Monocotyledonous plant gene editing vector and gene editing method and application thereof

Abstract

The invention provides a monocotyledonous plant gene editing vector and a gene editing method and application thereof, and particularly provides an optimized nucleotide sequence for coding CasWM protein, a nucleic acid construct for evaluating CasWM expression quantity or editing efficiency thereof, a nucleic acid construct for gene editing, a nucleic acid construct for gene editing and a nucleic acid construct for gene editing. The invention also provides a reagent combination for gene editing, and the optimized CasWM nucleotide sequence obtained by screening is introduced into plant cells, so that very high editing efficiency is obtained.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a gene-editing vector for monocotyledonous plants, a method for editing genes thereon, and its applications. Background Technology

[0002] In many bacteria and most archaea, there exists a defense system against foreign DNA (such as bacteriophages), called the CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated Cas endonuclease) system (Bhaya et al., 2011). The CRISPR / Cas system consists of two basic components: the Cas protein, a nuclease, and gRNA (guide RNA). Under certain conditions, gRNA can form a complex with the Cas protein. Through base pairing, the gRNA guides the Cas protein to the target DNA, whereupon the Cas protein binds to and cleaves the target double-stranded DNA, causing a double-strand break. Intracellular DNA repair mechanisms repair damaged double-stranded DNA, including NHEJ (non-homologous end-joining) and HDR (homology-directed repair).

[0003] Plant gene editing developed using the CRISPR / Cas system is a key technology in crop breeding. Researchers have used classic gene editing nucleases such as Cas9 and Cpf1 as underlying tools to conduct extensive downstream technology development and application research, achieving a series of important results in the field of plant gene editing.

[0004] Based on the number and composition of Cas proteins involved in genome cleavage by nucleases, CRISPR / Cas is classified into class I (types I, III, and IV) and class II (types II, V, and VI) systems. In the class II system, the type II nuclease Cas9 contains an HNH nuclease domain inserted into the RuvC nuclease domain; these two domains together cleave dsDNA 3 bp upstream of the PAM (5'-NGG-3') site, producing blunt ends. By introducing point mutations into the nuclease domain, nickase-Cas9 (nCas9) or dead-Cas9 (dCas9) can be generated and used for the development of base editors and gene expression regulators. Unlike Cas9, type V Cas12a has a single RuvC nuclease domain that cleaves dsDNA by recognizing a T-rich PAM sequence (5'-TTTN-3') and producing sticky ends, thus expanding the range of available targets. In recent years, Cas9 (type II) and Cas12a have been widely used in genome editing applications across various organisms, including microorganisms, animals, and plants. Due to the diversity of type V CRISPR / Cas systems, many recently reported novel Cas proteins are members of the type V endonuclease family. Among them, CRISPR / Cas12 shows promising potential as a genome editing tool due to its relatively small size, simple crRNA, “TTN” PAM requirement, and pre-crRNA processing capability. Cas12 is a single crRNA-guided effector that primarily cleaves the non-spacer complementary strand of the target DNA and, with lower efficiency, cleaves the spacer complementary strand, producing dsDNA breaks. Several Cas12is, including Cas12i 1, Cas12i2, Cas12i3, Cas12i7, Cas12i 10, Cas12i 11, and Cas12i 12, have been shown to possess gene-editing activity in mammalian cells. In 2023, a study identified Cas12i3, a member of the endonuclease family VI, to determine its use in plant genome editing. It can recognize PAMs of TTN and has an average editing efficiency of 36.31% at four endogenous sites in rice (OsYSA, OsNAL, OsMIR396e, and OsPYL6).

[0005] Currently, there are relatively few domestically patented Cas12i endonucleases, which to some extent hinders the progress of gene-edited crop breeding in my country. Furthermore, most researchers focus on optimizing the amino acid sequence of the nuclease protein, resulting in relatively singular protein efficiency optimization strategies. Additionally, there are few reports of efficient Cas12 protein-mediated gene editing in monocots.

[0006] Therefore, there is an urgent need in this field to develop an optimized method that can significantly improve the gene editing efficiency of Cas proteins. Summary of the Invention

[0007] The purpose of this invention is to provide an optimized method that can significantly improve the gene editing efficiency of Cas proteins.

[0008] A first aspect of the present invention provides a nucleotide sequence encoding a CasWM protein, said nucleotide sequence being selected from the group consisting of:

[0009] (a) The nucleotide sequence is as shown in SEQ ID NO.:1 or 2; and

[0010] (b) The nucleotide sequence has ≥95% identity with the nucleotide sequence shown in SEQ ID NO.: or 1 or 2, preferably ≥98%, more preferably ≥99%.

[0011] In another preferred embodiment, the nucleotide sequence includes a DNA sequence, a cDNA sequence, or an mRNA sequence.

[0012] In another preferred embodiment, the nucleotide sequence includes single-stranded and double-stranded sequences.

[0013] In another preferred embodiment, the nucleotide sequence comprises a nucleotide sequence that is completely complementary to SEQ ID NO.:1 or 2.

[0014] A second aspect of the present invention provides a nucleic acid construct for evaluating CasWM expression levels, the nucleic acid construct comprising:

[0015] First expression box;

[0016] The second expression box; and

[0017] An optional third expression box;

[0018] Wherein, the first expression cassette is an expression cassette used to express the internal reference protein;

[0019] The second expression cassette is a fusion protein expression cassette for expressing a fusion protein, wherein the fusion protein includes CasWM and the protein encoded by a reporter gene;

[0020] The third expression box is a filter mark expression box used to express filter marks;

[0021] Furthermore, the first expression box, the second expression box, and the third expression box are each independently located on the same or different carriers.

[0022] In another preferred embodiment, the first expression box, the second expression box, and the third expression box are each independently located on the same carrier.

[0023] In another preferred embodiment, the internal reference protein includes luciferase.

[0024] In another preferred embodiment, the luciferase includes firefly luciferase and sea cucumber luciferase (Rluc).

[0025] In another preferred embodiment, the second expression box has the structure of Formula I:

[0026] P-N1-Z1-N2-Z2-Z3(I);

[0027] in,

[0028] P is the first promoter;

[0029] N1 is the encoded sequence of the null or non-nuclear positioning signal (NLS);

[0030] Z1 is the nucleotide sequence encoding the CasWM protein;

[0031] N2 is the encoded sequence of the null or non-nuclear localization signal (NLS);

[0032] Z2 is a reporter gene;

[0033] Z3 is the no or stop codon.

