Application of dcEZH2 gene and dsRNA in prevention and treatment of citrus psylla

Abstract

The application discloses DcEZH2 The application discloses a gene and a dsRNA for preventing and treating citrus psylla. The application first clones a citrus psylla DcEZH2 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and a dsDcEZH2 with a nucleotide sequence shown as SEQ ID NO. 2 is synthesized based on the sequence; the dsDcEZH2 is introduced into the citrus psylla through a feeding method, can efficiently silence the expression of the DcEZH2 gene, thereby causing the mortality of the citrus psylla to be significantly increased, the oviposition amount to be significantly decreased, and the ovary development to be inhibited. The application shows that the decrease DcEZH2 The expression can be used for preventing and treating the citrus psylla, and the provided dsDcEZH2 can be used for preparing a biological pesticide for preventing and treating the citrus psylla, and is suitable for green prevention and control of insect vectors of citrus Huanglongbing.

Description

Technical Field

[0001] This invention belongs to the field of agricultural pest control technology, specifically involving DcEZH2 Application of genes and their dsRNA in the control of citrus psyllids. Background Technology

[0002] Citrus psyllid ( Diaphorina citri Fiber is the obligate vector insect of citrus Huanglongbing (HLB), a disease caused by the bacterium spp. of the genus *Huanglongbing* (*H. HLB*). Candidatus Liberibacter asiaticus, C Citrus psyllids (L.) cause severe economic losses to the global citrus industry. Currently, the control of citrus psyllids mainly relies on chemical pesticides, but long-term use can easily lead to problems such as increased pest resistance, environmental pollution, and pesticide residues. Therefore, there is an urgent need to develop green and efficient alternative control methods.

[0003] RNA interference (RNAi) technology, which silences target gene expression by introducing specific double-stranded RNA (dsRNA), has shown great potential in the control of various pests. In recent years, dsRNA targeting key insect physiological genes (such as neuropeptides and hormone-related genes) has been developed and applied to the control of various pests. These studies have shown that targeting key genes that regulate insect development, reproduction, or immunity can effectively suppress pest population growth.

[0004] Polycomb Repressive Complex 2 (PRC2) is a key epigenetic complex regulating gene expression in eukaryotes. Its core catalytic subunit, EZH2 (Enhancer of Zeste Homolog 2), is responsible for catalyzing the trimethylation of histone H3 at lysine 27 (H3K27me3). This modification typically causes chromatin condensation and transcriptional repression of target genes. However, there are currently no publicly available reports on the sequence information, expression pattern, and application as an RNAi target for the control of the citrus psyllid EZH2 gene. This study explores the use of RNAi technology to target and silence the citrus psyllid. EZH2 Genes, in order to achieve effective control of this pest, are still a technological gap. Summary of the Invention

[0005] Based on the shortcomings and defects of existing technologies, this invention aims to provide... DcEZH2 Application of genes and their dsRNA in the control of citrus psyllids.

[0006] The first objective of this invention is to provide citrus psyllids. DcEZH2 The gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0007] A second objective of this invention is to provide a way to suppress the aforementioned DcEZH2 Application of gene expression in the control of citrus psyllids.

[0008] Preferably, the application is to suppress the DcEZH2 Applications of gene expression in increasing mortality of citrus psyllids, reducing oviposition of female citrus psyllids, or inhibiting ovarian development in female citrus psyllids.

[0009] Preferably, suppress the DcEZH2 Genes were generated by feeding female citrus psyllids. DcEZH2 The target is achieved through the dsRNA of the gene. DcEZH2 The target nucleotide sequence of the gene's dsRNA is shown in SEQ ID NO.2.

[0010] Preferably, the target DcEZH2 The concentration of the gene's dsRNA was 200-500 ng / μL.

[0011] The third objective of this invention is to provide a targeted DcEZH2 The dsRNA of the gene, and the target nucleotide sequence is shown in SEQ ID NO.2.

