HbCAT2 gene capable of improving cold resistance of plants and application of HbCAT2 gene
By overexpressing the HbCAT2 gene in Brazilian rubber tree and Arabidopsis thaliana, the problem of rubber tree sensitivity to low temperature stress was solved, and significant improvement in cold resistance and synergistic improvement in growth traits were achieved, providing a new tool for the genetic improvement of cold resistance in rubber trees.
Patent Information
- Application Number
- CN202610162845.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-05
- Publication Date
- 2026-03-10
- Estimated Expiration
- 2046-02-05
AI Technical Summary
In existing technologies, Brazilian rubber trees are sensitive to low-temperature stress, which leads to cold damage affecting rubber production and planting areas, and there is a lack of effective methods to improve cold resistance.
The HbCAT2 gene and its recombinant expression vector were provided. The cold resistance of the plants was enhanced by overexpressing the HbCAT2 gene in Brazilian rubber tree and Arabidopsis thaliana. The specific methods included constructing pEGAD-GFP-HbCAT2 and 2300-GFP-CAT2 vectors and using Agrobacterium-mediated transformation.
The transgenic Arabidopsis thaliana significantly improved the cold resistance of plants. After low temperature stress, the survival rate of the transgenic Arabidopsis thaliana increased significantly and the plant size did not decrease. This achieved a synergistic improvement of stress resistance and growth traits, providing a new tool for the genetic improvement of cold resistance in rubber trees.
Smart Images

Figure CN121628928A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving an HbCAT2 gene for improving plant cold resistance and its application. Background Technology
[0002] Brazilian rubber tree ( Hevea brasiliensis Natural rubber is the only commercial source of rubber and is a typical tropical crop, highly sensitive to low temperatures. In areas where rubber trees are not traditionally grown, they frequently suffer from winter chill, leading to bark cracking, latex bursting, and even death. Chill damage not only affects rubber production and limits the distribution of rubber plantations but also threatens the survival of the rubber trees, becoming a bottleneck restricting the development of the natural rubber industry.
[0003] Low-temperature stress causes cell dehydration, leading to osmotic stress and cell damage. To mitigate the damage caused by low-temperature stress, plants have evolved sophisticated and complex defense mechanisms over a long evolutionary process. At the physiological level, plants synthesize various substances and protective proteins, such as soluble sugars, proline, and cold-resistant proteins. These substances participate in regulating the osmotic potential, ice crystal formation, cell membrane stability, and reactive oxygen species (ROS) scavenging processes in plants under cold stress. ROS are oxygen-containing molecules with higher chemical reactivity than ordinary oxygen molecules, including superoxide anions (O2). .- ), hydroxyl radicals (-OH), hydrogen peroxide (H2O2), and singlet oxygen ( 1 These reactive oxygen species (ROS) naturally form byproducts in basic biological processes, and various environmental stresses, such as low temperatures, can induce their excessive accumulation, thus triggering oxidative stress. Long-term evolution has endowed plants with a complex and precise antioxidant system, which includes antioxidant enzymes such as catalase (CAT), ascorbate peroxidase (APX), and superoxide dismutase (SOD), as well as non-enzymatic antioxidants such as glutathione, ascorbic acid, anthocyanins, and melatonin. Catalase plays a crucial role in plant stress responses by scavenging excess H2O2.
[0004] Studies have shown that mutant plants with reduced CAT activity are more sensitive to salt stress, drought stress, heat stress, heavy metals, and infection by necrotrophic pathogens, while their role in low temperature stress remains unclear. Summary of the Invention
[0005] The purpose of this section is to outline some aspects of the embodiments of the present invention and to briefly describe some preferred embodiments.
[0006] In view of the problems existing in the above and / or prior art, the present invention is proposed.
[0007] Therefore, the present application aims at overcoming the deficiencies in the prior art and providing an HbCAT2 gene for improving cold resistance of plants.
[0008] To solve the above technical problems, the present application provides the following technical scheme: an HbCAT2 gene for improving cold resistance of plants, wherein the nucleotide sequence of the HbCAT2 gene is shown as SEQ ID NO. 1. The plant is at least one of Hevea brasiliensis and Arabidopsis thaliana.
[0009] As a preferred scheme of the HbCAT2 gene, the amino acid sequence of the protein encoded by the HbCAT2 gene is shown as SEQ ID NO. 2.