[0034] In another preferred embodiment, the first promoter is a plant promoter, including UBI and EF1α.

[0035] In another preferred embodiment, the nuclear localization signal is selected from the group consisting of bpNLS.

[0036] In another preferred embodiment, the nucleotide sequence encoding the CasWM protein is shown in any one of SEQ ID NO. 1, 2, 5, or 6.

[0037] In another preferred embodiment, the reporter genes include HiBiT and Nluc.

[0038] In another preferred embodiment, the stop codon includes NOS and PolyA.

[0039] In another preferred embodiment, the first expression box has a structure of Formula II:

[0040] X1-X2-X3(I)

[0041] In the formula,

[0042] X1 is the second promoter;

[0043] X2 is the coding sequence of the internal reference protein;

[0044] X3 is an optional stop codon.

[0045] In another preferred embodiment, the second promoter includes UBQ and EF1α.

[0046] In another preferred embodiment, the third expression box has a structure of Formula III:

[0047] Y1-Y2-Y3(III)

[0048] In the formula,

[0049] Y1 is the third promoter;

[0050] Z2 is the encoded sequence of the encoding filter marker;

[0051] Z3 is the encoded sequence of polyA.

[0052] In another preferred embodiment, the third promoter includes 35S and UBQ.

[0053] In another preferred embodiment, the selection marker is selected from the group consisting of: Basta resistance gene (Bar), hygromycin resistance gene (HYG), G418 and kanamycin resistance gene (NPTII), puromycin resistance gene (PAC), neomycin resistance gene (NEO), or combinations thereof.

[0054] In another preferred embodiment, the first expression box and the second expression box are located on the same carrier.

[0055] In another preferred embodiment, the first expression box, the second expression box, and the third expression box are located on the same carrier.

[0056] In another preferred embodiment, the vector is an expression vector that can transfect or transform plant cells.

[0057] In another preferred embodiment, the vector is an expression vector capable of transfecting or transforming immature plant embryos or calluses.

[0058] In another preferred embodiment, when two or three of the first expression box, the second expression box, and the third expression box are located on the same carrier, the two or three expression boxes are arranged in a cluster, thereby forming an expression box cluster.

[0059] In another preferred embodiment, the expression cassette cluster contains an RB sequence on the outer side of its 5' end; and contains an LB sequence on the outer side of its 3' end.

[0060] In another preferred embodiment, the order of the expression boxes in the expression box cluster (from 5'-3') is selected from the following group:

[0061] First expression box and second expression box;

[0062] The second expression box and the first expression box;

[0063] First expression box, second expression box, and third expression box;

[0064] Second expression box, first expression box, and third expression box;

[0065] The third expression box, the second expression box, and the first expression box;

[0066] The third expression box, the first expression box, and the second expression box.

[0067] In another preferred embodiment, when a single expression cassette is located on a carrier, an RB sequence is contained outside the 5' end of the expression cassette; and an LB sequence is contained outside the 3' end of the expression cassette.

[0068] A third aspect of the present invention provides a nucleic acid construct for gene editing in plants, the nucleic acid construct comprising:

[0069] Fourth expression box;

[0070] Fifth expression box; and

[0071] An optional third expression box;

[0072] The fourth expression cassette is a gRNA expression cassette for expressing gRNA;

[0073] The fifth expression box is an expression box used to express CasWM;

[0074] The third expression box is a filter mark expression box used to express filter marks;

[0075] Furthermore, the fourth expression box, the fifth expression box, and the third expression box are each located independently on the same or different carriers.

[0076] In another preferred embodiment, the fourth expression box, the fifth expression box, and the third expression box are each independently located on the same carrier.

[0077] In another preferred embodiment, the fifth expression box has a structure of formula A:

[0078] P-N1-A1-N2-Z3(I);

[0079] in,

[0080] P is the first promoter;

[0081] N1 is the encoded sequence of the null or non-nuclear positioning signal (NLS);

[0082] A1 is the nucleotide sequence encoding the CasWM protein as described in claim 1;

[0083] N2 is the encoded sequence of the null or non-nuclear localization signal (NLS);

[0084] Z3 is the no or stop codon.

[0085] In another preferred embodiment, the first promoter is a plant promoter, including UBI and EF1α.

[0086] In another preferred embodiment, the nuclear localization signal is selected from the group consisting of bpNLS.

[0087] In another preferred embodiment, the stop codon includes NOS and PolyA.

[0088] In another preferred embodiment, the fourth expression box has a structure of formula B:

[0089] B1-B2(I)

[0090] In the formula,

[0091] B1 is a plant promoter, preferably a promoter driven by plant polymerase III (such as U6 or U3 promoters);

[0092] B2 is the coding sequence for gRNA.

[0093] In another preferred embodiment, the fourth expression box and the fifth expression box are located on the same carrier.

[0094] In another preferred embodiment, the fourth expression box, the fifth expression box, and the third expression box are located on the same carrier.

[0095] In another preferred embodiment, the vector is an expression vector that can transfect or transform plant cells.

[0096] In another preferred embodiment, the vector is an expression vector capable of transfecting or transforming immature plant embryos or calluses.

[0097] In another preferred embodiment, when two or three of the fourth, fifth, and third expression boxes are located on the same carrier, the two or three expression boxes are arranged in a cluster, thereby forming an expression box cluster.

[0098] In another preferred embodiment, the expression cassette cluster contains an RB sequence on the outer side of its 5' end; and contains an LB sequence on the outer side of its 3' end.

[0099] In another preferred embodiment, the order of the expression boxes in the expression box cluster (from 5'-3') is selected from the following group:

[0100] The fourth and fifth expression boxes;

[0101] The fifth expression box and the fourth expression box;

[0102] Fourth expression box, fifth expression box, and third expression box;

[0103] Fifth expression box, fourth expression box, and third expression box;

[0104] The third expression box, the fifth expression box, and the fourth expression box;

[0105] The third expression box, the fourth expression box, and the fifth expression box.

