Dampus australis SkORC3 gene as well as expression protein and application of Dampus australis SkORC3 gene

By cloning and expressing the SkORC3 gene of Phyllostachys edulis, the leaf morphology of Arabidopsis thaliana was regulated, filling the gap in the regulation of leaf development of Phyllostachys edulis and realizing the abnormal regulation of leaf morphology and biomass increase of ornamental plants.

CN121628922APending Publication Date: 2026-03-10NANJING FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610034665.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-12
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

The mechanism of the SkORC3 gene in regulating leaf development of Bambusa fulva is unclear, and current technologies lack effective means to regulate plant leaf morphology and biomass.

Method used

The SkORC3 gene of *Phyllostachys edulis* was cloned and expressed. A recombinant vector was constructed and plant tissues were infected with recombinant microorganisms to achieve the introduction and expression of the SkORC3 gene, thereby regulating plant leaf morphology.

Benefits of technology

Transgenic plants with abnormal rosette leaf differentiation and dwarfing were successfully bred in Arabidopsis thaliana. The number of leaves increased and the abnormal characteristics were obvious, providing new gene resources and methods for regulating plant leaf type, plant type and biomass.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121628922A_ABST
    Figure CN121628922A_ABST
Patent Text Reader

Abstract

The invention discloses an Anemonium aureum SkORC3 gene as well as an expression protein and application thereof, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the SkORC3 gene is as shown in SEQ ID NO. 1, and the amino acid sequence of the protein coded by the SkORC3 gene is as shown in SEQ ID NO. 2. According to the invention, the gene is constructed into an overexpression vector and is converted into arabidopsis thaliana, so that the key function of the SkORC3 in regulating and controlling the morphogenesis of plant leaves is disclosed for the first time. A transgenic arabidopsis thaliana plant over-expressing the gene shows remarkable rosette leaf dysplasia, and the specific phenotypes comprise double main vein bifurcated heart-shaped leaves, symmetrical twin leaves at the top end of a petiole, uniaxial special-shaped leaves and the like. The invention provides a new gene resource and tool for molecular mechanism research of plant leaf development, and has potential application value in the field of ornamental plant leaf type molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to the SkORC3 gene of *Phyllostachys edulis*, its expressed protein, and its applications. Background Technology

[0002] *Sasaella kogasensis* 'Aureostriatus', a ground cover bamboo species in the genus *Sasaella*, is highly valued for its ornamental qualities. Its leaves are green with irregular yellow stripes, and its application in landscaping is increasingly in demand, leading to its rising economic value. Leaves are crucial organs for bamboo growth, capturing light energy and performing photosynthesis. Plant organ growth is a complex, interconnected process; the three-dimensional morphogenesis of organs involves cell growth, differential division, and precise temporal and spatial coordination between cells. Compared to other bamboo organs, cytological studies on how bamboo leaves develop from leaf primordia to mature leaves are scarce. *Sasaella kogasensis*'s large leaves make it an ideal material for studying bamboo leaf development.

[0003] The Origin Recognition Complex (ORC) is a multi-subunit protein complex ubiquitous in eukaryotes and archaea. In yeast and mammalian cells, the ORC consists of six subunits (ORC1-ORC6) and is a core regulator of DNA replication initiation. Subunits ORC1-5 each contain two major conserved functional domains: the AAA+ superfamily domain and the winged-helix domain (WHD). ORC family genes in plants have been systematically identified; for example, six, five, and five ORC family members have been found in Arabidopsis, rice, and maize, respectively. Research on ORC genes in model plants such as Arabidopsis and rice has been particularly extensive. Numerous studies have confirmed the important functions of ORC genes in plant DNA replication, cell cycle progression, and growth and development. Although the function of the ORC3 gene in model species has been studied, the function of the SkORC3 gene in *Phyllostachys edulis* has not yet been reported, especially its mechanism of action in regulating leaf development, which remains unclear. Summary of the Invention

[0004] To address the aforementioned problems in existing technologies, the technical problem this invention aims to solve is to provide the SkORC3 gene of *Phyllostachys edulis*. Another technical problem this invention aims to solve is to provide the expression protein of the *Phyllostachys edulis* SkORC3 gene. A further technical problem this invention aims to solve is to provide applications for the *Phyllostachys edulis* SkORC3 gene, used to regulate rosette leaf cell proliferation and leaf morphogenesis.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0006] A SkORC3 gene of *Phyllostachys edulis*, characterized in that its nucleotide sequence is shown in SEQ ID NO. 1.