[0010] Another object of the present application is to overcome the deficiencies in the prior art and provide an application of the HbCAT2 gene in improving cold resistance of plants, comprising, constructing a recombinant expression vector containing the HbCAT2 gene; introducing the recombinant expression vector containing the HbCAT2 gene into plants to promote expression of the HbCAT2 gene in the plants and improve cold resistance of the plants; The plant is at least one of Hevea brasiliensis and Arabidopsis thaliana.
[0011] As a preferred scheme of the application, the recombinant expression vector containing the HbCAT2 gene comprises a pEGAD-GFP-HbCAT2 vector, and the nucleic acid sequence of the vector is shown as SEQ ID NO. 7.
[0012] As a preferred scheme of the application, the recombinant expression vector containing the HbCAT2 gene comprises a 2300-GFP-CAT2 expression vector, and the nucleic acid sequence of the vector is shown as SEQ ID NO. 14.
[0013] The present application has the following beneficial effects: (1) The present application first proposes an HbCAT2 gene, which can significantly enhance the cold resistance of plants without biomass loss. Unlike the trade-off effect of "improving stress resistance but reducing biomass" in the prior art, the transgenic Arabidopsis thaliana of the present application has a significantly improved cold resistance (indicated by survival rate) after low-temperature stress, and the plant size is not reduced, realizing the coordinated improvement of stress resistance and growth traits.
[0014] (2) The present application provides the first key gene HbCAT2 verified in the rubber tree plant system, which can effectively improve the cold resistance of rubber tree callus, and provides a new tool with independent intellectual property rights for genetic improvement of rubber tree cold resistance. BRIEF DESCRIPTION OF DRAWINGS
[0015] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings. Among them: Figure 1 Figure is a diagram for detecting the expression level of HbCAT2 in 35S::GFP-HbCAT2 transgenic Arabidopsis plants by RT-qPCR technology in the embodiments of the present application.
[0016] Figure 2 Figure is a phenotype diagram of 3-week-old wild type and two independent 35S::GFP-HbCAT2 transgenic lines in the embodiments of the present application, wherein the scale = 2.5 cm.
[0017] Figure 3 Figure is a comparison diagram of root growth phenotypes of 5-day-old wild type and 35S::GFP-HbCAT2 plant seedlings treated at 22℃ or 10℃ for 7 days in the embodiments of the present application.
[0018] Figure 4 Figure is a comparison diagram of root length data of 5-day-old wild type and 35S::GFP-HbCAT2 plant seedlings treated at 22℃ or 10℃ for 7 days in the embodiments of the present application, wherein a, b, c have no meaning, and the difference is reflected by comparison between each other.
[0019] Figure 5 Figure is a phenotype diagram of wild type and 35S::GFP-HbCAT2 plants before and after cold stress treatment in the embodiments of the present application.
[0020] Figure 6 Figure is a comparison diagram of survival rates of wild type and 35S::GFP-HbCAT2 plants before and after cold stress treatment in the embodiments of the present application.
[0021] Figure 7 Figure is a bright field (BF) and GFP fluorescence diagram of wild type and HbCAT2-OE transgenic calli in the embodiments of the present application.
[0022] Figure 8 Figure is a DAB and NBT staining image of wild type and HbCAT2-OE calli treated by simulation (22℃) and low temperature (10℃) in the embodiments of the present application, wherein WT represents wild type.
[0023] Figure 9The images show the growth status and browning phenotype of wild-type and HbCAT2-OE callus tissues after 21 days of simulated treatment (22°C) and low-temperature treatment (10°C) in this embodiment of the invention, where WT represents wild-type. Detailed Implementation
[0024] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.
[0025] Example 1 This embodiment provides a method for obtaining the HbCAT2 gene: Using rubber tree cDNA as a template, primers were designed for PCR amplification. The target gene was recovered and ligated into the pCR2.1 vector and transformed into competent DH5α cells. White colonies were selected by blue-white screening for colony PCR identification. The identified positive clones were sequenced to obtain the full-length CDS of the gene.
[0026] in, HbCAT2 The nucleotide sequence of the gene is shown in SEQ ID NO.1. HbCAT2 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; The primer sequences shown are as follows: HbCAT2-1-F: gaattc ATGGATCCCTACAAGAACCGTCC (as shown in SEQ ID NO.3); HbCAT2-1-R: gaattc AATGCTTGGCCTCGCATTGAGAC (as shown in SEQ ID NO.4).
