Slow obstructive pulmonary disease marker LSM2 and application thereof in disease screening

Abstract

The invention discloses a chronic obstructive pulmonary disease marker LSM2 and application thereof in disease screening, and belongs to the technical field of disease screening and diagnosis. The invention finds that the LSM2 protein is related to the occurrence of the chronic obstructive pulmonary disease, so that the LSM2 protein can be used as a biomarker for screening the chronic obstructive pulmonary disease. On the basis, the invention provides the kit, the kit accurately judges the early-stage chronic obstructive pulmonary disease by detecting LSM2 protein expression or Lsm2 gene expression quantity in lung tissues of a subject, early discovery and early treatment are realized, and the kit has important significance in controlling disease symptoms and relieving disease progression and clinical outcome.

Description

Technical Field

[0001] This invention belongs to the field of disease screening and diagnosis technology, specifically relating to the application of LSM2, a biomarker for COPD, in disease diagnosis. Background Technology

[0002] Chronic obstructive pulmonary disease (COPD) is a common chronic respiratory disease characterized by irreversible airway obstruction. In my country, over 100 million people suffer from COPD, and its incidence remains high. The gold standard for COPD diagnosis is typically pulmonary function testing, with an FEV1 / FVC ratio <0.7 after bronchodilator use as the diagnostic criterion. However, pulmonary function testing has limitations: firstly, it requires highly skilled physicians, hindering its widespread implementation in primary care hospitals in my country; secondly, routine pulmonary function testing cannot diagnose early-stage COPD patients, and its accuracy in diagnosing airway obstruction in some young people is low. Studies have found that early diagnosis and treatment of COPD can effectively control disease symptoms and mitigate disease progression and clinical outcomes. Therefore, developing screening kits for early-stage COPD is of great significance, enabling early diagnosis and treatment for COPD patients.

[0003] The LSM protein family consists of RNA-binding proteins that play a crucial role in RNA metabolism. Studies have found that the LSM2-8 complex can enhance telomerase activity, protecting telomere stability and thus maintaining cell division. Telomerase typically exhibits high activity in stem cells, germ cells, and tumor cells. Furthermore, research has demonstrated a strong correlation between Lsm2 gene expression and the occurrence and prognosis of malignant tumors such as breast cancer and melanoma. Simultaneously, studies have found a strong correlation between increased Lsm2 expression and lung cancer. All of these studies indicate that the Lsm2 gene is highly associated with cell proliferation.

[0004] This invention creatively discovers that LSM2 protein is associated with the occurrence of COPD, and that LSM2 protein can be used as a biomarker for COPD screening. Based on this research, this invention provides a kit that accurately diagnoses early COPD by detecting the expression of LSM2 protein or the Lsm2 gene in the lung tissue of a subject. Summary of the Invention

[0005] One object of the present invention is to provide the use of LSM2 protein in the preparation and / or screening of products for the diagnosis or auxiliary diagnosis of COPD; a second object of the present invention is to provide the use of a substance for detecting said LSM2 protein in the preparation and / or screening of products for the diagnosis or auxiliary diagnosis of COPD; another object of the present invention is to provide a kit for the diagnosis or auxiliary diagnosis of COPD; and a final object of the present invention is to provide a method for diagnosing COPD not for the purpose of diagnosis or treatment.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] In a first aspect, the present invention provides an application of the biomarker LSM2 in at least one of the following:

[0008] a1) Use in the preparation and / or screening of products for the diagnosis or auxiliary diagnosis of COPD;

[0009] a2) Use in the preparation and / or screening of products for evaluating or assisting in the evaluation of the efficacy of COPD treatment;

[0010] a3) Use in screening or assisting in the screening of drugs for the treatment or adjunctive treatment of COPD;

[0011] a4) Use in screening or assisting in the screening of drugs for inhibiting the progression of COPD.

[0012] The COPD described in this invention includes airway obstruction that cannot be diagnosed as COPD by conventional pulmonary function tests, early COPD, and COPD diagnosed by conventional pulmonary function tests.

