NLR receptor and application thereof

Abstract

The invention discloses an application of an NLR receptor RCSP (GenBank: XAX32969.1) in endowing or enhancing immune resistance of plants, and the over-expression of the RCSP in the plants can activate ETI and generate very strong systemic resistance, so that the plants can better resist various pathogenic bacteria or viruses and the like.

Description

Technical Field

[0001] This invention belongs to the field of agricultural bioengineering, and specifically relates to the application of an NLR receptor RCSP in conferring or enhancing plant immune resistance against pathogens and / or viruses. Background Technology

[0002] Piercing-sucking insects, such as aphids, brown planthoppers (BPH), whiteflies, and black sedge flies, rely on their long, thin stylets to penetrate the plant epidermis and extract sap from the phloem as a food source (Pollard, 1973; Wang et al., 2010). Some of these insects pose a serious threat to their host plants. For example, the brown planthopper is a major pest of rice and a key factor in reduced rice yields (Savary et al., 2019). Similarly, aphids are also economically important pests, causing significant losses to global crop yields (Gupta and Virendra, 1994). Furthermore, species such as aphids and brown planthoppers can also act as vectors for viruses (Brault et al., 2010; Ng and Perry, 2004), further exacerbating the negative impact on host plants.

[0003] During the feeding process of piercing-sucking insects, they inject salivary proteins into plant cells. These proteins play important roles in the plant-insect interaction (Huang et al., 2016; Liu et al., 2016; Miles, 1999). In recent years, research on effector proteins of piercing-sucking insects has gradually become a hot topic, especially the study of effector proteins of aphids and brown planthoppers. To date, nearly ten effector proteins have been identified from brown planthoppers, such as NlEG1 (β-1,4-endoglucanase) (Ji et al., 2017), NlSEF1 (EF-hand calcium-binding protein) (Ye et al., 2017), and NlMLP (mucin-like protein) (Huang et al., 2017; Shangguan et al., 2018). Furthermore, Guo et al. discovered a salivary protein (BISP) that interacts with BPH14. This insect salivary effector protein, recognized by the CC-NB-LRR (CNL) receptor BPH14, can activate the host plant's resistance response (Guo et al., 2023). In aphids, various effector proteins with different functions have also been found, most of which suppress plant immunity and promote insect reproduction, such as Me10 and MIF (Atamian et al., 2013; Chaudhary et al., 2019; Naessens et al., 2015). However, some aphid effector proteins, such as Mp10 in the peach aphid, can activate plant immunity, but the specific mechanisms are unclear (Bos et al., 2010; Rodriguez et al., 2014).

[0004] Although the importance of NLR (nucleotide-binding leucine-rich repeat receptor) proteins in conferring plant resistance to pathogens is well-known, the roles of NLR-mediated ETI (effector-triggered immunity), cell death, and SA (salicylic acid) signaling pathways in insect resistance remain to be elucidated. Recent studies have shown that some plant insect-resistance genes also encode NLR proteins. For example, the first identified brown planthopper resistance gene, Bph14, encodes a CNL protein, suggesting a possible similarity in the resistance mechanisms of rice to insects and pathogens (Du B et al., 2009). Subsequently, Bph9 and its alleles were also identified as encoding CNL proteins (Zhao et al., 2016). Furthermore, the tomato Mi-1.2 gene has also been confirmed to encode a CNL protein, conferring resistance to potato aphids and various root-knot nematodes (Milligan et al., 1998; Rossi et al., 1998). The Vat gene in melons also encodes the CNL protein, which controls resistance to cotton aphids and some viruses (Dogimont et al., 2015).

[0005] Chemosensory proteins (CSPs) are a family of small, water-soluble proteins with OS-D domains, most of which are located in the lymph surrounding the dendrites of olfactory receptors and play a role in olfactory perception in insects. Previous studies have shown that six members of the NlCSP family in the brown planthopper can induce a dwarf phenotype in Nicotiana benthamiana (Rao et al., 2019). Meanwhile, the CSP protein MP10 in the peach aphid has also been confirmed as an effector protein involved in aphid-plant interactions (Bos et al., 2010; Rodriguez et al., 2014). Furthermore, SmCSP4 in aphid saliva activates SA-mediated defense responses by interacting with the wheat transcription factor TaWKRY76 (Zhang et al., 2023). These findings suggest that CSPs may be conserved effector proteins that activate plant immunity. However, the mechanisms by which CSPs activate immune responses in plants and their receptor proteins remain unknown. Summary of the Invention

[0006] In our research on plant immunology, our group systematically explored the mechanism of ETI (Effective Toxicological Infection) induced by aphids infesting Nicotiana benthamiana. We discovered that an NLR receptor protein RCSP (GenBank: XAX32969.1) can interact with effector proteins (effect factors) CSP, specifically recognizing conserved salivary proteins CSPs secreted by various piercing-sucking insects. Furthermore, it exhibits broad-spectrum immunity against pathogens and viruses, unlike the NLR genotype specificity of the ETI response. Based on these findings, this invention includes the following technical solutions.

[0007] The first aspect of the present invention provides the use of a polypeptide or its encoding gene in conferring or enhancing plant immune resistance, said polypeptide being selected from the group consisting of:

[0008] (a) A polypeptide with the amino acid sequence shown in SEQ ID NO:1, which is the NLR immune receptor protein RCSP (GenBank: XAX32969.1) derived from Nicotiana benthamiana;

[0009] (b) A conserved variant polypeptide derived from (a) having the polypeptide function of (a) formed by substituting, deleting or adding one or more amino acid residues of the amino acid sequence SEQ ID NO:1.

[0010] (c) A polypeptide derived from (a) having 90% or more homology with the polypeptide sequence defined in (a), preferably 92% or more homology, preferably 95% or more homology, preferably 97% or more homology, preferably 98% or more homology, more preferably 99% or more homology, and having the function of the polypeptide in (a); or

[0011] (d) A derivative polypeptide containing the polypeptide sequence described in (a), (b), or (c).

[0012]

[0013] The aforementioned function refers to recognizing insect CSP proteins and triggering a plant immune response. In particular, it recognizes conserved salivary proteins CSPs secreted by insects such as aphids and brown planthoppers, activates the ETI immune response, and generates systemic resistance, enabling plants to resist attacks from various pathogens or viruses.

[0014] The nucleotide sequence encoding the polypeptide RCSP (GenBank: XAX32969.1) with the above-mentioned amino acid sequence as shown in SEQ ID NO:1 is SEQ ID NO:2, or is a nucleotide sequence that has more than 90% homology with SEQ ID NO:2, preferably more than 92% homology, preferably more than 95% homology, preferably more than 97% homology, preferably more than 98% homology, and more preferably more than 99% homology.

[0015] Alternatively, the above-mentioned plants are crops selected from the group consisting of: rice, wheat, corn, soybean, barley, oats, rye, sorghum, cotton, vegetables, tobacco, and cruciferous plants.

[0016] As a specific application of the above-mentioned polypeptide or its encoding gene, the present invention provides a method for improving the resistance of plants to pathogens and / or viruses, comprising the following steps: inserting or overexpressing the encoding gene of the polypeptide as described in claim 1, such as the NLR receptor RCSP (GenBank: XAX32969.1), into the plant genome. The overexpressed polypeptide can be used to recognize conserved salivary proteins CSPs secreted by insects, i.e., effector proteins CSPs from insects.