[0012] Preferably, the dsRNA targeting the DcEZH2 gene is prepared by the following steps:

[0013] S1. Total RNA was extracted from citrus psyllids and reverse transcribed into cDNA;

[0014] S2. Design a specific primer pair with the T7 sequence, and perform PCR amplification using the cDNA obtained in step S1 as a template to obtain a DNA fragment containing the T7 promoter sequence; the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.10.

[0015] S3. Using the DNA fragment containing the T7 promoter sequence obtained in step S2 as a template, perform in vitro transcription reaction using an in vitro transcription kit and purify it to obtain dsRNA targeting the DcEZH2 gene.

[0016] A fourth object of the present invention is to provide a formulation for controlling citrus psyllids, which contains the aforementioned targeted... DcEZH2 The dsRNA of the gene is the active ingredient.

[0017] A fifth object of the present invention is to provide the application of the described formulation in the control of citrus psyllids.

[0018] Preferably, the application includes the following steps: feeding citrus psyllids with the preparation.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] 1. First Cloning and Identification: This invention is the first to clone and identify the citrus psyllid. EZH2 The full-length coding sequence of the gene, whose nucleotide sequence is shown in SEQ ID NO.1, lays the foundation for functional research of the gene and its application as a control target.

[0021] 2. The target is novel and critical: EZH2 These are core genes involved in epigenetic regulation and are crucial for insect reproduction and development. Using them as RNA interference targets to intervene in insect physiological processes at the epigenetic level represents an innovative control strategy.

[0022] 3. Significant prevention and control effects: This invention targets... DcEZH2 The designed specific dsRNA (dsEZH2, whose targeted nucleotide sequence is shown in SEQ ID NO.2) can efficiently silence citrus psyllids. EZH2 Genes that cause a significant decrease in the number of eggs laid by pests, hinder ovarian development, and lead to a high mortality rate.

[0023] 4. Environmentally friendly and with promising application prospects: RNA interference-based technology has high sequence specificity, targeting only citrus psyllids. EZH2 The gene exhibits high safety for non-target organisms. The dsRNA provided by this invention can be developed into a novel nucleic acid biopesticide, is not prone to inducing pesticide resistance, is environmentally friendly, and has promising application prospects in the green control of vector insects of citrus Huanglongbing (HLB). Attached Figure Description

[0024] Figure 1 Based on citrus psyllid DcEZH2 Phylogenetic tree analysis constructed from the amino acid sequences of genes.

[0025] Figure 2 Citrus psyllid DcEZH2 Multiple sequence alignment of the protein SET domain with the corresponding domains of EZH2 proteins from four other insect species.

[0026] Figure 3 for DcEZH2 The relative expression levels of the gene in different age groups and tissues of citrus psyllids that do not carry Huanglongbing fungus; where different lowercase letters indicate significant differences. P <0.05 (ANOVA, Tukey's HSD test).

[0027] Figure 4The relative expression level of the DcEZH2 gene in citrus psyllids without Huanglongbing pathogens was determined after feeding with dsDcEZH2; where *** indicates the expression level of the gene. P The difference at levels <0.001 was significant ( t test).

[0028] Figure 5 For silence DcEZH2 The impact on the survival rate of citrus psyllids not carrying Huanglongbing fungus; where * and *** represent the survival rate of citrus psyllids not carrying Huanglongbing fungus. P <0.05、 P The difference at levels <0.001 was significant ( χ 2 test).

[0029] Figure 6 For silence DcEZH2 The effect on the oviposition rate of a single female citrus psyllid not carrying Huanglongbing fungus; where *** indicates that in P The difference at levels <0.001 was significant ( t test).