[0027] The specific implementation method is as follows: (1) Searching for Arabidopsis thaliana in the NCBI database AtCAT2 Homologous sequences of the sequence were obtained from rubber trees that showed high similarity to it. HbCAT2 The cDNA sequence of the gene (1479 bp, as shown in SEQ ID NO.1). Amplifying the target gene: The primer sequence is sent to a biotechnology company for synthesis; The PCR system was prepared using DNA or cDNA from the Brazilian rubber tree 7-33-97 as a template. The DNA polymerase used was phanta DNA polymerase (VAZYME) high-fidelity enzyme, and the target fragment was blunt-ended. 1 μl of cDNA template was added to a 50 μl system, and the amplification reaction system is shown in Table 1. The PCR reaction program is shown in Table 2.
[0028] Table 1. High-fidelity enzyme amplification of target gene PCR reaction system (50 μl reaction system)
[0029] Table 2 PCR reaction procedure
[0030] (2) Recovery of target fragment: The fragment was recovered using the TIANGel Midi purification kit (centrifuge column type). The specific steps are as follows: Transfer the gel block to a 1.5mL EP tube, add 600μL of sol solution, and place it in a 65℃ water bath for 10min, shaking the EP tube occasionally to ensure the gel is completely dissolved. After cooling to room temperature, the mixture was transferred to an adsorption column, allowed to stand for 5 minutes, centrifuged at 12,000 rpm for 1 minute, and the eluent was discarded. Add 600 μL of washing buffer to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid; centrifuge at 12000 rpm for 3 min, and air-dry the adsorption column at room temperature; add 40 μL of ddH2O to the center of the adsorption column and let it stand at room temperature for 3 min; centrifuge at 12000 rpm for 3 min, collect the DNA solution in the tube, and store at -20℃.
[0031] (3) Linearization and recovery of pCR2.1 vector: The T vector used in this experiment was the pCR2.1 vector (a common commercially available vector). Eco After cutting RV into blunt ends, a ligation reaction was performed. The plasmid digestion system (50 μl reaction system) is shown in Table 3.
[0032] Table 3 pCR2.1 vector linearization enzyme digestion system
[0033] The reaction system was placed in a 37°C water bath for 30 min. Agarose gel electrophoresis was used to check whether the vector had been cleaved. After the pCR2.1 vector was completely digested, it was recovered using a gel recovery kit (see the above method for recovery of the target fragment).
[0034] (4) Ligation of the target fragment to the pCR2.1 vector: using Eco The RV-linearized pCR2.1 vector was linearized overnight at 16 °C. The linearization reaction system is shown in Table 4.
[0035] Table 4 Connection Reaction System
[0036] (5) Transformation of Escherichia coli with ligation products: Carefully add the above ligation products into competent cells and place on ice for 30 min; After heat-shocking the EP tube in a 42℃ water bath for 60-90 seconds, quickly place it on ice and let it stand for 1-2 minutes. Add 600-800 µl of antibiotic-free LB medium to the clean bench; Subculture at 37°C in a shaker at 80 rpm / min for about 45 minutes to an hour; Take a solid LB plate containing the corresponding resistance (approximately 20 mL of culture medium), and evenly add 40 μL of 20 mg / mL X-gal solution and 8 μL of 100 mg / mL IPTG solution to the surface of the plate. Apply the coating evenly to the surface of the plate using a sterile coating stick; Subsequently, the plates were left to stand under sterile conditions until the surface liquid was absorbed or evaporated and dried. The dried plates were then placed in an incubator at 37°C and incubated upside down overnight.
[0037] (6) Screening of positive clones: In a clean bench, single white colonies were selected with a sterile toothpick as templates (Template: single white colonies selected with a sterile toothpick). Using universal primers at both ends of the vector (M13F:GTAAAACGACGGCCAGTG, nucleic acid sequence as shown in SEQ ID NO.5; M13R:CAGGAAACAGCTATGACC, nucleic acid sequence as shown in SEQ ID NO.6), colony PCR was used to identify positive clones containing the target fragment.
[0038] The colony PCR reaction system was prepared as shown in Table 5, and the colony PCR reaction procedure is shown in Table 6.
[0039] Table 5 Colony PCR Reaction System
[0040] Table 6 Colony PCR Reaction Procedure
[0041] Example 2 Construction of pEGAD-GFP-HbCAT2 vector: Will HbCAT2 The gene fragment was ligated into the pEGAD vector containing a 35S promoter and a GFP tag to obtain... HbCAT2 The overexpression vector pEGAD-GFP-HbCAT2 (nucleotide sequence shown in SEQ ID NO.7) was used in the following process: (1) Obtaining Eco RI endonuclease sticky ends HbCAT2cDNA full-length fragment and pEGAD vector: use Eco The constructed pCR2.1- was digested with RI as a single enzyme. HbCAT2 (The nucleotide sequence is shown in SEQ ID NO.8) and the plant overexpression binary vector pEGAD (pEGAD plasmid) , Obtain with Eco RI viscous ends EcoRI cDNA full-length fragment and HbCAT2 cDNA The enzyme digestion system for RI-linearized pEGAD vector is shown in Table 7.