[0017] The above method is implemented, for example, in the following manner:

[0018] (i) Cloning the gene encoding the polypeptide as described above into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, namely an RCSP overexpression vector, and transforming plants using Agrobacterium-mediated transformation to obtain transgenic plants overexpressing the polypeptide; and / or

[0019] (ii) By using gene editing technology, the coding gene of the polypeptide described above is cloned into a plant chromosome to obtain a transgenic plant that overexpresses the coding gene of the polypeptide described above; and / or

[0020] (iii) Using plant tissue culture, for example, rice, to construct transgenic plants expressing the aforementioned polypeptide, such as RCSP; using plant transgenic plants, such as Arabidopsis thaliana, to construct transgenic plants overexpressing the aforementioned polypeptide, such as RCSP, using the flower-dip method; or using a method of hybridization between closely related species and Nicotiana benthamiana to transfer RCSP into other plants; or

[0021] (iv) Place the NLR receptor RCSP (GenBank: XAX32969.1) in the genome of plants such as Nicotiana benthamiana under the regulation of a functionally enhanced promoter.

[0022] In one implementation, the gene editing technology described above may be selected from the group consisting of: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0023] A second aspect of the invention provides a DNA molecule comprising, for example, the nucleotide sequence SEQ ID NO:2 of the gene encoding the polypeptide RCSP (GenBank: XAX32969.1) as described above, such as an expression cassette / expression box for the NLR receptor RCSP.

[0024] A third aspect of the invention provides a recombinant plasmid comprising the DNA molecule described above for overexpression of RCSP (GenBank: XAX32969.1), said recombinant plasmid being an overexpression vector formed by cloning the DNA molecule described above onto a plasmid vector suitable for expression in Agrobacterium.

[0025] In one embodiment, the plasmid vector can be selected from plant transgenic vectors or modified vectors such as pHB-YFP, pHB-FLAG, pBin19, fluorescent reporter vector pGreenII0800-LUC, pCAMBIA1300, pCAMBIA1301, pCAMBIA3300, pCAMBIA2301, pBI121, and pTF102.

[0026] A fourth aspect of the present invention is a microbial engineered bacterium, which is a transformant containing the recombinant plasmid described above, used to mediate the transfer of the recombinant plasmid described above into plants. Preferably, the microorganism is Agrobacterium, such as Agrobacterium tumefaciens, Agrobacterium EHA105, or Agrobacterium GV3101. For example, the above-mentioned recombinant plasmid is transferred into an Agrobacterium strain using a freeze-thaw method to form a microbial engineered bacterium.

[0027] This invention marks the first identification of the NLR immune receptor RCSP (GenBank: XAX32969.1) that recognizes cytoseptic enzymes (CSPs) in *Nicotiana benthamiana*. Through genetic transformation, RCSP was overexpressed in host plants of piercing-sucking insects, demonstrating that RCSP can recognize CSPs secreted by these insects, thereby activating the plant's immune response. After recognizing CSPs, RCSP not only activates the endothelial stimuli (ETI) but also generates strong systemic resistance, enabling plants to better resist various pathogens and viruses. Therefore, it has significant application potential in enhancing plant resistance to pathogens and / or viruses. Attached Figure Description

[0028] Figure 1 The study shows that the cell death and dwarf phenotype induced by NlCSP11, a salivary protein of the brown planthopper, in tobacco is dependent on EDS1 and NRG1. The top row shows leaf photographs 7 days after Agrobacterium injection; the bottom row shows plant phenotypes 15 days after Agrobacterium injection.

[0029] Figure 2 This diagram illustrates the local resistance of tobacco to TMV virus activated by NlCSP11. The left image shows a phenotypic photograph of the inflitrated leaves. NlCSP11, XopQ, and LUC were co-injected into tobacco leaves along with the TMV-GFP reporter gene, and the images were taken under long-wave ultraviolet light four days later. The right image is a bar chart showing the average fluorescence intensity of TMV-GFP in the inflitrated leaves.

[0030] Figure 3 This study demonstrates how locally expressed NlCSP11 can activate systemic resistance to TMV virus in tobacco. The left image shows a phenotypic photograph of upper uninflitrated leaves. NlCSP11, XopQ, and LUC were transiently expressed in the localized leaves, while the TMV-GFP reporter gene was injected into the upper uninflitrated leaves 12 days later, and the photograph was taken under long-wave ultraviolet light 4 days later. The right image is a bar chart showing the average fluorescence intensity of TMV-GFP in the upper uninflitrated leaves.

[0031] Figure 4 This is a bar graph showing the bacterial count in leaves at the injection site, indicating that NlCSP11 can activate local resistance to *Pseudomonas syringae* Pst DC3000 in tobacco. First, NlCSP11, XopQ, and GFP were transiently expressed in local leaves. Twenty-four hours later, the leaves at the injection site were inoculated with Pst DC3000ΔhopQ1-1 (OD600 = 0.0005). Bacterial counts were quantified on days 0 and 3.

[0032] Figure 5 This is a bar graph showing the bacterial count in the uninjected apical leaf region of tobacco plants, indicating that locally expressed NlCSP11 can activate systemic resistance to *Pseudomonas syringae* Pst DC3000. First, NlCSP11, XopQ, and GFP were transiently expressed in localized leaves. Twelve days later, the uninjected apical leaves were inoculated with Pst DC3000ΔhopQ1-1 (OD600 = 0.0005), and the bacterial count was quantified at days 0 and 3.

[0033] Figure 6 Gene identification of two homozygous RCSP knockout lines in tobacco is shown, including the target sites of two RCSP double knockouts.

[0034] Figure 7 The image shows leaf phenotypes in which NlCSP11 can activate RCSP to induce cell death in tobacco and is dependent on EDS1.

[0035] Figure 8 Photographs show plant phenotypes of dwarfism induced by NlCSP11 in tobacco, which are dependent on RCSP.

[0036] Figure 9 Photographs showing leaf phenotypes in tobacco plants where the aphid CSP protein MP10 activates RCSP, inducing cell death.

[0037] Figure 10 Photographs of leaf phenotypes showing how five different members of the NlCSP family can activate RCSPs in tobacco to induce cell death are shown.

[0038] Figure 11 The image shows a leaf micrograph verifying the interaction between NlCSP11 and RCSP as verified by BIFC.

[0039] Figure 12 The image shows an SDS gel electrophoresis photograph of the interaction between NlCSP11 and RCSP verified by Co-IP.

[0040] Figure 13 Structural model of the NlCSP11-RCSP complex predicted by Alphafold2. Detailed Implementation

[0041] In the field of plant immunology, the mechanism by which NLR receptor proteins induce ETI immunity through interaction with effector proteins has attracted much attention from researchers. ETI-mediated immunity is usually targeted at specific pathogens or even specific effector factors, and ETI responses are generally considered to have strong genotype specificity. Currently, there are few reports of systematic studies on the broad-spectrum immunity against different pathogens.

[0042] In a recent study, we cloned an NLR immune receptor RCSP (GenBank: XAX32969.1) from Nicotiana benthamiana that can recognize piercing-sucking insect CSPs proteins. RCSP has an amino acid sequence as shown in SEQ ID NO:1, with 1163 amino acids, encoding a TIR-NBS-LRR-CJID domain.