[0007] An expressed protein encoded by the SkORC3 gene of the aforementioned *Phyllostachys edulis* has the amino acid sequence shown in SEQ ID NO. 2.

[0008] A recombinant vector containing the SkORC3 gene of the aforementioned *Phyllostachys edulis*.

[0009] A recombinant microorganism containing the aforementioned recombinant vector.

[0010] A method for regulating plant leaf morphology includes introducing and expressing the SkORC3 gene of *Phyllostachys edulis* in plant cells or tissues, thereby causing abnormal leaf morphology.

[0011] Furthermore, the morphological abnormality is manifested in the plant's leaves exhibiting at least one of the following phenotypes:

[0012] (a) Broad, heart-shaped leaves with two main veins that extend in a bifurcated radial pattern;

[0013] (b) Two leaf blades arranged opposite each other are symmetrically differentiated along the dorsal and ventral axes at the tip of a single petiole;

[0014] (c) Uniaxial heteromorphic leaves produced by asymmetric division of meristem.

[0015] Furthermore, the method specifically includes: using the recombinant microorganisms to infect plant tissues to achieve the introduction and expression of the SkORC3 gene.

[0016] Furthermore, the plant in question is Arabidopsis thaliana.

[0017] The application of the SkORC3 gene or the expressed protein of *Phyllostachys edulis* in regulating plant leaf morphogenesis.

[0018] The application of the Yellow-striped Bamboo SkORC3 gene or the recombinant vector in the preparation of kits for studying plant leaf development or in the cultivation of plant varieties with specific leaf morphologies.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] 1) The SkORC3 gene of *Phyllostachys edulis*, disclosed for the first time in this application, has the nucleotide sequence shown in SEQ ID NO. 1 and the amino acid sequence shown in SEQ ID NO. 2. This invention constructs an expression vector for the SkORC3 gene of *Phyllostachys edulis*; transforms the constructed expression vector into *Arabidopsis thaliana*; and cultivates, screens, and obtains transgenic *Arabidopsis thaliana* plants with abnormal rosette leaf differentiation and / or dwarfing.

[0021] 2) Three weeks after inoculation, compared with the rosette leaves of wild-type Arabidopsis thaliana, the single leaves of the transgenic Arabidopsis thaliana constructed in this application showed abnormal development characteristics; four weeks after inoculation, the transgenic plants constructed in this application were smaller than wild-type Arabidopsis thaliana, but had more leaves and the abnormal characteristics were more obvious.

[0022] 3) Compared with wild-type Arabidopsis, the abnormal rosette leaf development phenotype of the SkORC3 transgenic Arabidopsis constructed in this application can be divided into three types: (1) a large heart-shaped leaf with two main veins extending in a bifurcated radial pattern, which is the most numerous; (2) two leaf blades arranged opposite each other symmetrically along the dorsal and ventral axes at the tip of a single petiole; (3) a uniaxial heteromorphic leaf produced by asymmetric division of meristems.

[0023] In summary, this application provides new genetic resources and effective methods for regulating leaf shape, plant type and biomass of plants (especially ornamental plants or economic crops) through genetic engineering, and also provides beneficial genetic resources and methods for the study of plant leaf morphogenesis. Attached Figure Description

[0024] Figure 1 Electrophoresis diagram of PCR amplification of the SkORC3 gene in Bambusa textilis (lane 1 is DNA Marker, lanes 2-3 are PCR amplification products of SkORC3);

[0025] Figure 2 The structure diagram of the expression vector pCAMBIA1302;

[0026] Figure 3 The images show PCR detection results for transgenic Arabidopsis thaliana (#3 is the overexpression line pCAMBIA1302-SkORC3-3, #25 is the overexpression line pCAMBIA1302-SkORC3-25, #27 is the overexpression line pCAMBIA1302-SkORC3-27, and Control is the control plant).