[0106] In another preferred embodiment, when a single expression cassette is located on a carrier, an RB sequence is contained outside the 5' end of the expression cassette; and an LB sequence is contained outside the 3' end of the expression cassette.

[0107] A fourth aspect of the present invention provides an expression vector containing nucleic acid constructs as described in the second or third aspect of the present invention.

[0108] In another preferred embodiment, the expression vector backbone is pCXB053.

[0109] In another preferred embodiment, the vector is an expression vector that can transfect or transform plant cells.

[0110] In another preferred embodiment, the vector is an expression vector capable of transfecting or transforming immature plant embryos or calluses.

[0111] In another preferred embodiment, the carrier is either ring-shaped or linear.

[0112] The fifth aspect of the present invention provides a genetically engineered cell, said cell containing a vector expressing the nucleic acid constructs described in the third aspect of the present invention, or having its genome integrated with one or more nucleic acid constructs described in the third aspect of the present invention.

[0113] A sixth aspect of the present invention provides a host cell containing a vector expressing a nucleic acid construct as described in the second aspect of the present invention, or having its genome integrated with one or more nucleic acid constructs as described in the second aspect of the present invention.

[0114] In another preferred embodiment, the cell is a plant cell.

[0115] In another preferred embodiment, the plant is a monocotyledonous plant.

[0116] In another preferred embodiment, the plant is selected from the group consisting of: grasses, legumes, cruciferous plants, or combinations thereof.

[0117] In another preferred embodiment, the plant is selected from the group consisting of rice, corn, soybean, tomato, tobacco, wheat, sorghum, Arabidopsis thaliana, barley, oats, millet, peanut, or combinations thereof.

[0118] In another preferred embodiment, the genetically engineered cell or host cell is introduced into the cell by means of a method selected from the group consisting of Agrobacterium-mediated transformation, gene gun method, polyethylene glycol (PEG)-mediated transformation, or a combination thereof.

[0119] The seventh aspect of the present invention provides the use of the nucleic acid constructs described in the second aspect of the present invention, or a vector containing the nucleic acid constructs described in the second aspect of the present invention, or a host cell described in the sixth aspect of the present invention, for the preparation of reagents or kits for evaluating CasWM expression levels.

[0120] In another preferred embodiment, the CasWM is a CasWM protein encoded by a codon-optimized CasWM nucleotide sequence.

[0121] In another preferred embodiment, the codon-optimized CasWM nucleotide sequence is shown in any one of SEQ ID NO. 1, 2, 5, or 6.

[0122] The eighth aspect of the present invention provides a reagent combination for evaluating the expression level of CasWM, comprising: the nucleic acid construct described in the second aspect of the present invention, or an expression vector containing the nucleic acid construct.

[0123] The ninth aspect of the present invention provides a reagent combination for gene editing, comprising: the nucleic acid construct described in the third aspect of the present invention, or an expression vector containing said nucleic acid construct.

[0124] The tenth aspect of the present invention provides a reagent kit containing a combination of reagents described in the eighth or ninth aspect of the present invention.

[0125] In another preferred embodiment, the kit also includes a label or instructions.

[0126] The eleventh aspect of this invention provides a method for evaluating CasWM expression levels, comprising:

[0127] 1) Transform plant cells with a vector containing the nucleic acid construct described in the second aspect of the present invention and culture them for a period of time (T1);

[0128] 2) Add the substrate reagent of the internal reference protein and the reaction reagent of the reporter gene-encoded protein, incubate, and then perform fluorescence detection to obtain the ratio of the fluorescence value of the reporter gene-encoded protein to that of the internal reference protein;

[0129] 3) The expression level of CasWM was assessed based on the ratio of the luminescence values ​​of the reporter gene-encoded protein to the internal reference protein.

[0130] In another preferred embodiment, the reporter genes include HiBiT and Nluc.

[0131] In another preferred embodiment, the internal reference protein includes luciferase.

[0132] In another preferred embodiment, the luciferase includes firefly luciferase (Fluc) and sea cucumber luciferase (Rluc).

[0133] In another preferred embodiment, the substrate reagent of the internal reference protein includes novel furofurimazine analogs (Fluorofurimazine (FFz)) and coelenterazine (CTz).

[0134] In another preferred embodiment, the reaction reagent for the reporter gene-encoded protein includes a lysis buffer.

[0135] In another preferred embodiment, the lysis buffer includes HiBiT Lytic Buffer.

[0136] In another preferred embodiment, the reaction reagent for the reporter gene-encoded protein includes a fluorescent substrate (such as a novel furazine analogue (Fluorofurimazine (FFz)), coelenterazine (CTz)) and LgBiT protein.

[0137] In another preferred embodiment, the molar ratio of the fluorescent substrate (e.g., Fluorofurimazine In vivo Substrate (FFz), Coelenterazine (CTz)) to LgBiT protein is 1:1-10, more preferably 1:16, and even more preferably 1:1-3, such as 1:2 or 1:1.

[0138] In another preferred embodiment, if the ratio of the luminescence value of the reporter gene-encoded protein to the internal reference protein is ≥20, more preferably ≥40, and even more preferably ≥60, it indicates that the expression level of the CasWM protein is high.

[0139] The twelfth aspect of this invention provides a method for gene editing in plants, comprising the steps of:

[0140] (i) Provide the plant or plant cell to be edited;

[0141] (ii) An expression vector containing the nucleic acid construct described in the third aspect of the present invention is introduced into the plant or plant cell to be edited, thereby enabling the editing of the target gene of the plant or plant cell.

[0142] In another preferred embodiment, the introduction is performed via Agrobacterium.

[0143] In another preferred embodiment, the introduction is performed via a gene gun.

[0144] In another preferred embodiment, the gene editing includes modifying a gene, knocking out a gene, altering the expression of a gene product, repairing mutations, and / or inserting polynucleotides.

[0145] The thirteenth aspect of this invention provides a method for preparing transgenic plant cells, comprising the steps of:

[0146] (i) Transfecting plant cells with the construct described in the third aspect of the present invention, or an expression vector containing the construct described in the third aspect of the present invention, so that the plant cells contain the nucleic acid construct described in the third aspect of the present invention or the construct in the reagent combination described in the ninth aspect of the present invention, thereby obtaining the transgenic plant cells.