[0043] Currently, very few NLR genes have been found in plants that can recognize insect effectors, and these NLR genes are highly specific for effector recognition, resulting in a narrow range of resistance. Traditional NLR resistance genes mostly recognize only one effector protein, and over time, effector proteins evolve, causing NLR genes to lose their ability to recognize that effector protein, thus losing their resistance. In contrast, RCSP can recognize the conserved effector protein CSP from various piercing-sucking insects. After recognizing CSP, RCSP can not only activate ETI but also generate strong systemic resistance, enabling plants to better resist various pathogens or viruses.

[0044] Regulated stem cell pumps (RCSPs) can be transferred into other plants through Agrobacterium-mediated genetic transformation or by hybridization of closely related species with Nicotiana benthamiana. This imbues the plant with RCSPs, enabling it to recognize causative sap pumps (CSPs) secreted by piercing-sucking insects, thereby activating the plant's immune response. After recognizing CSPs, RCSPs not only activate the phytoestrogen response (ETI) but also generate strong systemic resistance, allowing the plant to better resist various pathogens and viruses. Furthermore, plants already possessing RCSPs will experience further enhancement of their immune resistance.

[0045] As used herein, the terms “(immune resistance) increase,” “enhancement,” or “enhancement” can mean an increase of at least 10% relative to a reference level (e.g., wild-type plants), such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times relative to a reference level.

[0046] Those skilled in the art will readily understand that the conserved variant polypeptide of SEQ ID NO:1, which has a high degree of homology with the structure of RCSP (GenBank: XAX32969.1), is expected to have similar functions and is expected to confer or enhance plant pathogen / virus immunity.

[0047] There are various ways to implement the overexpression or enhancement of RCSP expression in plants according to the present invention, and these methods can be combined or used in combination. For example, enhancing RCSP gene expression can be achieved by transferring a recombinant plasmid containing the RCSP gene into the plant via Agrobacterium-mediated transformation and / or by cloning a foreign RCSP gene into the plant genome through gene editing technology and / or by placing the RCSP gene in plants that already possess the RCSP gene, such as Nicotiana benthamiana, under the regulation of a strong promoter.

[0048] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0049] When the NLR receptor RCSP is used for plant improvement, it can be easily transferred into plants using traditional Agrobacterium-mediated methods. For this purpose, it is necessary to construct recombinant Agrobacterium strains that express RCSP.

[0050] In this article, the terms "recombinant bacteria (strain)" and "(genetically) engineered bacteria (strain)" have the same meaning, both referring to strains of wild-type Agrobacterium, such as Agrobacterium tumefaciens, that have been genetically modified and contain RCSP overexpression vectors.

[0051] In this document, for the sake of simplicity, the name of a protein, such as the NLR immune receptor protein RCSP, and its encoding gene (DNA), RCSP, are sometimes used interchangeably. Those skilled in the art should understand that they represent different types of substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the function or class of NLR receptors, RCSP refers to the protein; when used as a gene description, it refers to the gene encoding that protein.

[0052] It should be understood that the polypeptides used in the present invention are not limited to RCSP (GenBank:XAX32969.1) with the amino acid sequence SEQ ID NO:1, but also include other plant-derived NLR immune receptors. These isoform NLR receptors can be mutants formed by mutating one or more amino acid residues of polypeptide SEQ ID NO:1.

[0053] The term "mutation" includes, but is not limited to, the substitution, deletion, insertion, or chemical modification of amino acid residues, preferably a positive mutation, i.e., a mutation that increases enzyme activity. The substitution can be a non-conservative substitution, a conserved substitution, or a combination of both. A "conservative" amino acid substitution or mutation refers to the interchangeability of residues with similar side chains, and therefore generally includes the substitution of amino acids in a polypeptide with amino acids from the same or similar amino acid definition class. However, as used herein, if a conserved mutation can alternatively be an aliphatic to aliphatic, nonpolar to nonpolar, polar to polar, acidic to acidic, basic to basic, aromatic to aromatic, or restriction residue to restriction residue substitution, then a conserved mutation does not include hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing, or small residue to small residue substitution. As is known in this technical field, common examples of conservative substitutions include: substitutions between aromatic amino acids F, W, and Y; substitutions between hydrophobic amino acids L, I, and V; substitutions between polar amino acids Q and N; substitutions between basic amino acids K, R, and H; substitutions between acidic amino acids D and E; and substitutions between hydroxyl amino acids S and T. Furthermore, A, V, L, or I can be conservatively mutated to another aliphatic residue or another nonpolar residue. Exemplary conservative substitutions include:

[0054]

[0055]

[0056] "Non-conservative substitution" refers to the substitution or mutation of an amino acid in a polypeptide with an amino acid having significantly different side chain properties. Non-conservative substitution can be performed between, rather than within, the amino acids defined above. In one embodiment, a non-conservative mutation affects (a) the structure of the peptide backbone in the substituted region (e.g., proline replacing glycine), (b) charge or hydrophobicity, or (c) side chain volume.

[0057] "Deletion" refers to a modification of a peptide by removing one or more amino acids from a reference peptide. Deletion can include the removal of one or more amino acids, two or more amino acids, five or more amino acids, ten or more amino acids, fifteen or more amino acids, or twenty or more amino acids, up to 10% of the total number of amino acids constituting the reference enzyme, while preserving enzyme activity and / or the modified properties of the engineered aldolase. Deletion can target the interior and / or ends of the peptide. In several embodiments, the deletion can comprise a continuous segment or can be discontinuous.

[0058] "Insertion" refers to a modification of a polypeptide by adding one or more amino acids to a reference polypeptide. In some embodiments, modified engineered aldolases include inserting one or more amino acids into a naturally occurring aldolase and inserting one or more amino acids into other modified aldolase polypeptides. The insertion can be internal to the polypeptide, or at the carboxyl terminus or amino terminus. Insertions as used herein include fusion proteins as known in the art. The insertion can be a continuous amino acid segment or separated by one or more amino acids in a naturally occurring polypeptide.

[0059] To achieve overexpression of the RCSP (GenBank: XAX32969.1) gene in plants, the RCSP encoding gene (SEQ ID NO:2) can be artificially synthesized or cloned using Nicotiana benthamiana genomic DNA as a template via PCR. This gene can then be used as a foreign gene to construct a gene expression cassette or expression construct. The expression cassette / expression construct can be operatively linked to a plasmid vector suitable for expression in plants and Agrobacterium tumefaciens through subcloning to obtain a recombinant plasmid. The recombinant plasmid can then be transformed into plant cells to finally obtain transgenic plants overexpressing RCSP.

[0060] As used herein, the term "expression cassette" or "gene expression cassette" refers to a gene expression system containing all the necessary elements required to express the target gene RCSP gene. Typically, it includes the following elements: a promoter such as the 35S promoter, an RCSP gene sequence fragment, and a terminator; additionally, it may optionally include a signal peptide coding sequence, etc.; these elements are operatively linked.

[0061] As used herein, an "expression construct" or "expression building block" refers to a recombinant DNA molecule containing one or more intended RCSP gene sequences, which may contain one or more gene expression cassettes. The "construct" is typically contained within an expression vector (plasmid vector).

[0062] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) from different sources and a host cell. For example, if the combination of nucleic acid and host cell is not normally naturally occurring, then the nucleic acid is exogenous to that host cell. A particular sequence is "exogenous" to the cell or organism in which it is inserted.