[0013] The products described in this invention include, but are not limited to, reagents, kits, chips, test strips, membrane strips, or detection platforms.

[0014] In a second aspect, the present invention provides the use of a substance for detecting LSM2 in at least one of the following:

[0015] b1) Use in the preparation and / or screening of products for the diagnosis or auxiliary diagnosis of COPD;

[0016] b2) Use in the preparation and / or screening of products for evaluating or assisting in the evaluation of the efficacy of COPD treatment;

[0017] b3) Use in screening or assisting in the screening of drugs for the treatment or adjunctive treatment of COPD;

[0018] b4) Use in screening or assisting in the screening of drugs for inhibiting the progression of COPD.

[0019] The substances used to detect LSM2 include any reagents required for detecting LSM2 protein content or gene expression levels using RT PCR (reverse transcription-PCR), RT qPCR (reverse transcription-quantitative PCR), immunohistochemistry, Western blotting, microarray detection, DNA blotting, in situ hybridization, or spatial transcriptomics.

[0020] In some embodiments of the present invention, the substance for detecting LSM2 is a reagent for detecting LSM2 protein using immunohistochemistry. The immunohistochemical technique includes, but is not limited to, immunofluorescence and enzyme-linked immunosorbent assay (ELISA).

[0021] In some embodiments of the present invention, the substance for detecting LSM2 is a reagent for detecting LSM2 protein by immunoblotting.

[0022] In some embodiments of the present invention, the substance used to detect LSM2 is a reagent for detecting the expression level of LSM2 protein-related genes by RT qPCR.

[0023] In a specific embodiment of the present invention, the substance for detecting LSM2 includes reagents capable of detecting LSM2 protein content, or reagents capable of detecting the expression level of nucleic acids related to LSM2 protein. Specifically, the reagents include, but are not limited to, antibodies, peptides, or proteins that specifically bind to LSM2 protein, or nucleic acid molecules that specifically amplify some or all of the genes related to LSM2 protein.

[0024] In one specific embodiment of the present invention, the substance for detecting LSM2 is an antibody that specifically binds to the LSM2 protein. Specifically, the antibody is Novus product number: NBP2-38093.

[0025] In a specific embodiment of the present invention, the substance for detecting LSM2 is a primer pair specifically amplifying the LSM2 gene. Specifically, the primer pair is:

[0026] Nucleotide sequence information (5'-3') Serial Number forward primer CATCTGTGGAACCCTCCATTC SEQ ID NO.1 negative primer GCACGTATCGGACCACTGAG SEQ ID NO.2

[0027] Thirdly, the present invention provides a primer pair, characterized in that the primer pair can specifically amplify the Lsm2 gene, wherein the primer pair is:

[0028] Nucleotide sequence information (5'-3') Serial Number forward primer CATCTGTGGAACCCTCCATTC SEQ ID NO.1 negative primer GCACGTATCGGACCACTGAG SEQ ID NO.2

[0029] Fourthly, the present invention provides a kit, characterized in that the kit includes reagents for detecting LSM2 protein content or reagents for detecting the expression level of nucleic acids related to LSM2 protein.

[0030] Preferably, the reagents include, but are not limited to, antibodies, peptides or proteins that specifically bind to the LSM2 protein, or nucleic acid molecules that specifically amplify some or all of the genes related to the LSM2 protein.

[0031] In one embodiment of the invention, the kit includes an antibody that specifically binds to the LSM2 protein.

[0032] Further, the antibody is a fluorescently labeled antibody or an enzyme-labeled antibody. The fluorescently labeled antibody is selected from FITC, FAM, CY3, CY5, JOE, and ROX. The enzyme label is selected from horseradish peroxidase (HRP), alkaline phosphatase (ALP), and β-galactosidase (β-Gal).

[0033] Furthermore, the kit also includes other conventional reagents required for immunohistochemical or immunoblotting detection techniques, including but not limited to chemiluminescent solutions, chromogenic solutions, and enzyme-labeled secondary antibodies.

[0034] In another embodiment of the invention, the kit includes the primer pair described in the third aspect of the invention.