[0147] In another preferred embodiment, the transfection is performed using Agrobacterium-mediated transformation or gene gun bombardment.

[0148] The fourteenth aspect of the present invention provides a method for preparing transgenic plants, comprising the steps of:

[0149] The transgenic plant cells prepared by the method described in the thirteenth aspect of the present invention are regenerated into a plant body to obtain the transgenic plant.

[0150] The fifteenth aspect of the present invention provides a transgenic plant, said plant being prepared by the method described in the fourteenth aspect of the present invention, or said plant having plant cells containing the constructs described in the third aspect of the present invention or having its genome integrated with one or more of the constructs described in the third aspect of the present invention.

[0151] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0152] Figure 1 The optimization of the CasY vector is shown. A. Schematic diagram of the vector map. pCasWM-RP is the transient transformation reporter system vector, and the expression levels of different CasWM nucleotide sequence versions are compared by the HiBiT / Fluc luciferase ratio. pZmCasWM is the map of the monocotyledonous stable transformation vector, screened using the Bar gene. B. Comparison of the optimization of four CasWM nucleotide sequence versions. The HiBiT / Fluc ratio characterizes the expression level of the CasWM-HiBiT fusion protein.

[0153] Figure 2This diagram shows the editing efficiency of CasWM at the ZmNL4 gene site in maize. A. Gene structure diagram of ZmNL4. The red arrows indicate the four sgRNA sites targeted by CasWM. B. Editing efficiency of CasWM sequence-optimized versions v1 and v2 editing vectors at the sgRNA1, sgRNA2, sgRNA3, and sgRNA4 target sites in the ZmNL4 gene. C. First-generation sequencing peak diagram of the edited plant at the sgRNA4 site.

[0154] Figure 3 This diagram shows the editing efficiency of CasWM at the OsSLR1 gene site in rice. A. Gene structure diagram of OsSLR1. The red marker lines indicate the three sgRNA regions targeted by CasWM. B. Editing efficiency of the CasWM sequence-optimized version v2 editing vector at the sgRNA5, sgRNA6, and sgRNA7 targets in the OsSLR1 gene. C. First-generation sequencing peak diagram of the edited plant at the sgRNA5 site. Detailed Implementation

[0155] Through extensive and in-depth research, the inventors have, for the first time, constructed a nucleic acid construct for evaluating CasWM expression levels or editing efficiency. This construct was then used to screen for optimized CasWM nucleotide sequences with high expression levels or editing efficiency. The selected optimized CasWM nucleotide sequences were introduced into plant cells, resulting in very high editing efficiency. Based on this, the inventors completed this invention.

[0156] the term

[0157] As used in this article, the term "plant promoter" refers to a nucleic acid sequence that can initiate nucleic acid transcription in plant cells. A plant promoter can be derived from plants, microorganisms (such as bacteria or viruses), or animals, or it can be a synthetically produced or modified promoter.

[0158] As used herein, the term "CasWM protein" refers to a nuclease. In this invention, the CasWM protein belongs to the Cas12 protein family, and its amino acid sequence is shown in SEQ ID NO.3:

[0159]

[0160] As used herein, the term "coding sequence of CasWM protein" refers to the nucleotide sequence encoding a CasWM protein with cleavage activity. The coding sequence of the CasWM protein of this invention is a codon-optimized sequence.

[0161] The codon-optimized coding sequence of the CasWM protein obtained in this invention can significantly increase the expression level of the CasWM protein and also significantly improve the editing efficiency of the CasWM protein in plants.

[0162] As used herein, the term "plant" includes the whole plant, plant organs (such as leaves, stems, roots, etc.), seeds, and plant cells, as well as their progeny. There are no particular limitations on the types of plants that can be used in the methods of this invention, and generally include any type of higher plant that can be transformed, including monocots, dicots, and gymnosperms.

[0163] As used herein, the term "expression cassette" refers to a polynucleotide sequence containing the gene to be expressed and the sequence components required for expression. The components required for expression include a promoter and a polyadenylation signal sequence. Furthermore, the expression cassette of the present invention may contain or not contain other sequences, including (but not limited to): enhancers, secretion signal peptide sequences, etc.

[0164] Reporter genes

[0165] A reporter gene is a gene that encodes a protein or enzyme that is easily detected against a background of endogenous proteins. Reporter genes are linked to target genes or regulatory sequences, and by indirectly or directly detecting the signal of the reporter gene's encoded product, such as a reporter protein, mRNA, or enzyme, they directly reflect the transcriptional activity or expression level of genes within the cell. Generally, reporter genes are characterized by being non-toxic, non-immunogenic, easy to detect, and possessing a certain degree of specificity.

[0166] Reporter genes generally fall into four categories: those that emit fluorescence without a substrate, such as fluorescent protein genes; those that interact with radioactive or fluorescent substrates, such as luciferases; transport-based reporter genes, such as chloramphenicol acetyltransferase genes; and membrane-anchored receptors or antibodies, such as membrane-anchored luciferases.

[0167] In a preferred embodiment, the reporter gene is HiBiT, which is a short peptide (VSGWRLFKKIS) consisting of 11 amino acids. It can interact with the LgBit protein subunit in the reagent to form an Nluc protein. NLuc (Nanoluciferase) is a nanoluciferase that can catalyze the oxidation of CTz, FFz, etc., to produce light.

[0168] Internal reference protein

[0169] Internal control genes (also known as reference genes) are genes used to correct experimental errors. In dual-luciferase assays, a stably expressed gene is often selected as an internal control gene to standardize the expression level of the target gene. The expression of the internal control gene should remain relatively stable under different experimental conditions and should not be affected by the analyte. By using internal control genes, the influence of sample processing and detection errors in the experiment can be eliminated, making the results more accurate and reliable. Commonly used internal control genes include GAPDH (glycolytic enzyme) and β-actin (β-actin), but the selection of internal control genes should be based on the specific experimental design and the characteristics of the research subjects. In dual-luciferase assays, Flux and Rluc are often used as internal control genes.

