SNP (Single Nucleotide Polymorphism) molecular marker related to water-holding capacity character of beef and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to an SNP molecular marker related to the water-holding capacity character of beef and application of the SNP molecular marker. According to the method, genotype polymorphism located at 5986079bp on a No.7 chromosome of an international cattle reference genome AR-UCD1.2 version is obtained through screening by virtue of whole genome association analysis of hydraulic characters of beef cattle ectospinal tissue lines, and a basic group A is a beef hydraulic dominant basic group relative to a basic group G. Based on the polymorphism, the SNP molecular marker is developed, the genotype of a cattle species genome corresponding to the SNP molecular marker is detected, the beef water-holding capacity can be accurately evaluated, cattle species with high beef water-holding capacity can be screened, cattle species individuals with the genotype AA are selected for pure breeding, individuals with low water-holding capacity are eliminated, the dominant allele frequency can be increased generation by generation, and the beef water-holding capacity can be accurately evaluated. Therefore, genetic improvement of the beef water-holding capacity character is achieved, the breeding process of high-beef water-holding capacity cattle breeds is accelerated, and the economic benefits of beef cattle breeding are improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a SNP molecular marker related to the hydraulic traits of beef and its application. Background Technology

[0002] Beef quality is an important economic trait of cattle, which directly affects the market price and commercial potential of beef. Improving beef quality is one of the important goals of cattle breeding.

[0003] Water holding capacity (WHC) is a key indicator measuring the ability of muscle to retain its inherent moisture and add moisture during processing and storage, and is considered one of the core elements of meat quality assessment. WHC not only fundamentally affects the edible quality of meat, such as color, tenderness, juiciness, and nutritional value, but is also a key factor determining beef yield and sensory acceptance. Studies have shown that in ruminants, excessive degradation of myofibrillar proteins leading to decreased water holding capacity easily produces pale, soft, and juicy (PSE) meat; while high pH resulting in excessively high water holding capacity easily produces dark, hard, and dry (DFD) meat. Therefore, water holding capacity plays a decisive role in judging beef quality. However, current analysis of functional genes affecting carcass and meat quality traits is insufficient, and there are few molecular markers applicable to genetic breeding. Therefore, identifying genetic markers significantly associated with these traits is of significant practical importance for improving beef quality and increasing the efficiency of beef cattle farming. Summary of the Invention

[0004] The purpose of this invention is to provide a SNP molecular marker related to hydraulic traits in beef cattle and its application, to enrich the types of SNP molecular markers related to hydraulic traits in beef cattle, to accurately assess the hydraulic power of beef cattle, to screen cattle breeds with high hydraulic power, to genetically improve the hydraulic power of beef cattle, and to accelerate the breeding process of cattle breeds with high hydraulic power.

[0005] This invention provides a SNP molecular marker associated with hydraulic traits in beef, located at 5986079 bp on chromosome 7 of the international bovine reference genome ARS-UCD1.2 version, with polymorphic bases of A or G.

[0006] This invention provides a DNA fragment related to hydraulic traits of beef, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0007] This invention provides primers for detecting the SNP molecular markers or DNA fragments described in the above-mentioned technical solutions, including upstream primers and downstream primers; The upstream primer comprises a nucleotide sequence as shown in SEQ ID NO:2; The downstream primer comprises a nucleotide sequence as shown in SEQ ID NO:3.

[0008] This invention provides a kit for detecting the SNP molecular markers or DNA fragments described in the above-described technical solutions, comprising the primers described in the above-described technical solutions.

[0009] The present invention provides reagents for detecting SNP molecular markers described in the above-mentioned technical solutions, reagents for detecting DNA fragments described in the above-mentioned technical solutions, primers described in the above-mentioned technical solutions, or kits described in the above-mentioned technical solutions, and their applications in one or more of the following: (1) Assess beef line water capacity; (2) Screen for high beef line water capacity cattle breeds; (3) Genetic improvement of beef line water capacity; (4) Breeding and / or assisted breeding of high beef line water capacity cattle breeds.

[0010] Preferably, the breed of cattle includes Pingliang Red Cattle.

[0011] Preferably, the beef includes beef sirloin.

[0012] This invention provides a method for evaluating the hydraulic properties of beef, characterized by comprising the following steps: Using the primers described in the above technical solution or the primers in the kit described in the above technical solution, the whole genome DNA of the bovine breed to be tested is amplified by PCR to obtain PCR amplification products; Identify the genotypes in the PCR amplification products that correspond to the SNP molecular markers described in the above technical solution; If the genotype is AA, the beef strain of the tested cattle breed has high water content; If the genotype is GG, the beef strain of the tested cattle breed has low water capacity; If the genotype is AG, the beef line water capacity of the tested cattle breed is between that of the tested cattle breeds with genotypes AA and GG.