[0027] Figure 4Phenotypic observations of transgenic Arabidopsis thaliana three weeks (A) and four weeks (B) after inoculation (scale bar is 1 cm) (Control is the control plant, #3 is the overexpression line pCAMBIA1302-SkORC3-3, #25 is the overexpression line pCAMBIA1302-SkORC3-25 and #27 is the overexpression line pCAMBIA1302-SkORC3-27);

[0028] Figure 5 The rosette leaf phenotypic characteristics of the SkORC3 transgenic Arabidopsis thaliana line (scale bar is 1 cm) (Control is the control plant, #3 is the overexpression line pCAMBIA1302-SkORC3-3, #25 is the overexpression line pCAMBIA1302-SkORC3-25 and #27 is the overexpression line pCAMBIA1302-SkORC3-27);

[0029] Figure 6 This is a graph showing the quantitative analysis of SkORC3 in the rosette leaves of transgenic Arabidopsis plants and control plants. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art.

[0031] The plant material used in this application is the leaves of *Phyllostachys edulis*, collected from the bamboo cultivar garden of Nanjing Forestry University. The *Arabidopsis thaliana* (L.) Heynh. used in the genetic transformation experiment is of the Columbia variety (Col-0).

[0032] Example 1

[0033] 1. Total RNA extraction and cDNA synthesis

[0034] Total RNA was extracted from leaf tissues of *Phyllostachys edulis* using the Novizan FastPure Universal Plant Total RNA Isolation Kit (RC411) according to the manufacturer's instructions. cDNA was then obtained by reverse transcription using the extracted total RNA as a template, via the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (AT 311).

[0035] 2. Cloning the target gene

[0036] Based on the transcriptome data of *Phyllostachys edulis*, specific primers for candidate genes were designed. Using cDNA from *Phyllostachys edulis* leaves as a template, PCR amplification of the target fragment was performed using 2×Phanta UniFi Master Mix (Dye Plus) high-fidelity enzyme and corresponding specific primers. The primer sequences are shown below:

[0037] SkORC3-F:

[0038] 5'-ATGGATGTCTACACCATCTTGCGAAGC-3',

[0039] SkORC3-R:

[0040] 5'- GGGCCCGAATGCAATTCG -3'.

[0041] The PCR reaction system consisted of: 25 μL 2×Phanta UniFi Master Mix, 2 μL SkORC3-F, 2 μL SkORC3-R, 1 μL Phanta Max Super-Fidelity DNA Polymerase, 1 μL cDNA, and ddH2O to 50 μL.

[0042] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 35 sec, 35 cycles; 72℃ for 5 min.

[0043] The PCR amplification products were detected by 1% agarose gel electrophoresis. The bands were single, clear, and bright. Figure 1 The electrophoretic fragments of the target gene were excised under ultraviolet light, and the PCR products of the target gene were recovered using the Novizan gel recovery kit (DC 301).

[0044] The pCAMBIA1302 vector was linearized by double digestion with NcoI-HF and BstEII-HF restriction enzymes (vector information is as follows). Figure 2 (As shown). The endonuclease was purchased from New England Biotechnology Co., Ltd.

[0045] The gel-cut recovery fragments were ligated into the linearized vector fragments using the Novizan ClonExpress MLtra One Step Cloning Kit V3 (C117).

[0046] The ligation reaction system consisted of: 5 μL of 2×CE Mix V3, 1-2 μL of gel recovery product, 3 μL of linearized carrier, and 5 μL of ddH2O. After mixing the ligation system, the mixture was incubated at 50°C for 5 min. Following the reaction, the centrifuge tubes were placed on ice for E. coli transformation, following the specific steps below:

[0047] 1) Remove E. coli competent cells DH5α from the -80℃ ultra-low temperature freezer and quickly place them on ice to thaw until slightly thawed;

[0048] 2) Add 5 µL of ligation product to the center of 50 µL of competent E. coli cells, gently tap the tube wall to mix, and let stand on ice for 30 min.

[0049] 3) Heat shock in a water bath at 42℃ for 30 seconds, then quickly place on ice for 3 minutes;

[0050] 4) Add 500 μL of antibiotic-free LB liquid medium to a centrifuge tube, mix well, and place in a shaker at 37°C and 200 rpm for 1 h.

[0051] 5) Add 900µL of antibiotic-free LB liquid medium, and incubate at 37℃ in a shaker for 60 min at 200 rpm. Centrifuge at 5000 rpm for 5 min, discard 700µL of supernatant on a clean bench, and gently pipette the cells to fully suspend them. Take 100µL of the bacterial solution and use a sterile spreader to gently spread the competent cells evenly on LB agar plates (50μg / mL) containing Kans.

[0052] 6) Invert the container and incubate overnight in a 37°C incubator. The incubation time should not exceed 16 hours.