[0042] Table 7 obtained EcoRI viscous ends HbCAT2 cDNA Enzyme digestion system of fragment and pEGAD vector
[0043] The reaction system was placed in a 37°C constant temperature water bath for 30 min. Agarose gel electrophoresis was used to check whether the plasmid had been cut. The target fragment cut from the plasmid was recovered from the gel.
[0044] (2) The target fragment after gel recovery and purification was ligated with the extracted vector having the same restriction sites. HbCAT2 viscous ends HbCAT2 The ligation system of the fragment and the pEGAD vector was as shown in Table 8 to construct the pEGAD-GFP-HbCAT2 vector. The nucleotide sequence of the pEGAD-GFP-HbCAT2 vector is shown in SEQ ID NO.7.
[0045] Table 8 HbCAT2 cDNA fragment and pEGAD vector ligation reaction system
[0046] Example 3 GFP-HbCAT2 Obtaining homozygous transgenic Arabidopsis plants: The overexpression vector pEGAD-GFP-HbCAT2 was introduced into Arabidopsis thaliana using the Agrobacterium-mediated flower-dip method. After Basta resistance selection and real-time quantitative PCR detection, the results were obtained. 35S::GFP-HbCAT2 Transgenic Arabidopsis homozygous plants with increased expression levels 35S:: HbeIF2 ; Under normal growth conditions (temperature 23℃, photoperiod of 16 hours light / 8 hours dark, relative humidity 55%, light intensity 100 μmol / L), the growth was carried out under the following conditions: temperature 23℃, photoperiod of 16 hours light / 8 hours dark, relative humidity 55%, and light intensity 100 μmol / L. -2 s -1 Wild-type and 3-week-old growing35S::GFP-HbCAT2 The phenotypes of transgenic plants were compared.
[0047] The specific implementation method is as follows: (1) The constructed pEGAD-GFP-HbCAT2 vector was transformed into Agrobacterium competent cells GV3101: The constructed recombinant pEGAD-GFP-HbCAT2 plasmid was added to Agrobacterium competent cells, mixed by pipetting, and placed on ice for 30 min. The EP tube was rapidly frozen in liquid nitrogen for 45 seconds and then quickly placed in a 37°C water bath to melt the flocculent material inside the EP tube before being removed immediately. Add 0.7 ml of liquid LB medium to the EP tube in the clean bench, and then incubate at 220 rpm for 2-3 hours in a shaker at 28°C. Spread the bacterial culture onto LB solid medium containing 50 µg / mL kanamycin and 15 µg / mL gentamicin, and incubate upside down in an incubator at 28 °C for two to three days. Colony PCR was performed using HbCAT2-1-F and HbCAT2-1-R primers, and positive bacteria were inoculated and preserved.
[0048] (2) Agrobacterium-mediated flower-dip transformation of Arabidopsis: Agrobacterium GV3101 strain containing pEGAD-GFP-HbCAT2 recombinant plasmid was inoculated into 100 ml of double-antibiotic liquid LB medium containing 50 µg / mL kanamycin and 15 µg / mL gentamicin, and cultured for two days in a shaker at 250 rpm at 28 °C. Centrifuge at 5000 rpm for 10 min to collect the bacterial cells, and then resuspend the bacterial cells in 100 ml of a solution of 5% sucrose and 0.05% surfactant to fully resuspend the Agrobacterium. Agrobacterium was transformed into plants using the flower immersion method. When the transformed plants were blooming profusely, the flowers of Arabidopsis thaliana were briefly immersed in the Agrobacterium transformation solution for about 15 to 30 seconds. Cover the transformed plants with a lid and store them in the dark for one day. Then uncover them and culture them normally. To improve the transformation efficiency, the plants can be transformed again with Agrobacterium tumefaciens one week after transformation.
[0049] (3) Screening of HbCAT2 transgenic Arabidopsis plants and acquisition of homozygotes: After the Agrobacterium-transformed material was dried in an oven at 30°C, the T0 generation seeds were evenly sown in vermiculite in the greenhouse and sprayed with 1 / 3000 Basta every other day. After one week, the survival of the seedlings could be observed, and the surviving seedlings (i.e. resistant seedlings) were transplanted into the prepared new nutrient soil.