[0063] As used herein, “operationally linked” or “operationally connected” refers to a functional spatial arrangement of two or more nucleic acid regions or sequences. For example, a promoter region is placed at a specific position relative to the nucleic acid sequence of a target gene, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby “operationally linked” to the nucleic acid sequence.

[0064] In another specific embodiment, a gene knock-in vector can also be used to integrate the polynucleotide sequence of the RCSP-encoding gene described herein, such as SEQ ID NO:2, into the region of interest in the genome. Typically, in addition to the polynucleotide sequence described herein, the gene knock-in vector may also contain a 5' homologous arm and a 3' homologous arm required for genomic homologous recombination. In some embodiments, the nucleic acid constructs described herein contain a 5' homologous arm, the polynucleotide sequence described herein, and a 3' homologous arm. When using a gene knock-in vector, CRISPR / Cas9 technology can be used simultaneously to homologously recombine the polynucleotide sequence into the site of interest. CRISPR / Cas9 technology guides the Cas9 nuclease to modify the genome at the insertion site by designing guide RNAs targeting the target gene, resulting in increased homologous recombination efficiency in the modified gene region, thus homologously recombinating the target fragment contained in the gene knock-in vector into the target site. The steps of CRISPR / Cas9 technology and the reagents used, such as the Cas9 nuclease, are well known in the art.

[0065] In the embodiments of this invention, the NLR receptor function of the RCSP gene was verified using Nicotiana benthamiana as a plant sample. After knocking out RCSP, Nicotiana benthamiana could not recognize the insect effector protein CSP; however, co-expression of RCSP and CSP proteins could activate the ETI immune response of Nicotiana benthamiana.

[0066] The advantages of using RCSP as the NLR receptor in this invention are as follows: 1. Many piercing-sucking insects, such as aphids and brown planthoppers, secrete conserved salivary proteins CSPs. CSPs are highly conserved among different piercing-sucking insects, and their evolutionary rate is very slow. Therefore, the immune resistance conferred by RCSPs on plants is more durable. 2. The systemic acquired resistance produced by general NLR genes is very weak, while after RCSP recognizes CSPs, in addition to activating ETI, it can also produce strong systemic resistance, enabling plants to resist many kinds of pathogens and viruses.

[0067] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0068] Example

[0069] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0070] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0071] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0072] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0073] The primer synthesis and gene sequencing in this embodiment were commissioned to Beijing Qingke Biotechnology Co., Ltd.

[0074] Table 1. Some primers used in the recombinant plasmids and gene knockout CRISPR-Cas9 plasmids in the construction examples.

[0075]

[0076]

[0077] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0078] Example 1: Cell death and dwarfism induced by NlCSP11 in tobacco depended on EDS1 and NRG1

[0079] 1.1 Construction of the pEarlyGate-HA recombinant vector expressing NlCSP11

[0080] 1.1.1 Extraction of total RNA from brown planthoppers

[0081] To inactivate RNase, pipette tips, centrifuge tubes, etc., are soaked in chloroform for about 10 minutes, placed in wide-mouth glass bottles or pipette tip boxes, sterilized at 121°C for 20 minutes, and dried in an oven for later use. Mortars, mortars, spoons, and tweezers are soaked in chloroform for more than 20 minutes.

[0082] 1. Add 1 ml of RNAiso Plus (TAKARA, catalog number T9180) to a 1.5 ml centrifuge tube, then add 10 brown planthoppers, grind with an electric grinder, and incubate at room temperature for 5 min.

[0083] 2. Add 200 μl of chloroform (1 / 5 volume), shake to mix, and let stand at room temperature for 5 min.

[0084] Centrifuge at 3-4℃, 12000g for 15 minutes. The liquid will separate into 3 layers, with RNA in the upper aqueous phase.

[0085] 4. Pipette 400-500 μl of the upper aqueous phase into a new 1.5 ml centrifuge tube, add 2 times the volume of anhydrous ethanol, shake to mix, and incubate at -20°C for at least 40 min.

[0086] 5. Centrifuge at 12000g for 10 minutes at 4℃ to precipitate RNA.

[0087] 6. Discard the supernatant, add 1 ml of 75% ethanol (first add 750 μl of anhydrous ethanol, then add 250 μl of RNase-free water) to wash the RNA precipitate, and centrifuge at 1000 g for 10 min at 4 °C.

[0088] 7. Discard the supernatant, centrifuge for 10 seconds, then remove the residual liquid, place on a clean bench for 5-10 minutes until the ethanol evaporates, and add 30 μl of RNase-free water to dissolve.

[0089] 8. Take 2 μl of sample for electrophoresis to detect RNA quality and concentration, and then take 1 μl to determine RNA concentration using a Nanodrop 2000C spectrophotometer. The remaining RNA sample can be used for reverse transcription or stored at -80℃ for later use.

[0090] 1.1.2 Reverse transcription of RNA

[0091] Reverse transcription of RNA was performed according to the instructions for the PrimeScript RT reagent Kit with gDNA Eraser (TAKARA, catalog number RR047A).

[0092] 1. Removal of gDNA from RNA samples. First, adjust the RNA concentration to 1 μg / μl, then prepare the following reaction system:

[0093]

[0094] 2. Shake well, place in a PCR instrument, incubate at 42°C for 2 minutes, and store on ice.

[0095] 3. cDNA synthesis. Prepare the following reaction system:

[0096]

[0097] 4. Add the prepared mixture to the reaction product from the previous step, vortex to mix, and place in a PCR instrument. Incubate at 37°C for 15 min; then at 85°C for 5 s.

[0098] 1.1.3 Cloning of the NlCSP11 encoding gene

[0099] Primers were designed based on the NlCSP11 sequence with the signal peptide removed. PCR amplification was performed using 2×Phanta Max Master Mix (Vazyme, P515-01), and then ligated into the pDONR207 vector using the ClonExpress Ultra OneStep Cloning Kit (Vazyme, C115-02). After sequencing, the most common NlCSP11 sequence type was selected as the template.

[0100] The NlCSP11 one-step cloning primers are as follows:

[0101] pDONR-xxh-R:GAAGCCTGCTTTTTTGTACAAAGTTGG

[0102] pDONR-xxh-F:GACCCAGCTTTCTTGTACAAAGTTGG

[0103] NlCSP11-F:tacaaaaaagcaggcttcATGGAGCCATCATACCCCAC

[0104] NlCSP11-R: gtacaagaaagctgggtcAATTTGGTATTCCTTTCTCGTAT

[0105] 1.1.4 Ligation of EarlyGate-NlCSP11-HA vector

[0106] Using the pDONR207-NlCSP11 vector as a template, NlCSP11 was ligated into the pEarlyGate-HA vector via the Gateway LR clonase enzyme mix (Invitrogen, 11791019) through the LR reaction.

[0107] LR reaction procedure:

[0108] pDONR207-NlCSP11 2μl

[0109] pEarlyGate-HA 2μl

[0110] LR clonase enzyme mix 1μl

[0111] After the above steps, the pEarlyGate-HA recombinant vector pEarlyGate-NlCSP11-HA, which overexpresses NlCSP11 with the 35S promoter, was constructed.

[0112] 1.2 The pEarlyGate-NlCSP11-HA recombinant vector constructed above was electroporated into GV3101 Agrobacterium competent cells. NlCSP11 was then transiently expressed in tobacco, including the following steps:

[0113] (1) First, electroporate the recombinant vector pEarlyGate-NlCSP11-HA to Agrobacterium GV3101 competent cells, pick a single colony, inoculate it into 3 ml of LB medium containing antibiotics, and incubate at 28°C and 220 rpm for about 24 hours.