[0035] Furthermore, the kit also includes other conventional reagents based on RT qPCR detection technology, including but not limited to reverse transcriptase, DNA polymerase, dNTPs, MgCl2, and buffer.

[0036] Fifthly, the present invention provides a method for detecting the biomarker LSM2 not for diagnostic or therapeutic purposes, the method comprising the following steps:

[0037] 1) Obtain the biological sample to be tested;

[0038] 2) Add an antibody that specifically binds to the LSM2 protein, or the antibody labeled with a fluorescent group or enzyme, incubate, and detect the LSM2 protein content according to conventional immunohistochemistry or Western blotting techniques; or,

[0039] RNA was extracted from the biological sample to be tested, and cDNA was obtained by reverse transcription. The primer pair described in the third aspect of this invention was added for PCR amplification, and the relative change in the expression level of the Lsm2 gene was calculated.

[0040] The samples to be tested in this invention are selected from lung tissue and human bronchial epithelial cells.

[0041] The contribution of the technical solution provided by this invention to the field is as follows:

[0042] This invention, through the construction of a mouse model of COPD, revealed that compared with healthy mice, the expression levels of LSM2 protein and Lsm2 gene in the lung tissue of COPD mice were significantly increased. In cell experiments, stimulation of human bronchial epithelial cells with cigarette smoke extract (CSE) showed that CSE stimulation increased the expression level of the Lsm2 encoding gene in a concentration-time dependent manner. These basic experimental results demonstrate for the first time that LSM2 is associated with the occurrence of COPD, and LSM2 can serve as a biomarker for the diagnosis and screening of drugs for COPD treatment.

[0043] Based on the above fundamental experiments, the inventors have creatively proposed a kit for early screening of COPD. This kit contains antibodies for detecting LSM2 protein and / or primers for specifically amplifying the Lsm2 gene. The kit provided by this invention enables early diagnosis of COPD in patients or high-risk groups by detecting the levels of LSM2 protein and Lsm2 gene expression in the lung tissue of the subjects. It is particularly useful for some young patients with airway obstruction, allowing detection in early stages where conventional pulmonary function tests cannot diagnose the condition. This facilitates early diagnosis and treatment of COPD, which is of great significance for controlling disease symptoms, mitigating disease progression, and improving clinical outcomes. Attached Figure Description

[0044] Figure 1 Immunohistochemical staining results of LSM2 protein in lung tissue sections of COPD mice; WT: wild-type mice; WT_CS: wild-type cigarette smoke mice.

[0045] Figure 2 Results of Lsm2 gene expression level detection in lung tissue of COPD mice; WT: Wild-Type mice; WT CS: Wild-Type cigarette smoke mice, ****p<0.0001.

[0046] Figure 3Results of Lsm2 gene expression level detection in human bronchial epithelial cells under CSE stimulation; (A) Relative expression level of Lsm2 gene after 24h, 48h, and 72h of stimulation with 1.5% CSE; (B) Relative expression level of Lsm2 gene after 72h of stimulation with 0.5%, 1%, and 1.5% CSE. CON: No CSE stimulation; 0.5%, 1%, 1.5%: HBE cells stimulated with 0.5%, 1%, and 1.5% CSE, respectively; 24h, 48h, 72h: HBE cells stimulated with 1.5% CSE for 24h, 48h, and 72h, respectively. **p<0.01, ****p<0.0001. Detailed Implementation

[0047] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0048] Example 1

[0049] A mouse model of COPD was established by exposing wild-type (WT) mice to cigarette smoke for 3 months. The expression levels of LSM2 protein and gene were detected by immunohistochemical staining and real-time quantitative PCR, respectively.