[0050] (4) After the resistant seedlings have grown for about 3 weeks, RNA was extracted from the leaves and further identified by real-time PCR. The specific procedures are as follows: RNA extraction: Place 50-100 mg of fresh Arabidopsis thaliana leaves in a 1.5 mL centrifuge tube, add 1 mL of RNAkey TM Homogenize Reagent (Seven Biotech, Cat#:SM129-02) thoroughly and let stand at room temperature for 5 minutes to completely separate the nucleic acid-protein complex; add 0.2 mL of chloroform, shake for 15 seconds, and let stand at room temperature for 2-3 minutes; centrifuge at 12000 g, 4 °C for 10 minutes. Transfer the upper aqueous phase to a new tube, add 0.5 mL of isopropanol, let stand at room temperature for 10 min, centrifuge at 12000 g at 4℃ for 10 min, carefully discard the supernatant, and retain the precipitate on the side and bottom of the tube. Add 1 mL of 75% ethanol, gently pipette to mix, centrifuge at 12000g at 4℃ for 10 min, carefully discard the supernatant, open the tube cap and let it air dry at room temperature for 5-10 min; add an appropriate amount of enzyme-free sterile water and gently pipette a few times to dissolve the RNA, and store at -80℃.
[0051] cDNA synthesis: The GenStar StarScript II RT Mix with gDNA Remover kit (catalog number: A224-10) was used. The specific experimental method is as follows: (1) Removal of residual DNA from RNA: Mix the following samples in an EP tube and incubate at 42°C for 15 min. The system is shown in Table 9.
[0052] Table 9 Removal of residual DNA from RNA
[0053] (2) Synthesis of the first cDNA: Add the following components as shown in Table 10 to the above reaction tube, mix well, incubate at 42℃ for 15-50 min; at 85℃ for 5 min, and store the cDNA at -20℃ after the reaction.
[0054] Table 10 shows the first cDNA synthesis reaction system.
[0055] (3) Real-time quantitative PCR (qRT-qPCR) A. Preparation of the reaction system (in the reagent preparation area to prevent aerosol contamination). 1. The experiment was performed using the Vazyme ChamQ Universal SYBR qPCR Master Mix kit. Refer to the instruction manual for specific instructions. Calculate the required number of wells based on the number of samples (technical replicates are required, typically 2-3), and prepare the following reaction mixture (20 μL).
[0056] Table 11 Real-time quantitative PCR reaction system (20 μL)
[0057] 2. After adding the sample, seal the reaction plate: carefully seal the reaction plate with an optical sealing film, and briefly centrifuge to allow the liquid to settle to the bottom of the tube and eliminate air bubbles.
[0058] B. Computer Operation and Program Setup 1. Placing the plate / tube: Place the reaction plate into the sample holder of the LightCycler®480 instrument.
[0059] 2. Create the experiment: Select the appropriate program in the LightCycler® 480 software. Set the reaction program as follows: Table 12 Real-time quantitative PCR reaction program
[0060] 3. Save and run: Save the experimental file and start running. The running time is about 1-1.5 hours.
[0061] C. Data Analysis 1. Check the amplification curve: After the operation is complete, the software will automatically generate an amplification curve. Check whether the curve has a standard S-shape and whether the baseline is flat.
[0062] 2. Then perform "Analysis" on the data, and the software will automatically provide the Cp value for each well.
[0063] 3. Perform relative quantification (such as gene expression differential analysis) using... HbCAT2 To normalize the internal reference gene, the relative expression level of the target gene was calculated using the 2^(-ΔΔCt) method.
[0064] The primer sequences for quantitative PCR are as follows: qRT-HbCAT2-Forward Primer:TTCGTCCTTGACTGTTGGGC (SEQ ID NO.9); qRT-HbCAT2-Reverse Primer: CATGGACAACACGCTCTGGA (SEQ ID NO. 10).