[0114] (2) Centrifuge at 10000g for 1 min and discard the supernatant. Adjust the bacterial concentration to OD using MES buffer (10mM MES, 10mM MgCl2, 150mM acetylsuccine). 600 =0.4, placed at 28℃ for 1-3 hours.

[0115] (3) Select three suitable leaves from the upper part of the tobacco plant that have grown for about 4 weeks for injection. Observe the cell death phenotype of the leaves 2-7 days after injection. Observe the dwarf phenotype of the whole tobacco plant 15 days after injection.

[0116] The tobacco mutants eds1, nrg1, adr1, and nrg1-adr1 are important materials for studying the TNL signaling pathway in plants (Schultink et al., 2017; Qi et al., 2018; Wang et al., 2024; Prautsch et al., 2023). Among them, the mutant tobacco eds1, compared to WT, has the following characteristics: the EDS1 gene is knocked out in wild-type tobacco, and the TNL-mediated ETI signaling pathway is completely suppressed. The mutant tobacco nrg1, compared to WT, has the following characteristics: the NRG1 gene is knocked out in wild-type tobacco, and the TNL-mediated ETI signaling pathway is largely suppressed. The mutant tobacco adr1, compared to WT, has the following characteristics: the ADR1 gene is knocked out in wild-type tobacco, and the TNL-mediated ETI signaling pathway is weakly suppressed. Compared with wild-type tobacco, mutant tobacco nrg1-adr1 has the following characteristics: NRG1 and ADR1 genes are knocked out in wild-type tobacco, and the TNL-mediated ETI signaling pathway is completely suppressed.

[0117] By transiently expressing NlCSP11 in wild-type (WT) and four mutant tobaccos (eds1, nrg1, adr1, and nrg1-adr1), NlCSP11 was found to induce weak cell death and overall dwarfism in WT and adr1 mutant tobaccos. The mutants eds1, nrg1, and nrg1-adr1 completely eliminated the cell death and dwarfism induced by 35S-NlCSP11 (see [link to article]). Figure 1Experimental results showing that NlCSP11-activated cell death and dwarfism are dependent on EDS1 and NRG1 suggest that NlCSP11 may be recognized by TNL in tobacco.

[0118] Example 2: CSP induces resistance in tobacco to TMV virus and Pseudomonas syringae.

[0119] To test the local resistance to the virus induced by CSP in tobacco, we transiently expressed the recombinant vector pEarlyGate-NlCSP11 together with tobacco mosaic virus (TMV-GFP) carrying the GFP gene in tobacco. The experimental procedures for TMV resistance included:

[0120] (1) To determine the local resistance of tobacco to TMV virus, NlCSP11, XopQ and LUC(OD) were expressed transiently through Agrobacterium-mediated transmissibility. 600 =0.4) and TMV-GFP reporter gene (OD) respectively 600 =0.01) was co-expressed in tobacco. Four days later, images were taken under long-wave ultraviolet light to observe the expression of TMV-GFP.

[0121] (2) To determine the systemic resistance of tobacco to TMV virus, NlCSP11, XopQ or LUC were transiently expressed in local leaves for 12 days, and then the TMV-GFP reporter gene was injected into the terminal leaves. Four days after the TMV-GFP reporter gene injection, photographs were taken under long-wave ultraviolet light to observe the expression of TMV-GFP.

[0122] The results showed that the NLR receptor in tobacco, upon recognizing NlCSP11 and XopQ, activates the immune response in tobacco, producing resistance to TMV virus, and GFP fluorescence disappears (see [link to original text]). Figure 2 However, when pEarlyGate-NlCSP11 and TMV-GFP are co-expressed in the eds1 mutant, strong GFP fluorescence can be observed under long-wave ultraviolet light. Figure 2 This indicates that NlCSP11-induced local resistance to TMV in tobacco is dependent on EDS1.

[0123] To test the systemic resistance to the virus induced by CSP in tobacco, this invention transiently expressed NlCSP11, XopQ, and LUC (luciferase) in localized tobacco leaves. Twelve days later, TMV-GFP was injected into the terminal leaves. Compared to injections of LUC and XopQ, GFP fluorescence in the terminal leaves of WT tobacco injected with NlCSP11 was significantly reduced (see [link to original text]). Figure 3 Conversely, injection of NlCSP11 into the eds1 mutant resulted in strong GFP fluorescence. Figure 3This indicates that NlCSP11 induces strong systemic resistance to TMV viruses in tobacco in an EDS1-dependent manner.

[0124] Next, we tested whether CSP affected tobacco's resistance to bacteria. In the local resistance experiment, the bacterial titer of Pst DC3000ΔhopQ1-1 in GFP-injected WT tobacco (GFP / WT) was more than 10 times higher than that in tobacco injected with NlCSP11 and XopQ. The Pseudomonas syringae DC3000 resistance experiment included the following steps:

[0125] (1) For the bacterial resistance test, Pst DC3000ΔhopQ1-1 was suspended in a 10 mM MgCl2 solution (OD). 600 =0.0005), and then injected into tobacco leaves.

[0126] (2) Three days later, four leaf discs (1 cm in diameter) were taken from the inoculated leaves and the leaf discs were ground with metal beads in sterile water for 1 minute using a tissue lyser.

[0127] (3) Dilute the bacterial culture in the EP tubes in a 10-fold gradient, making 6 dilutions, and spread them on KB medium containing appropriate antibiotics.

[0128] (4) The cells were then incubated at 28°C for 36 hours, and colony counting was performed. Bacterial titers from 8 independent experiments were collected for statistical analysis.

[0129]

[0130] The results showed that NlCSP11 expression could enhance tobacco resistance to Pst DC3000ΔhopQ1-1 (see [link to study]). Figure 4 Furthermore, the eds1 mutant injected with NlCSP11 (NlCSP11 / eds1) had approximately 1000 times higher bacterial titers than WT tobacco injected with NlCSP11 (NlCSP11 / WT). Figure 4 These results indicate that the local immunity induced by NlCSP11 is dependent on EDS1.

[0131] In systemic resistance tests against bacteria, the bacterial titer in GFP-injected WT tobacco (GFP / WT) was approximately 10 times higher than that in NlCSP11-injected WT tobacco (NlCSP11 / WT), but less than 2 times higher than that in XopQ / WT (see [link to relevant documentation]). Figure 5This indicates that NlCSP11 exhibits stronger systemic resistance to Pst DC3000ΔhopQ1-1 than XopQ. Similarly, the bacterial titer in the NlCSP11-injected eds1 mutant (NlCSP11 / eds1) was approximately 200 times higher than that in NlCSP11-injected WT tobacco (NlCSP11 / WT). Figure 5 This means that NlCSP11 induces strong systemic resistance in tobacco through the EDS1 pathway.

