0043] The 'citron' and 'Guangdong fragrant lemon' variant sites were amplified by PCR using InDel-3 specific primers. The PCR products were recovered and processed using EZNA. ® DNA recovery kit (Omega, USA) was used, and the procedure was performed according to the kit instructions. The purified fragment was ligated into the blunt-ended cloning vector pClone007, then transformed into *E. coli* DH5α and cultured overnight at 37°C. Two single clones were picked from each culture dish transformed with the InDel-3 site. The transformed product size was amplified using the primers corresponding to InDel-3 in Table 2. After confirming that the size matched the target band size, the clones were sent to Kexin Biotechnology for sequencing verification. Specific TA cloning procedures were performed according to the pClone007 Blunt Simple Vector Kit instructions. Sequence alignment of variant sites was performed using ClustalX software, and visualization was performed using GeneDoc software.

[0044] Cloning was performed on the InDel-3 variant site (chr1:489260) of 'citron' and 'Guangdong fragrant lemon'. The sequence length of 'citron' was 294 bp, as shown in SEQ ID NO:7: AGTGACACAAAGCTGATGTGCAACTAGCACTTGAGAGATTAGAGACAATTGATTTTGGCATTAAGGTCTTGACACAGGATTAGATTGCATGTTTCGAAGATTAATCCAAAATCGAGTGTCCCTCTTTAATGTACTAACACCTTGAACTTTTTGTACATGTAAATTTGGCATGGCATCCACATTTTATAGGATTACTCCATGTTCAAAATCAAGTTTTTGTAAAAAATTTTGTGTATAATTAAGTTTGAGATTTTCAGTTCATATGCAGTATCTTAATTTTCTTATTCACGCTAT; while the sequence length of 'Guangdong fragrant lemon' was 230 bp, as shown in SEQ ID NO:7. As shown in NO:8: AGTGACACCAAAGCTGATGTGCAACTAGCACTTGAGAGATTAGAGACAATTGATTTTGGCATTAAGGTCTTGACACAGGATTAGATTGCATGTTTCGAAGATTAATCCAAAATCGAGTGTCCCTCTTTAATGTACTAACACCTTGAACTTTTTGTAAAAAATTTTGTGTATAATTAAGTTTGAGATTTTCAGTTCATATGCAGTATCTTAATTTTCTTATGTCACGCTAT. A 66bp insertion was found at this site in 'citron', as shown in SEQ ID NO:9. The nucleotide sequence of SEQ ID NO:9 is: ACATGTAAATTTGGCATGGCATCCACATTTTATAGGATTACTCCATGTTCAAAATCAAGTTTTTGT. Comparison shows that there is a 66bp insertion and a 2bp deletion between the sequences of 'citron' and 'Guangdong fragrant lemon'. Figure 2 and Figure 4 As shown, in Figure 4 In the text, XY and GDX represent 'citron' and 'Guangdong perfume lemon', respectively.

[0045] It is evident that, compared to other varieties, 'Citrus' has a 66bp sequence fragment inserted at position 489260 on chromosome 1. This feature can be used to distinguish 'Citrus' from other citrus varieties using the InDel-3 primer pair.

[0046] Example 2 Verification of the unique InDel-3 primer pair for citron To verify the effectiveness of the selected InDel-3 marker primer pairs, the initial two materials, 'Xiangci' and 'Guangdong Xiangshui Lemon', were expanded to 11 commonly cultivated citrus varieties in the market as validation examples (as shown in Table 1). These 11 citrus varieties were difficult to distinguish using phenotypic characteristics such as leaf shape and plant type during the seedling stage (e.g., Figure 1 As shown in the figure, these materials were amplified by PCR using InDel-3 primers.

[0047] The specific operating steps are as follows: According to the method in Example 1, genomic DNA was extracted from 11 samples, and the samples passed the agarose gel electrophoresis test. The concentration was then measured by spectrophotometer and diluted to 300 ng / µL for later use.

[0048] The PCR reaction system consisted of 20 µL of components: 10.0 µL 2×Taq Mix, 0.5 µL F (forward primer 10 mmol / L), 0.5 µL R (reverse primer 10 mmol / L), 1.0 µL DNA (template 300 ng / L), and 8.0 µL ddH2O.

[0049] The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 10 min, and storage at 4℃.

[0050] The amplification products were electrophoresed in a 2.5% agarose gel (0.5×TBE buffer), and the results were observed using a gel imaging system after development with Goldview. The results are as follows: Figure 5 As shown, the numbers 1 to 11 correspond one-to-one with the citrus varieties represented by the numbers in Table 1.

[0051] Depend on Figure 5 It can be concluded that the band of 'citron' amplified using the InDel-3 marker primers described in this invention is 294bp, while the amplified bands of other varieties are 230bp. In other words, the InDel-3 marker primers described in this invention can distinguish 'citron' from 10 citrus materials.

[0052] From the above embodiments, it can be concluded that the 'citron' Indel molecular marker described in this invention can be used quickly and accurately for the identification of citrus germplasm resources, especially the identification of 'citron'.

[0053] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An Indel molecular marker for citron, characterized in that, The Indel molecular marker is a 66bp insertion variant located at 489260bp on chromosome 1 of the citron genome, with the insertion sequence shown in SEQ ID NO:

9.

2. The Indel molecular marker according to claim 1, characterized in that, The nucleotide sequence containing the Indel molecular marker is shown in SEQ ID NO:

7.

3. A primer for amplifying the Indel molecular marker of claim 1 or 2, characterized in that, The nucleotide sequences of the forward and reverse primers are shown in SEQ ID NO:5 or SEQ ID NO:6, respectively.

4. The use of the Indel molecular marker of claim 1 or 2 or the primer of claim 3 in the preparation of citron detection reagent.

5. The application according to claim 4, characterized in that, The detection reagents include kits.

6. A citron detection kit, characterized in that, Includes PCR amplification reagents and the primers as described in claim 3.

7. The application of the Indel molecular marker of claim 1 or 2, the primer of claim 3, or the citron detection kit of claim 6 in the identification of citron.

8. A method for identifying citron, characterized in that, Includes the following steps: The genomic DNA of the sample to be tested was amplified using primers to obtain PCR amplification products; The PCR amplification products were detected by gel electrophoresis to obtain gel electrophoretic amplification bands; The results are determined based on the size of the amplified bands in the gel electrophoresis: When the gel electrophoresis amplification band is 294bp, the sample to be tested is citron; When the gel electrophoresis amplification band is 230bp, the sample to be tested is a citrus variety other than citron. The nucleotide sequences of the forward and reverse primers are shown in SEQ ID NO:5 or SEQ ID NO:6, respectively.

9. The method according to claim 8, characterized in that, The PCR amplification system comprises the following components: 10.0 µL of 2×TaqMix, 0.5 µL of 10 mmol / L forward primer, 0.5 µL of 10 mmol / L reverse primer, 1.0 µL of genomic DNA template, and 8.0 µL of ddH2O.

10. The method according to claim 8 or 9, characterized in that, The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 10 min.

Images