[0170] There are two types of internal controls: one uses a reference gene naturally present in the sample as an internal standard, and the other is an artificially added internal control. Endogenous internal controls: These typically exhibit relatively constant expression across tissues and cells, and are commonly used as references when detecting changes in gene expression levels. Internal control genes are usually housekeeping genes. Commonly used internal control genes include GAPDH, β-actin, and 18S rRNA. Exogenous internal controls: These are artificially synthesized internal controls that do not interfere with the amplification of the target sequence. They are used to monitor amplification or extraction processes, such as using GFP or luciferase as internal controls.

[0171] In a preferred embodiment, the internal control protein is Firefly luciferase (FLuc). FLuc was first extracted from fireflies by McElroy et al. in 1956, and since then, luciferase has been widely used as a reporter system in life science research. The catalytic luminescence process of firefly luciferase requires luciferin, oxygen, ATP, and magnesium ions. It can catalyze luciferin to emit light.

[0172] Sequence optimization

[0173] This invention optimizes the nucleotide sequence of CasWM (as shown in SEQ ID NO: 1 or 2). This sequence has been specially optimized, resulting in significantly improved transcription and translation efficiency.

[0174] This invention optimizes a large number of nucleotide sequences based on the CasWM protein, but not all optimized nucleotide sequences can improve the expression of the CasWM protein.

[0175] The nucleotide sequence of the optimized CasWM that enhances CasWM expression is shown in any of SEQ ID NO.1-2.

[0176] The nucleotide sequence of CasWM that did not improve CasWM expression after optimization is shown in SEQ ID NO: 5 or 6.

[0177] Based on the amino acid sequence of CasWM, this invention generated a variety of nucleotide sequences for testing. After extensive screening, it was found that SEQ ID NO.1-2 had high availability.

[0178] After extensive screening, this invention provides the CasWM protein sequence with optimized nuclear codon preferences, as shown in SEQ ID NO.:1 or 2.

[0179] In this invention, the natural DNA coding sequence (unoptimized DNA coding sequence) of the CasWM protein is shown in SEQ ID NO.:7. This application has found that the expression level and gene editing efficiency of the unoptimized natural DNA coding sequence are both very low.

[0180] Wild-type nucleotide sequence (unoptimized DNA coding sequence, shown in SEQ ID NO.:7)

[0181]

[0182]

[0183] This invention optimizes sequence fragments that affect gene expression. These sequence fragments include, but are not limited to, codon usage bias, elimination of secondary structures unfavorable to expression (such as hairpin structures), alteration of GC content, CpG dinucleotide content, mRNA secondary structure, cryptic splicing sites, early polyadenylation sites, internal ribosome entry and binding sites, negative CpG islands, RNA unstable regions, repetitive sequences (direct repeats, inverted repeats, etc.), and restriction sites that may affect cloning. The final result is a specially optimized DNA coding sequence as shown in SEQ ID NO.:1 or 2.

[0184] Reagent combination for gene editing

[0185] The present invention provides a reagent combination for gene editing, the reagent combination comprising the nucleic acid constructs described in the third aspect of the present invention, or an expression vector containing the nucleic acid constructs.

[0186] The various elements used in the constructs of this invention can be obtained by conventional methods, such as PCR, fully artificial chemical synthesis, and enzyme digestion, and then linked together using well-known DNA ligation technology to form the constructs of this invention.

[0187] Transgenic plant cells are obtained by transforming the vector of the present invention into plant cells, thereby mediating the integration of the vector of the present invention into the chromosomes of the plant cells.

[0188] The transgenic plant cells of the present invention are regenerated into plant bodies to obtain transgenic plants.

[0189] The nucleic acid constructs prepared in this invention can be introduced into plant cells using conventional plant recombination techniques (such as Agrobacterium-mediated transformation) to obtain plant cells carrying the nucleic acid constructs (or vectors carrying the nucleic acid constructs), or to obtain plant cells with the nucleic acid constructs integrated into their genome.

[0190] Carrier construction

[0191] This invention provides two vectors. One vector is used to evaluate CasWM expression levels or its editing efficiency. Its main feature is that a reporter gene is linked to the coding sequence of a codon-optimized CasWM protein, and both are constructed into the same vector along with the coding gene of an internal control protein. This vector can be used to effectively screen for optimized CasWM protein coding sequences with high CasWM expression levels or high editing efficiency.

[0192] Another vector provided by this invention is used for efficient gene editing in plants. Its main feature is that the coding sequence of the CasWM protein with high expression level or high editing efficiency obtained by screening is constructed with gRNA into the same vector. This vector can significantly improve the gene editing efficiency in plants.

[0193] When driving CasWM expression or co-expression of CasWM and reporter genes, strong promoters suitable for plants are generally selected, such as the CaMV 35S promoter or the UBI promoter.

[0194] When driving the expression of internal reference proteins, promoter types suitable for plants are generally selected, such as the UBQ promoter or the CaMV 35S promoter.

[0195] When driving sgRNA expression, type II promoters, such as U6 and U3, are generally selected.

[0196] In this invention, the vector is not particularly limited. Any binary vector can be used, not limited to the pCambia vector, nor limited to these two types of resistance. Any vector that meets the following requirements can be used in this invention: (1) can be transformed into plants through Agrobacterium-mediated transformation; (2) allows RNA to be transcribed normally; (3) allows plants to acquire new resistance.

[0197] In a preferred embodiment, the carrier is selected from the group consisting of pZmCasWM.

[0198] Genetic transformation

[0199] In a preferred embodiment of the present invention, the vector of the present invention is introduced into a plant recipient. The introduction method includes, but is not limited to, gene gun method, microinjection method, electrocautery method, ultrasound method, and polyethylene glycol (PEG)-mediated method. Recipient plants include, but are not limited to, rice, corn, soybean, tomato, tobacco, wheat, and sorghum.

[0200] application

[0201] This invention can be used in the field of plant genetic engineering for plant research and breeding, especially for the genetic improvement of economically valuable agricultural and forestry crops.

[0202] The main advantages of this invention include:

[0203] (1) This invention first constructs a nucleic acid construct for evaluating the expression level of CasWM or its editing efficiency, and uses the construct to screen for optimized CasWM nucleotide sequences with high CasWM expression levels or editing efficiency. The screened optimized CasWM nucleotide sequences are introduced into plant cells to obtain very high editing efficiency.