[0030] Figure 7 For silence DcEZH2 Microscopic comparison of ovarian development in citrus psyllids that do not carry Huanglongbing fungus. Detailed Implementation

[0031] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0032] Example 1: Citrus psyllid EZH2 ( DcEZH2 Gene cloning and bioinformatics analysis

[0033] Total RNA extraction and cDNA synthesis: Adult citrus psyllids not carrying Huanglongbing (HLB) were collected in the laboratory and total RNA was extracted using RNAiso Plus (Cat#9108, Takara). Genomic DNA was removed using the PrimeScript™ RT reagent Kit withgDNA Eraser (Cat#RR047A, Takara) and first-strand cDNA was synthesized by reverse transcription.

[0034] Gene cloning: Based on the EZH2 homologous sequence annotated in the citrus psyllid transcriptome data, and after preliminary confirmation through bioinformatics analysis (including homologous sequence comparison and conserved domain prediction), specific primers were designed to amplify its complete open reading frame (ORF) and perform sequence verification. The primers used are as follows: forward primer: 5'-ATGGTAGAAGATGAAACTGT-3' (SEQ ID NO. 3); reverse primer: 5'-TTAGGGATATTCAACTTCACGT-3' (SEQ ID NO. 4). The purified PCR product was ligated into the pMD™19-T vector (Takara, Cat#6013), transformed into E. coli DH5α competent cells, and positive clones were selected for sequencing after colony PCR screening. The citrus psyllid was finally obtained. EZH2 Gene( DcEZH2 The complete coded sequence (CDS) of ) is shown in SEQ ID NO.1.

[0035] Homology and phylogenetic analysis: NCBI BLAST program was used to analyze... DcEZH2 Homology comparison of nucleotide and amino acid sequences was performed to obtain the heterochromatic ladybug ( ). Harmonia axyridis Ladybug ( Coccinella septempunctata ), Red Valley Beetle ( Tribolium castaneum ), whitefly ( Bemisia tabaci ), pea aphid ( Acyrthosiphon pisum ), Drosophila melanogaster ( Drosophila melanogaster ) and silkworm ( Bombyx mori The EZH2 homologous sequences were identified. A phylogenetic tree was constructed using the Neighbor-Joining method in MEGA 7.0 software. Figure 1 The results showed that the citrus psyllid DcEZH2 is most closely related to the whitefly EZH2, which belongs to the same order Hemiptera, and they clustered together, indicating that the gene is evolutionarily conserved.

[0036] Conserved domain analysis and sequence alignment: SMART online tool prediction showed that the DcEZH2 protein contains SANT, CXC, and typical SET domains. Further, DNAMAN 9.0 software was used to perform multiple alignments of the DcEZH2 protein SET domain sequence with the corresponding EZH2 regions in Drosophila melanogaster, silkworm, whitefly, and pea aphid. Figure 2 The results showed that the SET domain (i.e., the catalytic active site of methyltransferase) was highly conserved in the selected insects, confirming that DcEZH2 possesses typical histone methyltransferase structural and functional characteristics.

[0037] Example 2: DcEZH2 Spatiotemporal expression profile analysis of genes

[0038] Head, legs, wings, midgut, fat body, ovary, and epidermal tissue of sexually mature female citrus psyllids were collected, along with samples from nymphs of different instars (1st to 5th instar) and adult females of different ages (3, 7, and 10 days after emergence). Total RNA was extracted from each sample and reverse transcribed into cDNA. Actin (GenBank accession number DQ675553.1) of the citrus psyllid was used as an internal control gene, and real-time quantitative PCR (qPCR) was performed using TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (Cat#RR820, Takara). The primer sequences used are as follows: DcEZH2-qF: 5'-TATGTGCAGTTTCCTGTTCA-3' (SEQ ID NO.5), DcEZH2-qR: 5'-CCAATACGGTGATCTCCATT-3' (SEQ ID NO.6); DcActin-qF: 5'-TGTTCCAACCTTCCTTCCTG-3' (SEQ ID NO.7), DcActin-qR: 5'-GTGTTGGCGTACAGGTCCTT-3' (SEQ ID NO.8).