[0065] Example 4 Cold resistance test of transgenic plants: (1) In order to investigate whether HbCAT2 is involved in plant cold resistance, this invention overexpressed GFP-HbCAT2 in wild-type Arabidopsis thaliana plants under the control of the 35S promoter and constructed 35S::GFP-HbCAT2 transgenic plants. Select 5 plants HbCAT2 Total RNA was extracted from the leaves of transgenic plants and reverse transcribed into cDNA. The cDNA was then used as a template for real-time quantitative PCR detection. 35S::GFP-HbCAT2 Gene expression levels in overexpressing Arabidopsis thaliana lines; Figure 1 Genes in 35S::GFP-HbCAT2 Relatively high levels of expression were observed in strains 4, 5, 6, 10, and 11, such as... GFP-HbCAT2 As shown. Two transgenic lines with high HbCAT2 expression and similar phenotypes were selected ( Figure 2 6 and 35S:: Figure 3 11) Conduct cold resistance tests, such as... 35S::GFP-HbCAT2 The strain shown.
[0066] Root length cold resistance phenotypic test: Wild-type seedlings and 35S::GFP-HbCAT2 seedlings grown in 1 / 2 MS medium for 5 days were treated at 22℃ or 10℃ for 7 days, respectively, and their taproot lengths were measured. Data are expressed as mean ± standard deviation. Columns with different letters indicate significant differences determined by analysis of variance and Tukey's multiple comparison test (P<0.05).
[0067] The results are as follows 35S::GFP-HbCAT2 As shown, under normal growth temperature (22℃), there was no significant difference in root length and morphology between wild-type and 35S::GFP-HbCAT2 plants. After low temperature treatment, the root system of HbCAT2 overexpressing transgenic plant seedlings was significantly larger than that of wild-type, indicating that HbCAT2 has strong cold resistance.
[0068] Wild-type seedlings and 35S::GFP-HbCAT2 seedlings grown under normal conditions (two transgenic lines with high HbCAT2 expression and similar phenotypes were selected from the 35S::GFP-HbCAT2 seedlings) were selected. Figure 4 6 and Figure 4 11) Move it to a low-temperature environment and measure its taproot length, see [reference needed]. 35S::GFP-HbCAT2 The results showed that the root length of 35S::GFP-HbCAT2 seedlings was significantly greater than that of wild-type seedlings; illustrate: 35S::GFP-HbCAT2The aim was to reveal and verify the positive effects of high HbCAT2 gene expression on promoting plant root growth and enhancing stress resistance. 35S::GFP-HbCAT2 #6 and 35S::GFP-HbCAT2 #11 were the most representative high-expression lines with the highest HbCAT2 expression levels among the obtained transgenic lines. Therefore, lines 35S::GFP-HbCAT2 #6 and 35S::GFP-HbCAT2 #11 were selected for this study. Lines 35S::GFP-HbCAT2 #4, 35S::GFP-HbCAT2 #5, and 35S::GFP-HbCAT2 #10, which had low HbCAT2 expression levels, were not included in the study.
[0069] (2) To verify the role of HbCAT2 in plant cold resistance, wild-type and 35S::GFP-HbCAT2 plants grown in soil were subjected to freezing stress. Among them, two transgenic lines with high HbCAT2 expression and similar phenotypes were selected from the 35S::GFP-HbCAT2 plants. Figure 5 6 and Figure 6 11.
[0070] Note: The purpose of the freezing stress treatment here is to reveal and verify the positive effect of high HbCAT2 gene expression on promoting plant root growth and cold resistance. Among the transgenic lines obtained, 35S::GFP-HbCAT2 #6 and 35S::GFP-HbCAT2 #11 have the highest HbCAT2 expression levels and are the most representative high-expression lines. Therefore, lines 35S::GFP-HbCAT2 #6 and 35S::GFP-HbCAT2 #11 were selected for this study. Lines 35S::GFP-HbCAT2 #4, 35S::GFP-HbCAT2 #5, and 35S::GFP-HbCAT2 #10, which have low HbCAT2 expression levels, were not included in this study.
[0071] Test method: Wild-type and transgenic plants grown in soil for 3 weeks were cold-acclimatized at 4°C for 2 days, then transferred to a freezer (initial temperature 0°C) and cooled to -8°C at a rate of 1°C per hour. The treated plants were then placed in darkness at 4°C for 12 hours, and then transferred to a 22°C environment with a 16-hour light / 8-hour dark cycle for another 3 days. Cold resistance phenotypes and survival rates were observed and statistically analyzed. Results are shown in [link to results]. Hevea brasiliensis and Figure 7 The transgenic plants were about the same size as the WT (wild type) plants, and no significant decrease in biomass was observed. After recovery, only a few wild type plants survived, while almost all 35S::GFP-HbCAT2 plants survived, further confirming that HbCAT2 can enhance plant cold resistance.