[0204] (2) This invention provides a monocotyledonous gene editing vector, gene editing method and application, specifically by optimizing the nucleotide sequence of a Cas12i-CasWM protein to improve gene editing efficiency in monocotyledons, thus broadening the application of Cas12i in the field of plant gene editing.

[0205] (3) Cas12 has limited applications in the field of plant gene editing. CasWM, as a novel Cas12i protein, is expected to expand the application of Cas12 in the field of plant gene editing.

[0206] (4) Currently, the efficiency of monocotyledonous gene editing mediated by Cas12 is low. This invention optimizes the vector structure, uses the ZmUBI promoter to start the expression of CasWM protein, optimizes the protein nuclear entry efficiency with bpNLS, and uses the CMV35S promoter to start the expression of Bar resistance gene.

[0207] (5) Most Cas12 protein editing efficiency is low, including unoptimized CasWM. This invention proposes a method for optimizing the nucleotide sequence of Cas protein, which can increase protein expression and thus improve the editing efficiency of Cas protein in monocotyledons.

[0208] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents involved in this invention are commercially available.

[0209] In this invention, the lysis buffer can be... HiBiT Lytic Buffer can also be prepared using the following formula:

[0210] 50 mM Tris-HCl buffer (pH 7.5), 150 mM NaCl (sodium chloride), 0.5 mmol / L ethylenediaminetetraacetic acid (EDTA) (pH 8.0), 10% glycerol, and 0.5% Triton X-100 immunostaining permeabilization solution.

[0211] Example

[0212] This invention constructs a novel plant Cas gene editing expression vector, pZmCasWM, by using an optimized and screened CasWM nucleotide sequence. The vector exhibits high editing efficiency at seven endogenous target sites in rice and maize.

[0213] Through extensive and in-depth testing, the inventors have established a dual-luciferase reporter system for testing the expression quality of Cas protein nucleotide sequences in plants. Specifically, the pCasWM-RP vector was constructed, and four artificially synthesized CasWM nucleotide sequences were tested using maize protoplast transformation and HiBiT detection technology. An optimized CasWM nucleotide sequence suitable for high expression in monocotyledonous plants was screened out, and efficient genome editing was achieved in rice and maize with an editing efficiency of ≥70%.

[0214] Example 1: Construction of a novel CasWM enzyme-efficient gene editing system in rice and maize

[0215] Through extensive and in-depth research and experimentation, the inventors have established a dual-luciferase reporter system to screen for a preferred nucleotide sequence of CasWM and constructed a plant genome editing vector pZmCasWM (constructed in the embodiments of this invention). This vector can efficiently achieve genome editing at sgRNA1, sgRNA2, sgRNA3, and sgRNA4 genomic sites in maize ZmNL4 and sgRNA5, sgRNA6, and sgRNA7 sites in rice OsSLR1. Therefore, this invention aims to provide a method and system for efficient genome editing suitable for plants.

[0216] The specific operating procedure is as follows.

[0217] Construction of a dual-luciferase reporter system

[0218] The dual-luciferase reporter system comprises two parts: an internal control gene system, specifically using the UBQ strong expression promoter to initiate Fluc expression and employing the plant NOS terminator; and the expression of the CasWM-HiBiT fusion protein. The short peptide portion of HiBiT functions as a reporter gene, emitting fluorescence under the reaction reagent (Promega, N1610). The stronger the expression ability of the corresponding CasWM nucleotide sequence, the stronger the HiBiT luminescence intensity. HiBiT can only be fused to the C-terminus of CasWM. Both parts were constructed on the same vector pCasWM-RP. The plasmid was transformed into maize protoplast cells using a transient protoplast transformation method to determine the expression levels of the corresponding test sequences. The specific experimental procedures are as follows:

[0219] Construction of pCasWM-RP vector

[0220] 1. Use pCXB053 [1] As the vector backbone, the pCXB053 vector backbone was cut with restriction endonucleases SbfI and BamHI (purchased from NEB) to remove the Cas9 nucleotide sequence, resulting in clone backbone 1 (see backbone sequence 1, SEQ ID NO. 8).

[0221] 2. Then, the four codons synthesized de novo were optimized to produce different CasWM-HiBiT nucleotide sequences, which included NLS sequences (specific sequences: CasWM-HiBiT-v1, CasWM-HiBiT-v2, CasWM-HiBiT-v3, CasWM-HiBiT-v4), and cloned using primers WM-F1 and WM-R1.

[0222] 3. Then, the UBI sequence fragment was cloned from the pCXB053 vector backbone by PCR using primers UBI-F and UBI-R; finally, four different CasWM-HiBiT sequences were cloned into the pCXB053 vector backbone along with cloning backbone sequence 1 and the UBI sequence fragment using the Novozymes non-ligase-dependent multi-fragment one-step cloning kit, respectively, to obtain four pCasWM-RP intermediate vectors.

[0223] 4. Then, the ZmU6-sgRNA expression cassette of the intermediate vector was excised using restriction endonucleases HindIII and SbfI (purchased from NEB) to obtain the intermediate vector backbone fragment. The UBQ-Fluc-NOS expression cassette was then extracted from the pDual-Luc vector (laboratory-owned vector) using primers UBQ-F and NOS-R. [2] After PCR cloning, the fragments were cloned into the intermediate vector backbone using Novizan's single-fragment one-step cloning kit, successfully constructing four pCasWM-RP vectors. Figure 1 A). The specific sequences are shown in Table 1.