[0039] The results are as follows Figure 3 As shown: DcEZH2 The expression level of the gene in the ovary and midgut of the citrus psyllid was significantly higher than in other tissues, suggesting that this gene may play an important role in the reproduction and metabolism of female insects. Furthermore, after adult emergence, its expression level increased with age, further indicating... DcEZH2 It is closely related to reproductive development.

[0040] Example 3: Targeting DcEZH2 Preparation of dsRNA (dsDcEZH2)

[0041] Template preparation: Using the cDNA obtained in Example 1 as a template, PCR amplification was performed using specific primers carrying the T7 promoter sequence. The primer sequences are as follows: DcEZH2-RNAi-F: 5'- GATCACTAATACGACTCACTATAGGGAGA ATCATCATTCAGGTCCCAAC-3' (SEQ ID NO.9); DcEZH2-RNAi-R: 5'- GATCACTAATACGACTCACTATAGGGAGA CAGAGTCCAGAGATACTTGC-3' (SEQ ID NO.10) (underlined T7 promoter sequence). The PCR product was purified and used as a template for in vitro transcription.

[0042] In vitro transcription and purification: Double-stranded RNA (dsRNA) was synthesized using the T7 High Yield RNA Transcription Kit (Vazyme, Cat#TR101). After the reaction, DNase I was added to remove the DNA template, followed by phenol / chloroform extraction and ethanol precipitation for purification. The concentration was determined using NanoDrop, and the integrity and singleness of the product were verified by 1.5% agarose gel electrophoresis. The target sequence of the obtained dsDcEZH2 is shown in SEQ ID NO.2.

[0043] Synthesis of control dsRNA: Simultaneously synthesized dsRNA targeting the enhanced green fluorescent protein (EGFP) gene (dsEGFP) as a negative control. The primers used were: EGFP-RNAi-F: 5'- GATCACTAATACGACTCACTATAGGGAGA CCTGAAGTTCATCTGCACCAC-3' (SEQ ID NO. 11), EGFP-RNAi-R: 5'- GATCACTAATACGACTCACTAT AGGGAGA CTCCAGCAGGACCATGTGATC-3' (SEQ ID NO. 12).

[0044] Example 4: Feeding dsDcEZH2 to citrus psyllids not carrying Huanglongbing fungus DcEZH2 gene silencing efficiency

[0045] dsDcEZH2 was diluted with 20% (w / v) sucrose aqueous solution to 200 and 500 ng / μL, respectively, while dsEGFP was diluted to 200 ng / μL as a control. RNA interference experiments were conducted using a membrane-clamped nutrient solution feeding method: double-layered feeding bags were made using Japanese Aglis rice paper grafting film, with 200 μL of sucrose solution containing the corresponding dsRNA injected in the middle. Female citrus psyllids of uniform size, 5-7 days after emergence, were collected in groups of 30 individuals (3 biological replicates) and placed in the feeding device. They were fed continuously for 48 hours in an artificial climate chamber (temperature 26±1℃, relative humidity 70±5%, photoperiod L:D=14:10 hours). After feeding, surviving insects were collected, total RNA was extracted and reverse transcribed into cDNA, and detected by qPCR. DcEZH2 The relative expression levels of genes. Results are as follows: Figure 4 As shown, compared with the dsEGFP control group, the mRNA expression level of DcEZH2 decreased by approximately 55% in the treatment group fed 200 ng / μL dsDcEZH2, and by approximately 75% in the treatment group fed 500 ng / μL. These results indicate that the dsDcEZH2 prepared in this invention can efficiently, specifically, and dose-dependently silence target genes.