[0053] On a clean bench, pick white, smooth-edged, and numbered single colonies and mix them thoroughly in 10 µL of ddH2O. Use a portion of the bacterial solution as a PCR template and amplify using Novizan 2×Rapid Taq Master Mix (P222). Prepare the following reaction system:

[0054] 10 μL of 2×Rapid Taq Master Mix, 2 μL of bacterial culture, 1 μL of upstream primer, 1 μL of downstream primer, and 20 μL of ddH2O.

[0055] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 35 sec, 35 cycles; 72℃ for 5 min.

[0056] Positive colonies with the correct target band length were detected by 1% agarose gel electrophoresis and selected. These colonies were then added to 350 µL of LB liquid medium containing Kans (50 μg / mL) and incubated at 37°C with shaking at 200 rpm for 3 hours. The bacterial culture was then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification. Bacterial cultures and plasmids with correct sequencing results were used for subsequent experiments. An equal volume of 50% glycerol was added to the bacterial culture, and it was stored at -80°C; the plasmid was stored at -20°C.

[0057] Based on the sequencing results, the nucleotide sequence of the target gene was determined as shown in SEQ ID NO. 1, and the gene was named SkORC3. The amino acid sequence of its expressed protein is shown in SEQ ID NO. 2.

[0058] Example 2

[0059] 1. Constructing overexpression vectors

[0060] The pCAMBIA1302-SkORC3 plant overexpression vector was constructed using homologous recombination. The successfully constructed recombinant vector was transformed into Agrobacterium GV3101, and positive single colonies were screened for subsequent transformation experiments. The homologous recombination primer sequences are as follows:

[0061] PC1302-SkORC3-F:

[0062] 5'- ACGGGGGGACTCTTGACCATGGATGTCTACACCATCTTGCGAAGC -3',

[0063] PC1302-SkORC3-R:

[0064] 5'- AAGTTCTTCTCCTTTACTAGTGGGCCCGAATGCAATTCG -3'.

[0065] 2. Genetic transformation in Arabidopsis thaliana

[0066] 1) Transformation of Agrobacterium

[0067] Remove Agrobacterium competent cells GV3101 from the -80℃ ultra-low temperature freezer, thaw by hand until they are in an ice-water mixture, and then place them on ice. Add 5µL of plasmid DNA to the center of 50µL of GV3101 competent cells, gently shake the bottom of the tube to mix, and repeat the following steps: stand on ice for 5 min, liquid nitrogen shock for 5 min, water bath and ice bath for 5 min each, then add 900µL of antibiotic-free LB liquid medium, and incubate at 28℃ on a shaker for 3 h at 200 rpm. Centrifuge at 5000 rpm for 1 min to enrich the cells, discard 700µL of supernatant on a clean bench, and gently pipette the cells to fully suspend them. Take 100µL of the bacterial suspension and spread it on a sterile LB agar plate containing kanamycin (Kan) and rifampin (Rifampin Rifampic ... Gently spread the bacterial solution evenly on the plate (20 μg / mL); after the bacterial solution is completely absorbed, seal it with sealing film and invert it in an incubator at 28 °C for 2 days.

[0068] 2) Preparation of infection solution

[0069] Agrobacterium bacterial suspension containing recombinant plasmid was removed from a -80°C ultra-low temperature freezer and thawed on ice. 5 µL of the suspension was transferred to 300 µL of double-antibiotic LB liquid medium and incubated at 28°C with shaking at 200 rpm. After shaking until turbid, the suspension was transferred to 30 mL of double-antibiotic LB liquid medium (Kan, Rif) and incubated at 28°C with shaking for 2 days until the suspension turned orange-yellow. The OD was measured using a UV spectrophotometer. 600 Adjust the pH to 0.8; centrifuge at 5000 rpm for 10 min, discard the supernatant, collect the cells, add an equal volume of transformation osmotic buffer, and mix thoroughly before use.

[0070] 3) Arabidopsis thaliana culture

[0071] The optimal substrate ratio for Arabidopsis thaliana growth is peat moss:vermiculite:perlite = 9:3:1. After thoroughly soaking the substrate, sow wild-type Arabidopsis thaliana seeds (Control) in the four corners of the pot, cover with plastic wrap to keep the soil moist, and remove the plastic wrap after 3-4 days. Water about 7 days after sowing, and then provide regular care. Once the Arabidopsis thaliana bolts, Agrobacterium tumefaciens can be used for transfection. In the early stage of bolting, cut off the stem tissue and wait for a period of time to allow the entire Arabidopsis thaliana in the pot to bolt. The day before Agrobacterium tumefaciens infection, water thoroughly and remove the pods from the inflorescence, leaving only the flower buds, to maximize the conversion efficiency.