[0224] Table 1 Primers used for constructing the pCasWM-RP vector

[0225]

[0226] Backbone sequence 1 (SEQ ID NO.8):

[0227]

[0228]

[0229]

[0230]

[0231] CasWM-HiBiT-v1(NLS-CasWM-NLS- HiBiT (SEQ ID NO.9, bold text indicates NLS, underline indicates HiBiT)

[0232]

[0233]

[0234] CasWM-HiBiT-v2(NLS-CasWM-NLS- HiBiT (SEQ ID NO.10, bold text indicates NLS, underline indicates HiBiT)

[0235]

[0236]

[0237] CasWM-HiBiT-v3(NLS-CasWM-NLS-HiBiT)(SEQ ID NO.11, bold text indicates NLS, underline indicates HiBiT)

[0238]

[0239]

[0240] CasWM-HiBiT-v4(NLS-CasWM-NLS-HiBiT)(SEQ ID NO.12, bold text indicates NLS, underline indicates HiBiT)

[0241]

[0242]

[0243] ZmU6-sgRNA expression cassette

[0244] UBQ-Fluc-NOS expression box (SEQ ID NO.14, bold text indicates UBQ, underline indicates NOS)

[0245]

[0246] The pCasWM-RP vector is a transient reporter vector for CasWM protein expression assays, containing two important expression cassettes: the UBQ promoter (sequence:

[0247] caattagccaaaaacaactttgcgtgtaaacaacgctcaatacacgtgtcattttattattagctattgcttc

[0248] accgccttagctttctcgtgacctagtcgtcctcgtcttttcttcttcttcttctataaaacaatacccaaag

[0249] agctcttcttcttcacaattcagatttcaatttctcaaaatcttaaaaactttctctcaattctctctaccgt

[0250] gatcaaggtaaatttctgtgttccttattctctcaaaatcttcgattttgttttcgttcgatcccaatttcgt

[0251] atatgttctttggtttagattctgttaatcttagatcgaagacgattttctgggtttgatcgttagatatcat

[0252] cttaattctcgattagggtttcatagatatcatccgatttgttcaaataatttgagttttgtcgaataattac

[0253]

[0254] The working principle is as follows: the Firefly luciferase gene (Fluc) serves as an internal control. The HiBiT tag peptide acts as a reporter gene. HiBiT is an 11-amino acid tag peptide that spontaneously interacts with the LgBiT protein. The two bind to form NanoLuc luciferase, which catalyzes the substrate and produces a bright luminescent signal. By fusing the HiBiT tag to the C-terminus of CasWM sequences with different optimizations, the expression effect of CasWM under different sequence optimizations can be determined based on the intensity of the HiBiT luminescent signal.

[0255] Protoplast transformation and fluorescence value determination

[0256] We used the maize variety KN5585 (obtained from Weimi Biotechnology) to prepare protoplasts. Methods for maize protoplast isolation and transformation can be found in the literature. [3] The four pCasWM-RP vectors constructed above were extracted using the Tiangen endotoxin-free plasmid large-scale extraction kit. Each plasmid vector was transfected at 2 μg via PEG-mediated transfection, with three replicates per plasmid. The transfected protoplasts were cultured at 25°C without drug screening for 12 hours. Afterward, the protoplast cells were transferred to the wells of an ELISA plate, and Fluc substrate reagent (Promega, N1610) and HiBiT reagent (substrate: Coelenterazine and LgBiT protein, purchased from Promega, N3030) were added.

[0257] After culturing 100 μL of protoplast cells for 12 hours, add 100 μL of cell lysis buffer (Promega, E1531, Luciferase Cell Culture Lysis 5X Reagent), and lyse on ice for 15 minutes. Then, extract 100 μL of supernatant into a microplate and add 50 μL of Fluc substrate reagent (Promega, N1610). Reporter (NanoDLR) TM The Fluc fluorescence value was detected using an ELISA reader. The ELISA plate was then removed again, and 50 μL of HiBiT reaction reagent (containing 0.5 μL of HiBiT substrate (100 mM) and 1 μL of LgBit protein (100 mM), purchased from Promega, N3030) was added to the sample. The HiBiT fluorescence value was detected again using the HiBiT Lytic Detection System and a microplate reader. The HiBiT / Fluc ratio was calculated from the two measurements. Figure 1From B, it can be concluded that CasWM-HiBiT-v1 had the lowest expression level, with a HiBiT / Fluc ratio of only 2.06, while CasWM-HiBiT-v2 had the highest expression level, with a HiBiT / Fluc ratio as high as 67.7. Furthermore, from... Figure 1 As shown in Figure B, when the HiBiT / Fluc ratio is ≥20, high expression of the CasWM protein can be obtained. We used v1 as the control sequence and v2 as the experimental group for genetic transformation verification.

[0258] pZmCasWM vector construction

[0259] 1. Using the intermediate vector of pCasWM-RP, containing the sequences of CasWM-HiBiT-v1 and CasWM-HiBiT-v2 as the backbone for this vector construction, the sgRNA was cloned. First, the vector was digested with BsaI and SbfI to extract the CCDB-sgRNA region (agagaccactagtttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaa, SEQ ID NO.15). The digested backbone fragment was named pZmCasWM-D1.

[0260] 2. Seven sgRNA sequences were artificially synthesized, including sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA5, sgRNA6, and sgRNA7. The specific sequences are shown in Table 2 below. The sgRNA1, sgRNA2, sgRNA3, and sgRNA4 sequences were cloned into the pZmCasWM-D1 vector backbone (containing CasWM-HiBiT-v1 and CasWM-HiBiT-v2 sequences) using Novizan's single-fragment one-step cloning kit, resulting in eight maize gene-editing plasmids. The sgRNA5, sgRNA6, and sgRNA7 sequences were cloned into the pZmCasWM-D1 vector backbone (containing CasWM-HiBiT-v2 sequence) using Novizan's single-fragment one-step cloning kit, resulting in three rice gene-editing vectors. A total of 11 gene-editing vectors were obtained, collectively referred to as pZmCasWM below.

[0261] Table 2. Synthetic CasWM-sgRNA sequences

[0262]

[0263] Agrobacterium-mediated genetic transformation of rice and maize

[0264] The pZmCasWM plasmid was transformed into immature maize embryos and rice callus using Agrobacterium-mediated transformation. [1,4] Using the herbicide resistance gene (Bar) as a selection tag, positive resistant calluses were obtained after conventional tissue culture screening, and further differentiation yielded stable transformed plants. [4] .

[0265] Rice and maize genome editing detection

[0266] Resistant calluses selected through tissue culture from the experimental and control groups were further differentiated to obtain stable transformed plants. A total of 54 and 60 T0 generation plants were obtained from the maize experimental group and control group, respectively, and genomic DNA was extracted from each plant for analysis. A total of 45 T0 generation plants were obtained from the rice experimental group. Primers were designed upstream and downstream of the target site for PCR amplification and detection; primer sequences are shown in Table 3 below.