[0072] Example 5 The role of HbCAT2 in the cold resistance of Brazilian rubber trees: (1) Construction of the transgenic rubber tree 2300-GFP-CAT2 overexpression vector To obtain HbCAT2-overexpressing transgenic rubber tree callus, the first step is to construct the HbCAT2 gene overexpression vector 2300-GFP-CAT2. The specific method is as follows: by HbCAT2-OE Using cDNA as a template, amplification was performed using a high-fidelity enzyme to obtain the recombinant fragment. The primer sequences are as follows: F: gggacgagctcggtacccgccaccATGGATCCCTACAAGAACCG (SEQ ID NO. 11); R: cgactctagaggatccccTCAAATGCTTGGCCTCGCAT (SEQ ID NO. 12).
[0073] After the PCR amplification products were detected and purified by agarose gel electrophoresis, they were homologously ligated with the plant expression vector pCAMBIA2300-GFP (the Sma I-digested plant expression vector pCAMBIA2300-GFP is referred to as the linearized vector, nucleic acid sequence SEQ ID NO.13) digested with restriction endonuclease Sma I. The reaction system used the core premix 2×ClonExpress Mix from the Novizan ClonExpress® Ultra One Step Cloning Kit. The specific reaction system is shown in Table 13.
[0074] Table 13 Homologous recombination reaction system
[0075] The homologous recombination ligation product was transformed into DH5α competent cells. After colony PCR identification, the sequence correctness of the inserted fragment was further verified by sequencing. The correct positive clones were activated and cultured, and plasmids were extracted using the Novizan FastPure Plasmid Mini Kit to obtain the overexpression vector 2300-GFP-CAT2 (nucleic acid sequence SEQ ID NO. 14).
[0076] (2) Genetic transformation of callus tissue from 2300-GFP-CAT2 transgenic rubber trees Preparation of 2300-GFP-CAT2 Agrobacterium tumefaciens EHA105: Take competent cells of Agrobacterium tumefaciens stored at -80℃ and allow them to partially thaw at room temperature or in the palm of your hand. When they are in an ice-water mixture, insert them into ice. Add 0.01-1 μg of plasmid to each 100 μl of competent cells, mix by hand by tapping the bottom of the tube, and incubate sequentially on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37℃ water bath for 5 minutes, and in an ice bath for 5 minutes. Add 700 μl of antibiotic-free LB liquid medium and incubate at 28℃ with shaking for 2-3 hours. Centrifuge at 6000 rpm for one minute to collect the bacteria. Take about 100 μl of supernatant, gently pipette and resuspend the bacterial block, and spread it on an LB plate containing 50 μg / ml kanamycin (KAN) and 20 μg / ml rifamycin (RIF). Invert the plate and incubate at 28℃ for 2-3 days to obtain 2300-GFP-CAT2 Agrobacterium tumefaciens EHA105.
[0077] Cell preparation: EHA105 Agrobacterium, which has been transformed into 2300-GFP-CAT2, was streaked onto an LB agar plate containing 50 μg / ml kanamycin (KAN) and 20 μg / ml rifampicin (RIF). The plate was inverted and incubated at 28°C for 2-3 days. Single colonies growing on the plate were picked and transferred to 5 ml of LB liquid medium containing 50 μg / ml kanamycin (KAN) and 20 μg / ml rifampicin (RIF). The plate was incubated overnight at 28°C with shaking at 200 rpm. 100 μl of the bacterial culture was inoculated into 50 ml of LB liquid medium containing 50 μg / ml kAN and 20 μg / ml Rifampicin (RIF). The plate was incubated at 28°C with shaking at 200 rpm until OD600 = 0.5-0.7. The bacteria were then collected by centrifugation for use in infection. Callus preparation: Embryogenic callus lines from rubber trees were cultured in a pre-culture medium one week in advance; Preparation of infection solution: Dilute the centrifuged bacterial cells to OD600 = 0.1-0.2 using liquid culture medium, add acetylsuccinone (0.1mM) to obtain the infection solution; Infection and co-culture: Pour the infection solution into the pre-cultured callus tissue, ensuring the solution level covers the callus tissue, and remove the infection solution after 10 seconds of infection. After the infected callus tissue was placed in a 20℃ incubator and cultured in the dark for 3-5 days, it was transferred to a virus-free culture medium and cultured for 2-3 weeks. Detoxified callus tissue was screened and cultured in PSM selective medium containing paromomycin (200 mg / L). Callus tissue exhibiting green fluorescence signals was selected and transferred to fresh PSM medium for further culture until homozygous transgenic callus tissue lines with green fluorescence signals were obtained. See [link to PSM selective medium]. Figure 8 .
