Application of SlMBR2 in regulation and control of biosynthesis of carotenoid in tomato fruits

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of SlMBR2 in regulation and control of biosynthesis of carotenoid in tomato fruits. The invention provides application of SlMBR2. Biosynthesis of carotenoid in tomato fruits is regulated and controlled, and the nucleotide sequence of the gene is shown as SEQ ID No: 1. The SlMBR2 is used for negative regulation of biosynthesis of carotenoid in tomato fruits. By editing the tomato SlMBR2 gene, a tomato material with higher carotenoid content in fruits is cultivated, and the tomato SlMBR2 gene has a good application prospect in the aspect of improving the sensory and nutritional quality of tomatoes.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to the application of SlMBR2 in regulating the biosynthesis of carotenoids in tomato fruits. Background Technology

[0002] tomato( Solanum lycopersicum Tomatoes have become one of the most widely cultivated and traded vegetable crops in the world. However, modern breeding focuses excessively on increasing yield and improving stress resistance, often neglecting the systematic optimization of tomato fruit quality. Fruit quality, as a core element affecting consumer choice and market value, is highly dependent on the dynamic accumulation and regulation of pigments such as carotenoids during the ripening process.

[0003] Tomatoes are rich in various bioactive components, including lycopene, beta-carotene, and lutein, which not only give the fruit a rich variety of colors from bright red to golden yellow, significantly enhancing its appearance and market appeal, but also play irreplaceable multiple functions in human health and plant physiology. Lycopene, as the core pigment of ripe fruit, exhibits excellent antioxidant capacity, effectively reducing the risk of cardiovascular disease and inhibiting the development of tumors (such as prostate cancer); beta-carotene is an important precursor to vitamin A, crucial for maintaining healthy vision and strengthening the immune system; lutein specifically protects the eyes, reducing the risk of retinal damage. At the plant level, these three carotenoids are synthesized through the isoprene pathway, participating not only in the photosynthetic protection mechanism and fruit ripening and coloring, but also serving as precursors to plant hormones such as abscisic acid, strigolactones, and volatile flavor compounds, deeply regulating tomato growth, development, flavor formation, and stress resistance, making it a globally recognized healthy crop with nutritional value, sensory quality, and ecological functions.

[0004] E3 ubiquitin ligases, as key regulators in the ubiquitination process, precisely regulate protein stability, subcellular localization, and functional activity by specifically recognizing target proteins and mediating their ubiquitination modification, playing a central role in the regulation of plant secondary metabolism. Related studies have shown that CUL3-RING E3 ubiquitin ligases in Arabidopsis thaliana regulate flavonoid biosynthesis by targeting and degrading the transcription factor WRKY33; in tomatoes, E3 ubiquitin ligases participate in regulating the accumulation of flavonoids and phenolic substances during fruit ripening, thereby affecting the nutritional value and antioxidant capacity of the fruit. However, although carotenoids are the most important pigments and nutrients in tomato fruits, the function of E3 ubiquitin ligases in directly regulating carotenoid biosynthesis in tomatoes has not yet been reported. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide the use of SlMBR2: regulating the biosynthesis of carotenoids in tomato fruit. The nucleotide sequence of this gene is shown in SEQ ID No: 1.

[0006] As an improvement to the application of this invention: SlMBR2 negatively regulates the biosynthesis of carotenoids in tomato fruit.

[0007] As a further improvement to the application of the present invention: SlMBR2 Gene knockout promotes the accumulation of carotenoids in tomato fruits.

[0008] In this invention: genes SlMBR2 The encoded protein has the amino acid sequence shown in SEQ ID NO: 2.

[0009] This invention also provides a plasmid containing the above-mentioned gene and a plant expression vector containing the above-mentioned gene, specifically the overexpression vector E8-pK7WGF2- SlMBR2 .

[0010] The present invention also provides a host cell containing the above-mentioned genes, wherein the host cell is an Escherichia coli cell or an Agrobacterium cell.

[0011] This invention also provides a method for knocking out tomatoes. SlMBR2 The genetic approach includes the following steps: 1) Design the target sgRNA sequence for gene editing using CRISPR / Cas9 technology: 5'-TGGCCAGACATATCATGGGGTGG-3'; 2) Use the sequence obtained in step 1) to synthesize primers and construct them into a CRISPR / Cas9 vector; 3) Genetically transform the vector obtained in step 2) into wild-type tomato varieties to obtain corresponding transgenic plants; identify the knockout strain from the transgenic tomato plants. SlMBR2 Gene-based plants.