[0132] Example 3: NLR receptor RCSP in tobacco can recognize CSP

[0133] To verify the recognition of CSP by RCSP, we obtained RCSP knockout lines in tobacco using CRISPR-Cas9 knockout technology. A total of six CRISPR-Cas9 knockout lines were obtained. Figure 6 The target sites for two RCSP double knockouts are shown. RCSPs encode the TIR-NBS-LRR-CJID protein. The CRISPR-Cas9 knockout experiment included the following steps:

[0134] 3.1 CRISPR-Cas9 knockout experiment:

[0135] (1) An RCSP knockout target was designed using the website http: / / crispr.hzau.edu.cn / CRISPR2 / :

[0136] 241-fw:AAAATTATGCATCTTCCTGT TGG

[0137] 153-fw: GCTGGATTTCGGACGTTCAA AGG

[0138] (2) Design the following primers to amplify the sgRNA containing CRISPR-Cas9 and the DNA fragment containing the knockout target:

[0139] RCSP_sgRNA1-F:

[0140] ATATATGGTCTCGATTGCTGGATTTCGGACGTTCAAGTTTTAGAGCTAGAA ATAGC;

[0141] RCSP_sgRNA2-R:

[0142] ATTATTGGTCTCGAAACACAGGAAGATGCATAATTTCAATCTCTTAGTCGA CTCTAC.

[0143] (3) PCR amplification and ligation: PCR amplification was performed using pCBC-DT1T2 (Chl chloramphenicol resistant) as a template. The DNA fragment was ligated into the pKSE401-35S-GFP vector using the following enzyme digestion-ligation system:

[0144]

[0145]

[0146] (4) Take 5 μl to transform competent E. coli cells, screen with Kan plate, and identify positive results by sequencing with U626-IDF primers.

[0147] U626-IDF_CX: TGTCCCAGGATTAGAATGATTAGGC.

[0148] (5) The constructed CRISPR knockout vector pKSE401-RCSP was sent to Wuhan Tianwen Biotechnology Co., Ltd. for tobacco transgenic experiments.

[0149] The results showed that WT tobacco could recognize NlCSP11 and induce cell death, but knockout of RCSP eliminated this recognition (see [link to study]). Figure 7 When RCSP and NlCSP11 are co-expressed in rscp mutant plants, cell death can occur, but not in eds1 mutant plants. Figure 7 Furthermore, the dwarfism of NlCSP11 in rscp mutants was completely eliminated (see...). Figure 8 These genetic complementation experiments indicate that RCSP is involved in the recognition of NlCSP11.

[0150] Furthermore, when the CSP protein MP10 from aphids is co-expressed with RCSP in rscp mutant plants, it can also activate RCSP to induce cell death (see [link to relevant documentation]). Figure 9 This indicates that RCSP can recognize MP10. Furthermore, when RCSP and five NlCSP family members (NlCSP1, NlCSP2, NlCSP4, NlCSP5, and NlCSP8) that can induce a dwarf phenotype in tobacco are co-expressed in rscp mutant tobacco, RCSP can also activate cell death (see [link to original text]). Figure 10 This evidence suggests that RCSP can identify a wide variety of different CSPs.

[0151] Example 4: RCSP and CSP Interaction

[0152] To confirm the interaction between RCSP and NlCSP11, BiFC experiments were conducted in *Tobacco Benedict* leaves. NlCSP11 and RCSP were fused with nYFP and cYFP tags, respectively. The experiments included the following steps:

[0153] 4.1 Construction of the recombinant vector overexpressing NlCSP11 with the fused nYFP tag

[0154] The steps for extracting total RNA from brown planthopper cells, reverse transcribing to synthesize cDNA, and cloning the NlCSP11 encoding gene were the same as in Example 1.

[0155] Ligation of the pErleyGate100-NlCSP11-nYFP vector:

[0156] First, PCR was performed using 2×Phanta Max Master Mix (Vazyme, P515-01) to amplify the DNA fragments NlCSP11 and nYFP. The pErleyGate100 vector was then linearized by PCR. Finally, the two fragments were recombinated and ligated into the pEarlyGate100 vector using the ClonExpress Ultra One Step Cloning Kit (Vazyme, C115-02).

[0157] The primers for one-step cloning and construction of the pErleyGate100-NlCSP11-nYFP vector are as follows:

[0158] pEarlyGate100-xxh-R:CTTGTGATCTCGAGCGTGTCCTCTCC

[0159] pEarlyGate100-xxh-F:GTGGTGCCTAGGTGAGTCTAGAGAG

[0160] NlCSP11-100-F: GACACGctcgagATCACAAGATGGAGCCATCATACCCCACG

[0161] NlCSP11-nYFP-R:

[0162] CAGCTCCTCGCCCTTGCTCACACTCCCACCTCCACCAATTTGGTATTCCTTCTC GT

[0163] nYFP-F:GTGAGCAAGGGCGAGGAGCTG

[0164] nYFP-100-R:CTAGACTCACCTAGGCACCACGGCCATGATATAGACGTTGTG

[0165] One-step cloning system (50℃ for 20 min):

[0166]

[0167] After the above steps, the NlCSP11 overexpression recombinant vector pErleyGate100-NlCSP11-nYFP containing the nYFP tag was constructed.

[0168] The pErleyGate100-NlCSP11-nYFP recombinant vector constructed above was electroporated into GV3101 Agrobacterium competent cells to obtain the corresponding Agrobacterium transformants.

[0169] 4.2 Construction of RCSP overexpression recombinant vectors fused with cYFP or FLAG tags

[0170] Total RNA was extracted from the leaves of *Benzia benthamiana* using the SteadyPure Plant RNA Extraction Kit (Aikerui Biotechnology, catalog number AG21019), and then reverse transcribed into cDNA using the Evo M-MLV Plus cDNA Synthesis Kit (Aikerui Biotechnology, catalog number AG11615). The RNA extraction and cDNA synthesis procedures were performed according to the kit instructions.

[0171] Using tobacco cDNA as a template, PCR was first performed using 2×Phanta Max Master Mix (Vazyme, P515-01) to amplify the RCSP DNA fragment. The pCAMBIA1300-cYFP and pCAMBIA1300-FLAG vectors were then linearized by PCR. Finally, the RCSP was ligated into the pCAMBIA1300-cYFP and pCAMBIA1300-FLAG vectors using the ClonExpress Ultra One Step Cloning Kit (Vazyme, C115-02) (the one-step cloning procedure is the same as in 4.1).

[0172] The primers for one-step cloning and construction of the pCAMBIA1300-FLAG vector are as follows:

[0173] pCAMBIA1300-xxh-F:ACCCGGGGATCCACTAGTGATTATAAG

[0174] pCAMBIA1300-xxh-R:ACCctgttaatcagaaaaactcagattaatc

[0175] RCSP_1300-F:gtttttctgattaacagggtATGGCCACAAAACAAGATTATG

[0176] RCSP_1300-R:tcactagtggatccccgggtAGTGCAAATATAGTAAGTACG

[0177] The primers for one-step cloning and construction of the pCAMBIA1300-cYFP vector are as follows:

[0178] RCSP_1300-F:gtttttctgattaacagggtATGGCCACAAAACAAGATTATG

[0179] RCSP-cYFP-R:

[0180] GCCGTTCTTCTGCTTGTCACTCCCACCTCCACCAGTGCAAATATAGTAAGTAC

[0181] cYFP-F:GACAAGCAGAAGAACGGCATC

[0182] cYFP-1300-R:TCACTAGTGGATCCCCGGGTCTTGTACAGCTCGTCCATGCCG

[0183] After the above steps, the RCSP overexpression recombinant vectors pCAMBIA1300-RCSP-cYFP and pCAMBIA1300-RCSP-FLAG containing cYFP or FLAG tags were constructed.