[0078] (3) Indicators of cold resistance: ROS levels detected by DAB and NBT staining. WT before and after low temperature stress treatment Figure 9 Transgenic rubber tree callus tissue was stained with DAB and NBT to detect changes in the content of ROS, an indicator of cold resistance.
[0079] DAB staining experiment on rubber tree callus: A DAB solution with a final concentration of 0.25 mg / mL was prepared using 1×PBS solution. 15 mL of DAB solution was added to a 50 mL beaker, and appropriate amounts of wild-type and transgenic rubber tree callus (before and after treatment) were placed inside. The beaker was placed under light for approximately 1 hour. The staining was observed, and the staining solution was aspirated. Since the background color of the callus tissue was pale yellow, alcohol destaining was not necessary, and phenotypic photography could be performed directly. The staining intensity was used to qualitatively determine the hydrogen peroxide content in the leaves; a darker color indicated a higher hydrogen peroxide content, reflecting the oxidative stress state of the plant.
[0080] NBT staining experiment on rubber tree callus: An NBT solution with a final concentration of 0.25 mg / mL was prepared using 1xPBS. The staining method was the same as DAB staining, but the staining time differed. The staining time for rubber tree callus was 20 min.
[0081] See results Figure 8 and Figure 8 , Figure 8 It can be seen that after a short period of low-temperature stress, the DAB ( ) of WT and HbCAT2-OE transgenic rubber tree callus tissues... Figure 9 Left image) and NBT staining ( (Right image) The staining depth of the HbCAT2-OE transgenic callus was significantly lower than that of the untreated callus; and the staining depth of the HbCAT2-OE transgenic callus was significantly lower than that of the WT callus. This indicates that the HbCAT2-OE transgenic callus has a lower level of reactive oxygen species (ROS) accumulation and is less susceptible to low-temperature damage, thus exhibiting stronger cold resistance. As can be seen, under normal temperature conditions, the growth of HbCAT2-OE callus is similar to that of wild-type callus; however, after prolonged low-temperature stress treatment, wild-type callus showed slower growth and more severe browning compared to HbCAT2-OE callus.
[0082] This invention reveals for the first time that overexpression of catalase (CAT) can significantly enhance the cold resistance of plants without biomass loss. Unlike the trade-off effect of "increased stress resistance but decreased biomass" often seen in existing technologies, the transgenic Arabidopsis of this invention exhibits a significant increase in cold resistance (indicated by survival rate) after low-temperature stress, while plant size remains unchanged, achieving a synergistic improvement in stress resistance and growth traits. Furthermore, this invention provides the first validated key gene resource, HbCAT2, in the rubber tree native plant system, which effectively enhances the cold resistance of rubber tree callus, providing a new tool for the genetic improvement of cold resistance in rubber trees.
[0083] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the present invention.
Claims
1. A HbCAT2 gene for improving cold resistance of a plant, characterized by: The nucleotide sequence of the HbCAT2 gene is shown as SEQ ID NO.
1. The plant is at least one of Hevea brasiliensis and Arabidopsis thaliana.
2. The HbCAT2 gene of claim 1, wherein: The amino acid sequence of the protein encoded by the HbCAT2 gene is shown as SEQ ID NO.
2.
3. Use of the HbCAT2 gene according to claim 1 or 2 for increasing the cold tolerance of a plant, characterized in that: Comprise, constructing a recombinant expression vector containing the HbCAT2 gene; introducing the recombinant expression vector containing the HbCAT2 gene into the plant, promoting the expression of the HbCAT2 gene in the plant, and improving the cold resistance of the plant; The plant is at least one of Hevea brasiliensis and Arabidopsis thaliana.
4. Use according to claim 3, wherein: The recombinant expression vector containing the HbCAT2 gene comprises a pEGAD-GFP-HbCAT2 vector, and the nucleic acid sequence thereof is shown as SEQ ID NO.
7.
5. The use according to claim 3, wherein: The recombinant expression vector containing the HbCAT2 gene comprises a 2300-GFP-CAT2 expression vector, and the nucleic acid sequence thereof is shown as SEQ ID NO. 14.
Citation Information
Patent Citations
Cold-resistant gene of rubber trees, cold-resistant protein and application of cold-resistant gene and cold-resistant protein
CN105693836A
Volvariella volvacea catalase (VCAT) and encoding gene and application thereof
CN110540974A
Gene improving the stress resistance of plants and use thereof
WO2013166996A1