[0012] The present invention also provides the use of the above-mentioned gene for constructing a transgenic tomato, wherein the transgenic tomato can increase the content of carotenoids.

[0013] It should be noted that: SlMBR2 The gene encodes an E3 ubiquitin ligase, but its specific function has not been reported prior to the date of this application. Currently known structural genes for the biosynthesis of carotenoids in tomato fruit include... PSY1 , PDS , ZDS , ZISOThe regulatory factors include family transcription factors such as B-box, bHLH, bZIP, WRKY, and AP2 / ERF, but it is unclear whether these genes or patented factors are related to the SlMBR2 of this invention; therefore, the prior art cannot provide technical guidance for this invention.

[0014] This invention is the first to construct a tomato SlMBR2 Transgenic plants with gene overexpression and gene-edited plants were studied, and their functions were investigated. By measuring the carotenoid content in the fruit, it was found that SlMBR2 plays a negative regulatory role in the accumulation of carotenoids in tomato fruit. Further research was conducted on tomato... SlMBR2 Gene editing to cultivate tomato varieties with higher carotenoid content has promising applications in improving the sensory and nutritional quality of tomatoes. Attached Figure Description

[0015] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0016] Figure 1 yes SlMBR2 Gene overexpression vector E8-pK7WGF2- SlMBR2 The carrier spectrum.

[0017] Figure 2 yes SlMBR2 Four typical developmental stages in tomato fruit with gene overexpression SlMBR2 Gene expression levels.

[0018] Figure 3 yes SlMBR2 CRISPR / Cas9 target location and sequencing results of gene-edited lines.

[0019] Figure 4 yes SlMBR2 A comparison of the fruit ripening process of gene-overexpressed and gene-edited lines with that of wild-type tomatoes.

[0020] Figure 5 yes SlMBR2 Carotenoid content in the fruit of gene-overexpressing and gene-edited lines and wild-type tomatoes.

[0021] It should be noted that: MG represents the mature green stage of tomato fruit, B represents the breakaker stage of tomato fruit, P represents the pink stage of tomato fruit, and R represents the red ripe stage of tomato fruit; abcd indicates that the strains are significantly different from the control. p <0.05). Detailed Implementation

[0022] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto: I. Obtaining Tomatoes SlMBR2 Construction of the gene and the overexpression vector for that gene: Primers for bidirectional gene amplification were designed using Primer Premier 6.0. Leaves of wild-type tomato AC (Ailsa Craig) grown in a greenhouse at Zhejiang University's Zijingang Campus were used to extract cDNA from RNA reverse transcribed into a template (cDNA extraction was performed using conventional methods, such as patent CN104561025A). The upstream specific primer was... SlMBR2 -F, downstream primer is SlMBR2 -R, amplified using PrimerSTAR high-fidelity enzyme SlMBR2 Full-length gene, SlMBR2 The nucleotide sequence of the gene is shown in SEQ ID No: 1.

[0023] The primer sequences are: SlMBR2 -F:5'-ATGGGGCACAGAAATTCATTCAACA-3' SlMBR2 -R:5'-TCATTTTTCCTTCAGATCGTCGTCA-3' PCR amplification reaction system: 2×PrimerSTAR buffer 25 μl, dNTP Mixture 5 μl, PrimerSTAR DNA polymerase 1 μl, ddH2O 14 μl, cDNA 2 μl, forward and reverse primers 1.5 μl each, total 50 μl. PCR reaction program: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 90 s, 35 cycles; final extension at 72℃ for 5 min. The amplified full-length gene was ligated into the pQB-V3 vector. The recombinant plasmid was sent to Qingke Company for sequencing to confirm sequence correctness. Then, the target fragment was transferred to the pK7WGF2 final vector using homologous recombination. The constructed overexpression vector was named E8-pK7WGF2- SlMBR2 ( Figure 1 ).