[0050] (1) Immunohistochemical staining to detect LSM2 protein

[0051] The operation steps are as follows:

[0052] S1) Dewaxing the 3μm thick white film with xylene for 10 minutes each time;

[0053] S2) After dewaxing, the sample sections are immersed in 100%, 95%, and 75% ethanol in sequence for 10 minutes each time;

[0054] S3) Subsequently, the sample slices were washed with PBS buffer for 2 minutes each time, for a total of 3 washes;

[0055] S4) After cleaning, wipe the surface moisture dry and drop 5% hydrogen peroxide onto the surface of the sliced ​​sample, and let it stand at room temperature for 15 minutes;

[0056] S5) Repeat step S3), wash 3 times with PBS;

[0057] S6) Place the cleaned slides into sodium citrate antigen retrieval solution and microwave on high for 5 minutes, then turn to medium-high heat for 25 minutes. During this process, be careful to avoid excessive evaporation of the liquid and make sure that the tissue slides are completely immersed in the retrieval solution.

[0058] S7) After the liquid has cooled to room temperature, repeat step S3) washing with PBS 3 times;

[0059] S8) Add 5% BSA to the surface of the slice for sealing, and let stand at room temperature for 2 hours;

[0060] S9) Then rinse the surface sealing liquid with running water;

[0061] S10) After rinsing and wiping off excess moisture, dilute the LSM2 antibody at a concentration of 1:200 and add 200 μl to the surface of the slide. Place the slide in a humidified chamber and incubate overnight at 4°C.

[0062] S11) On the second day, remove the slides and place them in PBS buffer. Wash them three times, for two minutes each time.

[0063] S12) After washing and drying, add 200 μl of diluted secondary antibody of the same species and incubate at 37°C for 1 hour;

[0064] After incubation (S13), repeat step (11) to remove the secondary antibody from the surface;

[0065] S14) Add colorimetric reagent;

[0066] S15) Add hematoxylin staining solution to the slide to stain the cell nuclei, and counterstain for 30 seconds;

[0067] S16) Rinse the surface of the slice with running water to remove excess dye;

[0068] S17) After cleaning, immerse it in 75%, 95%, and 100% ethanol for dehydration, 10 minutes each time;

[0069] S18) After dehydration is complete, place the sample in xylene three times for 10 minutes each time;

[0070] S19) Mount the slide with neutral resin as soon as possible and observe it under a microscope.

[0071] Immunohistochemical staining can detect the expression of target proteins; positive staining appears brownish-yellow, and the results are as follows: Figure 1 As shown, compared with WT mice, LSM2 protein expression in the lungs of COPD model mice was significantly increased.

[0072] (2) Real-time quantitative PCR detection of Lsm2 gene

[0073] The operation steps are as follows:

[0074] S1) RNA was extracted from mouse lung tissue using Trizol;

[0075] S2) The extracted mouse RNA samples were reverse transcribed into cDNA using a reverse transcription reagent (Takara, 037A);

[0076] S3) The obtained cDNA was amplified by PCR (Takara, 420A) to detect the expression level of the Lsm2 gene. The primer sequence included:

[0077]

[0078]

[0079] S4) Calculate the relative change in Lsm2 gene expression level, and the results are as follows: Figure 2 As shown, compared with WT mice, the expression of the Lsm2 gene was significantly increased in COPD model mice.

[0080] The above results all indicate that both LSM2 protein levels and Lsm2 gene levels are significantly increased in COPD, and the detection of LSM2 protein levels and Lsm2 gene levels has significant clinical value for the diagnosis of COPD.

[0081] Example 2

[0082] Constructing an in vitro cell model of COPD: Smoking is the most common cause of COPD. Cigarette smoke contains large amounts of tar, nicotine, and other components that cause severe damage to airway epithelial cells. This study used CSE (carcinoma spore extract) to stimulate HBE (human bronchial epithelial cells) to construct an in vitro COPD cell model. The relative expression level of LSM2 mRNA in the COPD cell model was detected under different concentrations and durations of CSE stimulation.

[0083] The operation steps are as follows:

[0084] S1) Before CSE stimulation, HBE cells were evenly seeded into six-well plates and incubated for 24 hours in a 37°C incubator containing 5% CO2.

[0085] S2) When the cell density reaches 60-70%, remove the original culture medium from the six-well plate and add 2 ml of culture medium containing 0.5%, 1%, and 1.5% CSE to each well. Incubate at 37°C in an incubator containing 5% CO2 for 72 hours. Set up a blank control.