[0046] Example 5: Silence DcEZH2 Effects on the survival rate and reproductive capacity of citrus psyllids not carrying Huanglongbing fungus

[0047] Survival rate determination: After feeding dsRNA for 48 hours as described in Example 4, all surviving psyllids were transferred to healthy citrus seedlings and continued to be reared for 5 days, with the number of surviving insects recorded daily. Results are as follows: Figure 5 As shown: the cumulative survival rate of the dsEGFP control group after 5 days was approximately 90% (mortality rate 10%); the survival rate of the treatment group fed 200 ng / μL dsDcEZH2 was 83% (mortality rate 17%); while the survival rate of the treatment group fed 500 ng / μL dsDcEZH2 decreased to approximately 37% (mortality rate 63%). This indicates silencing. DcEZH2 The gene can cause the death of citrus psyllids, and the effect is concentration-dependent.

[0048] Oviposition rate determination: Newly emerged female adults were fed 200 ng / μL dsDcEZH2 for 48 hours as described in Example 4. Then, males and females were paired in a 1:2 ratio and transferred to tender citrus shoots. The oviposition rate per female was recorded daily, and the shoots were replaced periodically until the females died. Results are as follows: Figure 6 As shown: the average number of eggs laid per female in the dsEGFP control group was 303.6, while that in the dsDcEZH2 treatment group was only 96.5, a highly significant difference. The results demonstrate that silencing... DcEZH2 Genes can significantly reduce the reproductive capacity of citrus psyllids.

[0049] Ovarian development observation: After feeding dsDcEZH2 for 5 days, the ovaries of female worms were dissected for morphological observation. Results are as follows... Figure 7 As shown: Compared with the dsEGFP control group, which showed normal development, full follicles, and significant yolk deposition, the ovarian development of females in the dsDcEZH2 treatment group was significantly delayed, with thin ovarian ducts, small follicle volume, and severely insufficient yolk deposition, directly confirming the silencing effect morphologically. DcEZH2 Genes can effectively inhibit ovarian development.

[0050] In conclusion, silence. DcEZH2 The gene can significantly increase the mortality rate of citrus psyllids, inhibit ovarian development and reduce egg production, indicating that it has application value as a target for pest control.

Claims

1. Citrus psyllid DcEZH2 Genes, characterized by, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. Suppressing the effect described in claim 1 DcEZH2 Application of gene expression in the control of citrus psyllids.

3. The application according to claim 2, characterized in that, To suppress the aforementioned DcEZH2 Applications of gene expression in increasing mortality of citrus psyllids, reducing oviposition of female citrus psyllids, or inhibiting ovarian development in female citrus psyllids.

4. The application according to claim 2, characterized in that, Suppress the above DcEZH2 Genes were generated by feeding female citrus psyllids. DcEZH2 The target is achieved through the dsRNA of the gene. DcEZH2 The target nucleotide sequence of the gene's dsRNA is shown in SEQ ID NO.

2.

5. The application according to claim 4, characterized in that, The target DcEZH2 The concentration of the gene's dsRNA was 200-500 ng / μL.

6. A targeting method as described in claim 1 DcEZH2 The dsRNA of a gene is characterized by, The target nucleotide sequence is shown in SEQ ID NO.

2.

7. The target according to claim 6 DcEZH2 The dsRNA of a gene is characterized by, Its preparation method includes the following steps: S1. Total RNA was extracted from citrus psyllids and reverse transcribed into cDNA; S2. Design a specific primer pair with the T7 sequence, and perform PCR amplification using the cDNA obtained in step S1 as a template to obtain a DNA fragment containing the T7 promoter sequence; the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.

10. S3. Using the DNA fragment containing the T7 promoter sequence obtained in step S2 as a template, perform in vitro transcription using an in vitro transcription kit and purify the DNA to obtain the targeted DNA fragment. DcEZH2 dsRNA of genes.

8. A formulation for controlling citrus psyllids, characterized in that, Contains the target as described in claim 6 DcEZH2 The dsRNA of the gene is the active ingredient.

9. The application of the formulation according to claim 8 in the control of citrus psyllids.

10. The application according to claim 9, characterized in that, Includes the following steps: The aforementioned preparation was used to feed citrus psyllids.

Images