[0024] II. Tomato SlMBR2 Construction of gene knockout CRISPR / Cas9 vector Using online professional software (http: / / crispr.mit.edu / ), in SlMBR2The target sgRNA sequence for CRISPR / Cas9 editing was designed in the gene coding sequence (SEQ ID NO:1): 5'-TGGCCAGACATATCATGGGGTGG-3'; and the corresponding target primer sequences were synthesized at a biotechnology company: 5'-ATTGTGGCCAGACATATCATGGGG-3' and 5'-AAACCCCCATGATATGTCTGGCCA-3'. The target primers were annealed and ligated into the intermediate vector AtU6-26-sgRNA-SK. The plasmid that was PCR-verified and sequenced correctly was extracted, digested with Nhe I and Spe I, and after electrophoresis, the fragment of approximately 642 bp was gel-cleaved and recovered. The recovered fragment is the sgRNA cassette. Then, the sgRNA cassette was ligated into the Spe I-digested pCAMBIA1300-pYAO-Cas9 plasmid. Colony PCR was performed using the primer sequences on the binary vector for identification. Correctly identified single colonies were picked, propagated, and the plasmid was extracted. Restriction enzyme digestion with Sal I and Kpn I was then performed for verification. The resulting plasmid fragment was approximately 670 bp in length. SlMBR2 CRISPR / Cas9 gene editing vector.

[0025] The recovered fragment after double digestion with Nhe I and Spe I, namely the sgRNA cassette sequence (642bp): ACTAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTTAAGCTTCGTTGAACAACGGAAACTCGACTTGCCTTCCGCACAATACATCATTTTCTTCTTAGCTTTTTTTCTTCTTCTTCGTTCATACAGTTTTTTTTTGTTTATCAGCTTACATTTTCTTGAAC CGTAGCTTTCGTTTTCTTCTTTTTAACTTTCCATTCGGAGTTTTTGTATCTTGTTTCATAGTTTGTCCCAGGATTAGAATGATTAGGCATCGAACCTTCAAGAATTTGATTGAATAAAACATCTTCATTCTTAAGATATGAAGATAATCTTCAAAAGGCCC CTGGGAATCTGAAAGAAGAGAAGCAGGCCCATTTATATGGGAAAGAACAATAGTATTTCTTATATAGGCCCATTTAAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTAGTG ATTGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTCCCTTCGAAGGGCCTTTCTCAGATATCCATCACACTGGCGGCCGCTCGAGGCTAG .

[0026] III. Construction and Detection of Transgenic Materials The overexpression vector E8-pK7WGF2- obtained in step one above was used. SlMBR2 The CRISPR / Cas9 gene editing vector obtained in step two above was transformed into Agrobacterium LBA4404 strain. Tomato cotyledons were used as explants and co-cultured with bacterial solution to obtain callus tissue. The callus tissue was processed into differentiation medium and rooting medium to obtain transgenic positive seedlings. The positive transgenic plants were verified by PCR and RT-PCR.

[0027] Overexpressing T2 generation lines meeting a 3:1 segregation ratio and exhibiting high expression levels (overexpression is defined as a 3:1 segregation ratio of long to non-long lateral roots on kanamycin (50 mg / L) medium, with gene expression levels increasing more than twofold) were selected as the research subjects. Figure 2 ). Figure 2In this context, WT represents wild-type tomato AC (Ailsa Craig), and OE-33, OE-61, and OE-62 represent... SlMBR2 Three overexpression lines.

[0028] synthesis SlMBR2 The upstream primer 5'-ATGGGGCACAGAAATTCATTCAACA-3' and the downstream primer 5'-TCATTTTTCCTTCAGATCGTCGTCA-3' were used for gene PCR amplification. Genomic DNA from gene-edited tomato plants and their control variety AC was used as templates, and 2×Taq PCR Master Mix (TIANGEN) was employed. SlMBR2 The gene was amplified by PCR. The PCR amplification system was 20 μl, containing 10 μl of 2×Taq PCR Master Mix, 1 μl each of upstream and downstream primers (10 μM), 1 μl of template DNA (<1 μg), and 7 μl of sterile water. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min.