[0086] S3) After 72 hours of CSE stimulation, RNA was collected from each group of samples and analyzed by real-time quantitative PCR to detect the relative expression level of LSM2 mRNA in cells. The results are as follows: Figure 3 B;

[0087] S4) Repeat step S1). When the cell density reaches 60-70%, aspirate the original culture medium from the six-well plate and add 2 ml of medium containing 1.5% CSE to each well. Incubate at 37°C in a 5% CO2 incubator for 24, 48, and 72 hours, respectively. Collect RNA from each sample and perform real-time quantitative PCR analysis to detect the relative expression level of LSM2 mRNA in the cells. The results are as follows: Figure 3 A.

[0088] Experimental results are as follows Figure 3 As shown, the expression level of LSM2 mRNA gradually increased with the increase of CSE stimulation concentration and duration.

[0089] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of the biomarker LSM2 in at least one of the following: a1) in the preparation and / or screening of a product for diagnosing or aiding in the diagnosis of COPD; a2) in the preparation and / or screening of a product for evaluating or aiding in the evaluation of the therapeutic efficacy of COPD treatment; a3) in the screening or aiding in the screening of a drug for treating or aiding in the treatment of COPD; a4) in the screening or aiding in the screening of a drug for inhibiting the progression of COPD disease. The product of the present application includes but is not limited to reagents, kits, chips, test papers, membrane strips or detection platforms.

2. Use of a substance for detecting LSM2 in at least one of the following: b1) in the preparation and / or screening of a product for diagnosing or aiding in the diagnosis of COPD; b2) in the preparation and / or screening of a product for evaluating or aiding in the evaluation of the therapeutic efficacy of COPD treatment; b3) in the screening or aiding in the screening of a drug for treating or aiding in the treatment of COPD; b4) in the screening or aiding in the screening of a drug for inhibiting the progression of COPD disease.

3. Use according to claim 2, characterized in that, The substance for detecting LSM2 includes any reagent required for detecting the content of LSM2 protein or the expression level of the gene by RT PCR method, RT qPCR method, immunohistochemical method, immunoblotting method, biochip detection method, Southern blotting method, in situ hybridization method, spatial transcriptome technology.

4. Use according to claim 3, characterized in that, The substance for detecting LSM2 is a reagent for detecting LSM2 protein by immunohistochemical technology; the substance for detecting LSM2 is a reagent for detecting LSM2 protein by immunoblotting method; the substance for detecting LSM2 is a reagent for detecting the expression level of LSM2 protein related gene by RT qPCR method.

5. Use according to claim 4, characterized in that, The reagent includes an antibody, a polypeptide or a protein specifically binding to LSM2 protein, or a nucleic acid molecule specifically amplifying part or all of the gene related to LSM2 protein.

6. A pair of primers characterised in that, The primer pair can specifically amplify Lsm2 gene, and the primer pair is:

7. A kit, characterized in that, The kit includes a reagent for detecting the content of LSM2 protein, or a reagent for detecting the expression amount of nucleic acid related to LSM2 protein, which includes an antibody, a polypeptide or a protein specifically binding to LSM2 protein, or a nucleic acid molecule specifically amplifying part or all of the gene related to LSM2 protein.

8. The kit of claim 7, wherein The kit includes an antibody specifically binding to LSM2 protein.

9. The kit of claim 7, wherein The kit includes the primer pair of claim 6.

10. A method for detecting the biomarker LSM2 without the purpose of diagnosis and treatment, comprising the following steps: 1) obtaining a biological sample to be detected; 2) adding an antibody specifically binding to LSM2 protein, or the antibody labeled with a fluorescent group or an enzyme, incubating, and detecting the content of LSM2 protein according to conventional immunohistochemical or immunoblotting technology; or, extracting RNA from the biological sample to be detected, obtaining cDNA by reverse transcription, adding the primer pair of the third aspect of the present application for PCR amplification, and calculating the relative change value of the expression content of Lsm2 gene.

Images