[0072] 4) Agrobacterium infection and transfection of Arabidopsis thaliana

[0073] The flower buds (showing white tips) of Arabidopsis thaliana were placed in 50 mL centrifuge tubes containing Agrobacterium tumefaciens permeate for 30 seconds. The liquid on the plant surface was wiped dry, and the plants were infected again for 30 seconds. After infection, the plants were placed flat on a tray, bagged to retain moisture, and cultured in the dark for 24 hours. Then, they were transferred to a plant growth chamber for normal culture. A second infection was performed one week after infection during the peak flowering period to improve transformation efficiency. After the Arabidopsis thaliana matured, T0 generation seeds were collected by mixing single genes, dried at 28°C, and then placed in silica gel to keep them dry for further identification.

[0074] 3. Screening and identification of homozygous transgenic Arabidopsis lines

[0075] After the infected Arabidopsis plants matured, T0 generation seeds were collected and dried in a 28℃ oven for 2-3 days. On a clean bench, 1.5 mL of 75% ethanol was added to centrifuge tubes containing transgenic and wild-type Arabidopsis T0 seeds, and the tubes were shaken uniformly for 5 minutes to sterilize. The ethanol was discarded, and 1 mL of anhydrous ethanol was added. The seeds were then pipetted out and spread evenly on sterilized filter paper until completely dry. Hygromycin resistance screening: sterilized wild-type seeds were evenly sprinkled on antibiotic-free and antibiotic-resistant 1 / 2 MS solid medium for wild-type plant culture and medium resistance testing (control). Transgenic seeds were evenly sprinkled on antibiotic-resistant 1 / 2 MS solid medium (25 mg / L hygromycin). The MS medium containing the treated seeds was sealed and vernalized at 4℃ for 3 days, then transferred to a light incubator (incubator conditions set to: 24℃, 16h light). Darkness (8 hours); about 10 days after sowing, select healthy seedlings with 4 true leaves and plant them in the mixed substrate. Cover with plastic wrap, water thoroughly, and after 1 day of cultivation, remove the plastic wrap and cultivate under normal light.

[0076] After Arabidopsis thaliana T1 seeds matured, they were dried and sown on resistant 1 / 2 MS solid medium. The number of seeds on each plate was counted. Wild-type seeds were treated with two control treatments. Ten days after inoculation, the positive rate of transgenic seeds was observed and counted. The screening criteria were that the ratio of positive seedlings that germinated and grew roots and four true leaves to negative seedlings that did not germinate was 3:1, which indicated that the line was homozygous and could be transplanted. The selected homozygous transgenic lines were normally cultivated until the T3 generation, during which phenotypic observation was carried out.

[0077] When the transgenic Arabidopsis plants reached the fourth week of growth (before bolting), leaves from both the transgenic and wild-type plants were collected, frozen in liquid nitrogen, and ground for DNA extraction. Extraction was performed using the Novizuma RoomTemp Sample Lysis Kit DNA Rapid Extraction Kit (P073). 1 µL of the lysed transgenic Arabidopsis DNA solution was used as a template for PCR amplification with Novizuma 2×Rapid TaqMaster Mix enzyme. All PCR products were subjected to 1% agarose gel electrophoresis; those with correctly identified bands were preliminarily considered positive seedlings (results are shown below). Figure 3 (As shown). Based on the CDS sequence of the cloned SkORC3 gene, specific primers were designed, and the specific primer sequences are shown below:

[0078] At ORC3-F:

[0079] 5'-TTGGTGCCTGTTGAGTGTT-3',

[0080] AtORC3-R:

[0081] 5'- CCATTCTTCTTGGGTTTCC-3'.

[0082] 4. Phenotypic observation of transgenic Arabidopsis thaliana

[0083] Two days after vernalization of the transgenic T3 seeds, the first day of the transgenic plant's growth was recorded. The morphology of the entire rosette leaf was observed and photographed in the third and fourth weeks of the plant's growth.