[0184] The pCAMBIA1300-RCSP-cYFP and pCAMBIA1300-RCSP-FLAG recombinant vectors constructed above were electroporated into GV3101 Agrobacterium competent cells to obtain the corresponding Agrobacterium transformants.

[0185] 4.3 BiFC Experiment:

[0186] (1) Agrobacterium carrying the vectors pErleyGate101-NlCSP11-nYFP and pCAMBIA1300-RCSP-cYFP was injected into tobacco leaves, with pErleyGate101-NlCSP11-RKK-nYFP (R22A / K29A / K34A) serving as a negative control.

[0187] (2) The YFP signal was detected 3 days later, and the image was taken using a Zeiss LSM880 laser scanning confocal microscope under 514nm excitation light.

[0188] 4.4 Co-IP Experiment

[0189] (1) The recombinant vectors pCAMBIA1300-RCSP-FLAG and pEarlyGate-NlCSP11-HA were co-expressed in tobacco by Agrobacterium transient transformation.

[0190] (2) Three days later, the leaves were sampled and ground in liquid nitrogen. 1 ml of Co-IP buffer was added to 300 mg of leaf tissue and incubated at 4°C for 1 hour.

[0191] (3) The sample was then centrifuged at 4°C and 20,000g for 20 minutes, and this process was repeated twice to obtain the protein extract from the supernatant. A portion of the protein was then added to protein loading buffer for denaturation to obtain the input protein.

[0192] (4) After washing the α-FLAG agarose beads (Sigma, Cat. A2220) three times, add them to the total protein extract. Then incubate the total protein extract and α-FLAG agarose beads at 4°C for 3 hours.

[0193] (5) Centrifuge at 4℃ and 250g for 1 minute to collect agarose beads, and wash with Co-IP buffer three times to remove impurities. Add protein loading buffer to denature and obtain IP protein.

[0194] (6) Western blot analysis was performed on immunoprecipitated proteins and input proteins using anti-FLAG and anti-HA antibodies, respectively.

[0195] Co-IP buffer: 20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 2 mM DTT, 1% Triton X-100 and a mixture of protease inhibitors (Roche, Cat. 04693116001).

[0196] The results show that RCSP and NlCSP11 interact (see [link to relevant documentation]). Figure 11 Furthermore, we used Co-IP to verify the interaction between RCSP and NlCSP11. NlCSP11-HA could be co-precipitated with RCSP-FLAG, but the NlCSP11-RKK-HA(R22A / K29A / K34A) mutant could not (see [link to Co-IP]). Figure 12 ).

[0197] AlphaFold2 predictions further confirm the interaction between RCSP and NlCSP11. The RCSP-NlCSP11 complex predicted by AlphaFold2 is shown in both cartoon and surface modes (see [link]). Figure 13 ).

[0198] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

[0199] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be construed as an admission that such documents are prior art or common general knowledge.

[0200] References

[0201] Atamian,HS,Chaudhary,R.,Cin,VD,Bao,E.,Girke,T.,and Kaloshian,I.(2013).In planta expression or delivery of potato aphid Macrosiphumeuphorbiae effectors Me10 and Me23 enhances aphid fecundity.Mol.Plant MicrobeInteract.26:67-74.

[0202] Bos,JI,Prince,D.,Pitino,M.,Maffei,ME,Win,J.,and Hogenhout,SA(2010).A functional genomics approach identifies candidate effectors from theaphid species Myzus persicae(green peach aphid).Plos Genet.6:e1001216.

[0203] Brault,V.,Uzest,M.,Monsion,B.,Jacquot,E.,and Blanc,S.(2010).Aphids as transport devices for plant viruses.CRBiol.333:524-538.

[0204] Chaudhary,R.,Peng,H.C.,He,J.,MacWilliams,J.,Teixeira,M.,Tsuchiya,T.,Chesnais,Q.,Mudgett,M.B.,and Kaloshian,I.(2019).Aphid effector Me10 interactswith tomato TFT7,a 14-3-3isoforminvolved in aphid resistance.New Phytol.221:1518-1528.

[0205] Dogimont,C.,Chovelon,V.,Pauquet,J.,Boualem,A.,and Bendahmane,A.(2015).The Vat locus encodes for a CC-NBS-LRR protein that confers resistanceto Aphis gossypii infestation and A.gossypii-mediated virus resistance.PlantJ.80:993-1004.

[0206] Du B,Zhang,W.,Liu,B.,Hu,J.,Wei,Z.,Shi,Z.,He,R.,Zhu,L.,Chen,R.,andHan,B.,et al.(2009).Identification and characterization of Bph14,a geneconferring resistance to brown planthopper in rice.Proc.Natl.Acad.Sci.U.S.A.106:22163-22168.

[0207] Guo,J.,Wang,H.,Guan,W.,Guo,Q.,Wang,J.,Yang,J.,Peng,Y.,Shan,J.,Gao,M.,and Shi,S.,et al.(2023).A tripartite rheostat controls self-regulated hostplant resistance to insects.Nature 618:799-807.

[0208] Gupta,and Virendra.(1994).Aphids on the world's crops.Anidentification and information guide.Orient.Insects 35:104.

[0209] Huang,H.J.,Liu,C.W.,Xu,H.J.,Bao,Y.Y.,and Zhang,C.X.(2017).Mucin-likeprotein,a saliva component involved in brown planthopper virulence and hostadaptation.J.Insect Physiol.98:223-230.

[0210] Ji,R.,Ye,W.,Chen,H.,Zeng,J.,Li,H.,Yu,H.,Li,J.,and Lou,Y.(2017).Asalivary endo-beta-1,4-glucanase acts as an effector that enables the brownplanthopper to feed on rice.Plant Physiol.173:1920-1932.

[0211] Liu,X.,Zhou,H.,Zhao,J.,Hua,H.,and He,Y.(2016).Identification of thesecreted watery saliva proteins of the rice brown planthopper,Nilaparvatalugens(Stal)by transcriptome and shotgun LC-MS / MS approach.J.InsectPhysiol.89:60-69.

[0212] Miles,P.W.(1999).Aphid saliva.Biol.Rev.Camb.Philos.Soc.74:41-85.

[0213] Milligan,S.J.,Yaghoobi,J.,Kaloshian,I.,Zabel,P.,and Williamson,V.M.(1998).The root knot nematode resistance gene Mi from tomato is a member ofthe leucine zipper,nucleotide binding,leucine-rich repeat family of plantgenes.Plant Cell 10:1307-1319.

[0214] Naessens,E.,Dubreuil,G.,Giordanengo,P.,Baron OL,Minet-Kebdani,N.,Keller,H.,and Coustau,C.(2015).A secreted MIF cytokine enables aphid feedingand represses plant immune responses.Curr.Biol.25:1898-1903.

[0215] Ng,J.C.,and Perry,K.L.(2004).Transmission of plant viruses by aphidvectors.Mol.Plant Pathol.5:505-511.

[0216] Pollard,D.G.(1973).Plant penetration by feeding aphids(Hemiptera,Aphidoidea):a review.Bull.Entomol.Res.62:631-714.

[0217] Prautsch,J.,Erickson,J.L.,Ozyurek,S.,Gormanns,R.,Franke,L.,Lu,Y.,Marx,J.,Niemeyer,F.,Parker,J.E.,and Stuttmann,J.,et al.(2023).Effector XopQ-induced stromule formation in Nicotiana benthamiana depends on ETI signalingcomponents ADR1 and NRG1.Plant Physiol.191:161-176.