[0267] Table 3

[0268] Primer name Primer sequence Gene NL4-F1 GATCCATTGGCTACCTCAG ZmNL4 NL4-R1 TAGAACAAGCACGCACACC ZmNL4 SLR1-F1 GCCCACCGCGCAGTGAGA OsSLR1 SLR1-R1 ACCGCACCTTGTACCCGA OsSLR1

[0269] result

[0270] The gene structure diagram of ZmNL4 is as follows: Figure 2 As shown in Figure A.

[0271] As can be seen, in corn, the efficiency of CasWM version 2 is significantly improved compared to version 1. Figure 2B). Version v2 achieved an average efficiency of 94.5% across four sgRNA targets, compared to only 23.9% for version v1. One edited plant showed a homozygous deletion of 276 bp, indicating that the v2 editor has better editing efficiency. Figure 2 C). The editing efficiencies of the three rice loci were 76.9%, 73.3%, and 76.5%, respectively. Figure 3 AB). Among them, one plant showed a 5bp heterozygous deletion at the sgRNA 5 site ( Figure 3 C).

[0272] Compared to the optimized but inefficient v1 version of CasWM, the v2 version of CasWM, screened based on the experimental method of this invention, successfully and efficiently achieved genome editing in maize and rice, demonstrating the practical application value of this invention.

[0273] Partial sequence information:

[0274] CasWM-optimized nucleotide sequences

[0275] >CasWM-v2 (SEQ ID NO.1)

[0276]

[0277]

[0278] >V4 nucleotide sequence (SEQ ID NO.2)

[0279]

[0280]

[0281] >pZmCasWM(SEQ ID NO.4)

[0282]

[0283]

[0284]

[0285]

[0286]

[0287]

[0288] >V1 nucleotide sequence (SEQ ID NO.5)

[0289]

[0290]

[0291] >V3 nucleotide sequence (SEQ ID NO.6)

[0292]

[0293]

[0294] References

[0295] 1. Liu, H.-J., et al., High-Throughput CRISPR / Cas9 MutagenesisStreamlines Trait Gene Identification in Maize. The Plant Cell, 2020.32(5):p.1397-1413.

[0296] 2.Tian,Y.,et al.,Efficient C-to-G editing in rice using an optimizedbase editor.Plant Biotechnol J, 2022.20(7):p.1238-1240.

[0297] 3.Tu,

[0298] 4. Lin, Q., et al., Prime genome editing in rice and wheat. NatBiotechnol, 2020.38(5):p.582-585.

[0299] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A nucleotide sequence encoding a CasWM protein, characterized in that The nucleotide sequence is selected from the group consisting of: (a) the nucleotide sequence is as set forth in SEQ ID NO.: 1 or 2; and (b) the nucleotide sequence has >95% identity, preferably >98%, more preferably >99% to the nucleotide sequence set forth in SEQ ID NO.: 1 or 2.

2. A nucleic acid construct for assessing the amount of CasWM expression, comprising, The nucleic acid construct comprises: a first expression cassette; a second expression cassette; and optionally a third expression cassette; wherein the first expression cassette is an expression cassette for expressing a reference protein; the second expression cassette is a fusion protein expression cassette for expressing a fusion protein, the fusion protein comprising a CasWM and a reporter protein; the third expression cassette is a selection marker expression cassette for expressing a selection marker; and the first expression cassette, the second expression cassette, and the third expression cassette are each independently located on the same or different vectors.

3. A nucleic acid construct for gene editing of a plant, characterized in that, The nucleic acid construct comprises: a fourth expression cassette; a fifth expression cassette; and optionally a third expression cassette; wherein the fourth expression cassette is a gRNA expression cassette for expressing a gRNA; the fifth expression cassette is an expression cassette for expressing a CasWM; the third expression cassette is a selection marker expression cassette for expressing a selection marker; and the fourth expression cassette, the fifth expression cassette, and the third expression cassette are each independently located on the same or different vectors.

4. An expression vector, characterized by, The expression vector contains the nucleic acid construct of claim 2 or 3.

5. A genetically engineered cell, comprising, The cell contains a vector expressing the nucleic acid construct of claim 3, or its genome integrates one or more nucleic acid constructs of claim 3.

6. A host cell, characterized in that, The cell contains a vector expressing the nucleic acid construct of claim 2, or its genome integrates one or more nucleic acid constructs of claim 2.

7. Use of the nucleic acid construct of claim 2 or a vector containing the nucleic acid construct of claim 2 or the host cell of claim 6, characterized in that, A reagent or kit for preparing an evaluation of the expression amount of CasWM.

8. A reagent combination for evaluating the expression amount of CasWM, characterized by, Comprising: the nucleic acid construct of claim 2, or an expression vector containing the nucleic acid construct.

9. A reagent combination for gene editing, characterized in that, Comprising: the nucleic acid construct of claim 3, or an expression vector containing the nucleic acid construct.

10. A kit characterized in that, The kit contains the reagent combination of claim 8 or 9.

11. A method of assessing CasWM expression, comprising, Comprising: 1) transforming a plant cell with a vector containing the nucleic acid construct of claim 2, and culturing for a period of time T1; 2) adding a substrate reagent of a reference protein and a reaction reagent of a reporter protein coding protein, and after incubation, performing fluorescence detection to obtain the luminescence value ratio of the reporter protein coding protein to the reference protein; 3) evaluating the expression amount of CasWM according to the luminescence value ratio of the reporter protein coding protein to the reference protein.

12. A method of genetically editing a plant, comprising, Comprising steps of: (i) providing a plant or plant cell to be edited; (ii) introducing an expression vector containing the nucleic acid construct of claim 3 into the plant or plant cell to be edited, thereby achieving editing of a target gene of the plant or plant cell.

13. A method of making a transgenic plant cell, comprising, Comprising steps of: (i) transfecting a plant cell with the construct of claim 3, or an expression vector containing the construct of claim 3, so that the plant cell contains the nucleic acid construct of claim 3 or the construct in the reagent combination of claim 9, thereby preparing the transgenic plant cell.

14. A method of making a transgenic plant, comprising, Comprising steps of: regenerating the transgenic plant cell produced by the method of claim 13 into a plant body, thereby obtaining the transgenic plant.

Images