[0084] The results are as follows Figure 4 As shown, under the same cultivation conditions, compared with the wild-type control, SkORC3 transgenic seedlings exhibited abnormal differentiation characteristics in their rosette leaves three weeks after transplanting. When the plants reached four weeks of age, the transgenic plants were smaller than wild-type Arabidopsis, but had more rosette leaves, and the abnormal characteristics were more pronounced.

[0085] Based on the morphological findings of abnormal phenotypes, developmental abnormalities can be classified into three patterns ( Figure 5 (1) Broad, heart-shaped leaves with two main veins branching out radially; this type is the most numerous. Figure 5 -A~C); (2) Two leaflets arranged in opposite directions are symmetrically differentiated at the tip of the single petiole along the dorsal-ventral axis. Figure 5 -D); (3) Uniaxial heteromorphic leaves produced by asymmetric division of meristems ( Figure 5 -E).

[0086] 5. Expression analysis of SkORC3 in transgenic Arabidopsis thaliana

[0087] Leaves were collected from transgenic and wild-type Arabidopsis thaliana before bolting for analysis of relative gene expression levels.

[0088] RNA was extracted from transgenic and wild-type Arabidopsis thaliana using the Novizan RNA Extraction Kit (RC 411) according to the manufacturer's instructions. cDNA was then obtained by reverse transcription using the extracted RNA as a template, via the Tiangen Long Chain Reverse Transcription Kit (KR 107).

[0089] Using Atactin as an internal control gene and the reverse-transcribed cDNA as a template, the following reaction system was prepared using the AG11701 kit, with three biological replicates for each sample. Primer sequences are shown below:

[0090] Atactin-F:

[0091] 5'-GAAAAATGGCCGATGGTGAGG-3',

[0092] Atactin-R:

[0093] 5'-CACCAGCAAAACCAGCCTTC-3';

[0094] AtORC3-F:

[0095] 5'-TTGGTGCCTGTTGAGTGTT-3',

[0096] AtORC3-R:

[0097] 5'-CCATTCTTCTTGGGTTTCC -3';

[0098] The results are as follows Figure 6 As shown, the relative expression levels of the SkORC3 gene in different transgenic Arabidopsis lines were analyzed. Compared with the wild type, the relative expression levels of the SkORC3 gene in the rosette leaves of each transgenic line were significantly upregulated, at 2812-fold, 1158-fold, and 2728-fold, respectively, compared to the wild type. These results indicate that overexpression of SkORC3 leads to abnormal rosette leaf development in transgenic Arabidopsis, confirming its crucial regulatory role in plant leaf morphogenesis.

[0099] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.

Claims

1. A yellow stripe Dendrocalamus giganteus SkORC3 gene, characterized in that, The nucleotide sequence of which is shown as SEQ ID NO.

1.

2. The expression protein encoded by the Skimia oreophila SkORC3 gene of claim 1, characterized in that, The amino acid sequence of which is shown as SEQ ID NO.

2.

3. A recombinant vector, characterized in that, The SkORC3 gene of Dendrocalamopsis oldhami var. luteostriata.

4. A recombinant microorganism, characterized in that, The recombinant vector of claim 3.

5. A method of modulating leaf morphology in a plant, comprising, The method comprises introducing and expressing the SkORC3 gene of Dendrocalamopsis oldhami var. luteostriata in plant cells or tissues, so that the leaves of the plants are morphologically abnormal.

6. The method of claim 5, wherein, The morphological abnormality is manifested as at least one of the following phenotypes of the leaves of the plants: (a) wide heart-shaped leaves with double main veins and bifurcated radial extension; (b) two leaves arranged back to back differentiated from the top of a single petiole along the dorsal-ventral axis; (c) single-axial heteromorphic leaves produced by asymmetric division of meristems.

7. The method according to claim 5 or 6, characterized in that, The method specifically comprises: using the recombinant microorganism of claim 4 to infect plant tissues, so as to achieve the introduction and expression of the SkORC3 gene.

8. The method according to any one of claims 5-7, characterized in that, The plant is Arabidopsis thaliana.

9. The SkORC3 gene of Dendrocalamopsis oldhami var. luteostriata of claim 1 or the expressed protein of claim 2 is used for regulating the morphological construction of leaves of plants.

10. The SkORC3 gene of Dendrocalamopsis oldhami var. luteostriata of claim 1 or the recombinant vector of claim 3 is used for preparing a kit for studying the development of leaves of plants, or for cultivating plant varieties with specific leaf morphology.