[0029] After sequencing the PCR products, the sequencing results were compared with the wild-type sequence on the Dsdecode website. If a biallelic mutation occurred in the sequence near the target site, it was considered a successfully gene-edited line; otherwise, the mutations were considered different lines. Three successful knockout sequences were ultimately identified. SlMBR2 Genetic lineage ko1 , ko2 and ko3 (that is, for) Figure 4 , Figure 5 In ko12 , ko22 and ko3 Among the plants of these three strains SlMBR2 The editing scenarios in the gene coding region were deletion of 8 bases, insertion of 1 base, and substitution of 3 bases, respectively. Figure 3 ),make SlMBR2 A frameshift mutation occurs in a gene, resulting in the loss of its function. ko1 , ko2 and ko3 Among the plant strains SlMBR2 The nucleotide and amino acid sequences of a gene are as follows Figure 3 The above, ko1 The amino acid sequence is shown in SEQ ID No: 3. ko2 The amino acid sequence is shown in SEQ ID No: 4. ko3 The amino acid sequence is shown in SEQ ID No: 5.

[0030] IV. Study on Carotenoid Content in Fruits of Transgenic Strains SlMBR2 Gene-overexpressing transgenic lines and gene-edited lines were compared with wild-type tomato fruits at the green-ripe stage (MG). Fruit samples were collected at four different stages: the color-breaking stage (B) when the fruit tip turned red; the pink stage (P) three days after the color-breaking stage; and the red-ripe stage (R) seven days after the color-breaking stage. Figure 4 ).

[0031] A certain amount of fruit tissue was ground, and 0.3 g of fruit powder was weighed in a 10 mL centrifuge tube. Immediately, 6 mL of extraction buffer (n-hexane:acetone:anhydrous ethanol = 1:1:1, v / v / v) was added, and the mixture was shaken at 150 r / min for 30 min. Then, 2 mL of double-distilled water was added to the mixture, and the mixture was centrifuged at 1500 g for 10 min at 4℃. The top 1 mL of liquid was accurately aspirated using a disposable sterile syringe. The centrifuge tube containing the extraction buffer was dried in a vacuum concentrator. When the liquid in the centrifuge tube was almost completely dry, 1 mL of dissolving buffer (tetrahydrofuran:acetonitrile:methanol = 15:30:55, v / v / v) was added and the mixture was thoroughly dissolved. The solution was filtered through a syringe filter (containing an organic nylon 66 membrane) into a 1.5 mL centrifuge tube and transferred to a brown HPLC bottle for HPLC analysis.

[0032] A 20 μl sample was analyzed using a Shimadzu HPLC system (Shimadzu, Kyoto, Japan), including a C18 column (5 μm particle size, 4.6 mm × 250 mm, Elite analytical instruments Co., Ltd., Dalian, China), an autosampler, and an SPD-M20A diode array detector. The mobile phase was methanol:acetonitrile = 90:10, v / v, with 0.05% triethylamine added simultaneously, and the flow rate was 1.2 mL / min. The detection wavelength was 475 nm. The content of lycopene, β-carotene, and lutein was calculated using the external standard method with standards (Sigma, St Louis, MO, USA). Results are expressed in μg / g. -1 FW (fresh weight) is expressed in units of fresh weight.

[0033] SlMBR2 The carotenoid content of gene-overexpressed and gene-edited lines compared to wild-type tomato fruits is as follows: Figure 5 The contents, from top to bottom, are lycopene content, β-carotene content, lutein content, and total carotenoid content. According to... Figure 5 The following conclusions can be drawn: three SlMBR2The lycopene, β-carotene, and total carotenoid content in the fruits of the gene-edited strain were significantly higher than those of the wild type at all stages of fruit development. SlMBR2 The lycopene, β-carotene, and total carotenoid contents of fruits from gene-overexpressing lines were significantly lower than those of wild types at all stages of fruit development. SlMBR2 Gene knockout promotes the accumulation of carotenoids in tomato fruits.

[0034] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. Use of SlMBR2 in regulating carotenoid biosynthesis in tomato fruits, characterized in that: SlMBR2 The nucleotide sequence of the gene is shown in SEQ ID No:

1.

2. Use according to claim 1, characterized in that: SlMBR2 negatively regulates carotenoid biosynthesis in tomato fruits.

3. Use according to claim 1 or 2, characterized in that: SlMBR2 Gene knockout promotes carotenoid accumulation in tomato fruits.

4. Use according to claim 3, characterized in that: Constructing transgenic tomato which can increase the content of carotenoid.

Images