[0218] Qi,T.,Seong,K.,Thomazella,D.,Kim,J.R.,Pham,J.,Seo,E.,Cho,M.J.,Schultink,A.,and Staskawicz,B.J.(2018).NRG1 functions downstream of EDS1 toregulate TIR-NLR-mediated plant immunity in Nicotiana benthamiana.Proc.Natl.Acad.Sci.U.S.A.115:E10979-E10987.

[0219] Rao,W.,Zheng,X.,Liu,B.,Guo,Q.,Guo,J.,Wu,Y.,Shangguan,X.,Wang,H.,Wu,D.,and Wang,Z.,et al.(2019).Secretome analysis and in planta expression ofsalivary proteins identify candidate effectors from the brown planthopperNilaparvata lugens.Mol.Plant Microbe Interact.32:227-239.

[0220] Rodriguez,P.A.,Stam,R.,Warbroek,T.,and Bos,J.I.(2014).Mp10 and Mp42from the aphid species Myzus persicae trigger plant defenses in Nicotianabenthamiana through different activities.Mol.Plant Microbe Interact.27:30-39.

[0221] Rossi,M.,Goggin,F.L.,Milligan,S.B.,Kaloshian,I.,Ullman,D.E.,andWilliamson,V.M.(1998).The nematode resistance gene Mi of tomato confersresistance against the potato aphid.Proc.Natl.Acad.Sci.U.S.A.95:9750-9754.

[0222] Savary,S.,Willocquet,L.,Pethybridge,S.J.,Esker,P.,McRoberts,N.,andNelson,A.(2019).The global burden of pathogens and pests on major foodcrops.Nat.Ecol.Evol.3:430-439.

[0223] Schultink,A.,Qi,T.,Lee,A.,Steinbrenner,A.D.,and Staskawicz,B.(2017).Roq1mediates recognition of the Xanthomonas and Pseudomonas effectorproteins XopQ and HopQ1.Plant J.92:787-795.

[0224] Shangguan,X.,Zhang,J.,Liu,B.,Zhao,Y.,Wang,H.,Wang,Z.,Guo,J.,Rao,W.,Jing,S.,and Guan,W.,et al.(2018).A mucin-like protein of planthopper isrequired for feeding and induces immunity response in plants.PlantPhysiol.176:552-565.

[0225] Wang,H.,Song,S.,Gao,S.,Yu,Q.,Zhang,H.,Cui,X.,Fan,J.,Xin,X.,Liu,Y.,andStaskawicz,B.,et al.(2024).The NLR immune receptor ADR1 and lipase-likeproteins EDS1and PAD4 mediate stomatal immunity in Nicotiana benthamiana andArabidopsis.Plant Cell36:427-446.

[0226] Wang,Y.,Tang,M.,Hao,P.,Yang,Z.,and He,G.(2010).Penetration into ricetissues by brown planthopper and fine structure of the salivarysheaths.Entomol.Exp.Appl.129:295-307.

[0227] Ye,W.,Yu,H.,Jian,Y.,Zeng,J.,Ji,R.,Chen,H.,and Lou,Y.(2017).A salivaryEF-hand calcium-binding protein of the brown planthopper Nilaparvata lugensfunctions as an effector for defense responses in rice.Sci.Rep.7:40498.

[0228] Zhang,Y.,Fu,Y.,Liu,X.,Francis,F.,Fan,J.,Liu,H.,Wang,Q.,Sun,Y.,Zhang,Y.,and Chen,J.(2023).SmCSP4 from aphid saliva stimulates salicylic acid-mediated defence responses in wheat by interacting with transcription factorTaWKRY76.Plant Biotechnol.J.21:2389-2407.

[0229] Zhao,Y.,Huang,J.,Wang,Z.,Jing,S.,and He,G.(2016).Allelic diversity inan NLR gene BPH9 enables rice to combat planthopper variation.Proc.Natl.Acad.Sci.U.S.A.113:201614862。

Claims

1. Use of a polypeptide selected from the group consisting of: (a) a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 1 RCSP (GenBank: XAX32969.1); (b) a conservatively modified variant of (a) derived from the amino acid sequence of SEQ ID NO: 1 by substitution, deletion or addition of one or more amino acid residues, which conservatively modified variant has the function of the polypeptide of (a); (c) a polypeptide derived from (a) having 90% or more identity to the polypeptide sequence defined in (a) and which has the function of the polypeptide of (a); or (d) a polypeptide comprising a sequence of (a) or (b) or (c) in the sequence; or a gene encoding the polypeptide in conferring or enhancing immune resistance in a plant. The nucleotide sequence of the gene encoding the polypeptide RCSP (GenBank: XAX32969.1) having an amino acid sequence as set forth in SEQ ID NO: 1 is SEQ ID NO: 2, or a nucleotide sequence having 90% or more identity to SEQ ID NO:

2. The plant is a crop selected from the group consisting of rice, wheat, maize, soybean, barley, oat, rye, sorghum, cotton, vegetables, tobacco, and Brassicaceae. The method comprises the step of inserting or overexpressing the gene encoding the polypeptide as claimed in claim 1 in the genome of a plant. The method is carried out by:

2. Use according to claim 1, wherein (i) cloning the gene encoding the polypeptide as claimed in claim 1 or 2 in a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, transforming a plant by Agrobacterium-mediated method to obtain a transgenic plant overexpressing the polypeptide; 3. The use according to claim 1, wherein (ii) inserting or overexpressing the gene encoding the polypeptide as claimed in claim 1 or 2 in the genome of a plant by gene editing technology; 4. A method for increasing the resistance of a plant against pathogenic bacteria and / or viruses, characterized in that, (iii) constructing a transgenic plant expressing the polypeptide as claimed in claim 1 or 2, such as RCSP, by plant tissue culture method, constructing a transgenic plant overexpressing the polypeptide as claimed in claim 1 or 2, such as RCSP, by plant flower dipping method, or transferring RCSP into other plants by the method of crossing Nicotiana benthamiana with a relative species; or 5. The method of claim 4, wherein, (iv) placing RCSP (GenBank: XAX32969.1) in the genome of a plant, such as Nicotiana benthamiana, under the control of a functionally enhanced promoter. The gene editing technology is selected from the group consisting of homologous double exchange, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MuGENT. A gene encoding the polypeptide RCSP (GenBank: XAX32969.1) as claimed in claim 2. A DNA molecule as claimed in claim 7. ​ ​ 6. The method of claim 5, wherein, ​ 7. A DNA molecule, characterized in that, ​ 8. A recombinant plasmid, characterized in that, ​ 9. The recombinant plasmid of claim 8, wherein The plasmid vector is selected from the group consisting of pHB-YFP, pHB-FLAG, pBin19, pGreenII0800-LUC, pCAMBIA1300, pCAMBIA1301, pCAMBIA3300, pCAMBIA2301, pBI121, pTF102.

10. A microbially engineered bacterium, characterized in that, It is a transformant comprising the recombinant plasmid as claimed in claim 8 or 9, preferably the microorganism is Agrobacterium. It is a transformant comprising the recombinant plasmid as claimed in claim 8 or 9, preferably the microorganism is Agrobacterium.

Images