[0013] This invention provides a method for breeding and / or assisted breeding of high-beef-quality water buffalo breeds, comprising the following steps: Using the primers described in the above technical solution or the primers in the kit described in the above technical solution, the whole genome DNA of the bovine breed to be tested is amplified by PCR to obtain PCR amplification products; Identify the genotypes in the PCR amplification products that correspond to the SNP molecular markers described in the above technical solution, and select bovine individuals with the AA genotype for purebred breeding.

[0014] Preferably, the identification method includes sequencing; the whole genome DNA includes whole genome DNA from a blood sample.

[0015] Beneficial effects: This invention utilizes genome-wide association analysis (GWAS) of the hydraulic traits in beef cattle sirloin tissue to identify a genotype polymorphism at 5986079 bp on chromosome 7 of the international bovine reference genome ARS-UCD 1.2. The polymorphism, with base A corresponding to base G, represents the dominant hydraulic base in beef cattle. Based on this polymorphism, a Special Nominal Point (SNP) molecular marker was developed. Detecting the genotype at this SNP marker in the bovine genome allows for accurate assessment of beef cattle hydraulic traits, enabling the selection of breeds with high hydraulic traits. By selecting individuals with the AA genotype for purebred breeding and culling those with low hydraulic traits, the frequency of dominant alleles can be increased generation by generation. This facilitates the genetic improvement of beef cattle hydraulic traits, accelerates the breeding process for high-hydration cattle, and improves the economic benefits of beef cattle farming. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 Manhattan plot for genome-wide association analysis of hydraulic traits in the lateral rib tissue of Pingliang Red Cattle; Figure 2 The hydraulic phenotypic values ​​corresponding to different genotypes at 5986079bp on chromosome 7 of Pingliang Red Cattle in Example 1; Figure 3 The hydraulic phenotypic values ​​corresponding to different genotypes at 5986079bp on chromosome 7 of Pingliang Red Cattle in Example 2; in, express P <0.05; express P <0.01; express P <0.001. Detailed Implementation

[0018] This invention provides a SNP molecular marker associated with hydraulic traits in beef, located at position 5986079np on chromosome 7 of the international bovine reference genome ARS-UCD 1.2, with a polymorphic base of either A or G. In this invention, the polymorphic base A is the dominant hydraulic base in beef.

[0019] This invention provides a DNA fragment related to hydraulic traits of beef, the nucleotide sequence of which is shown in SEQ ID NO:1, specifically 5'-ATGTGCAAGATCTGGAAAATTCCCTAAGAGGGCACTTCCAAAGGTGACGTGGCCAACCTGCCCATCTCCCCTACARTGTTTGTTTCAGTGAATGAGACAAAACTGAATCAACTTTTCTCTATCTGGATGATTATCTATCAAAAATTCCCTT-3', wherein R is a degenerate base representing A or G.

[0020] This invention provides a primer for detecting the SNP molecular marker or DNA fragment described in the above-described technical solutions, comprising an upstream primer and a downstream primer; the upstream primer comprises a nucleotide sequence as shown in SEQ ID NO:2; and the downstream primer comprises a nucleotide sequence as shown in SEQ ID NO:3.

[0021] This invention provides a kit for detecting the SNP molecular markers or DNA fragments described in the above-described technical solutions, comprising the primers described in the above-described technical solutions.

[0022] The present invention provides reagents for detecting SNP molecular markers described in the above technical solutions, reagents for detecting DNA fragments described in the above technical solutions, primers described in the above technical solutions, or kits described in the above technical solutions for use in one or more of the following: (1) assessing beef line water capacity; (2) screening cattle breeds with high beef line water capacity; (3) genetic improvement of beef line water capacity; (4) breeding and / or assisted breeding of cattle breeds with high beef line water capacity.

[0023] In one embodiment, the cattle breed described in this invention includes Pingliang Red Cattle. In another embodiment, the beef described in this invention includes beef sirloin.

[0024] This invention provides a method for evaluating the hydraulic properties of beef, characterized by comprising the following steps: Using the primers described in the above technical solution or the primers in the kit described in the above technical solution, the whole genome DNA of the bovine breed to be tested is amplified by PCR to obtain PCR amplification products; Identify the genotype in the PCR amplification product corresponding to the SNP molecular marker described in the above technical solution; if the genotype is AA, the beef line of the tested cattle breed has high water capacity; if the genotype is GG, the beef line of the tested cattle breed has low water capacity; if the genotype is AG, the beef line of the tested cattle breed has water capacity between the tested cattle breeds with genotypes AA and GG.

[0025] This invention provides a method for breeding and / or assisted breeding of high-beef-quality water buffalo breeds, comprising the following steps: Using the primers described in the above technical solution or the primers in the kit described in the above technical solution, the whole genome DNA of the bovine breed to be tested is amplified by PCR to obtain PCR amplification products; Identify the genotypes in the PCR amplification products that correspond to the SNP molecular markers described in the above technical solution, and select bovine individuals with the AA genotype for purebred breeding.

[0026] In one embodiment, the identification method of the present invention includes sequencing. In another embodiment, the whole genome DNA of the present invention includes whole genome DNA from a blood sample.

[0027] In one embodiment, the PCR amplification reaction system of the present invention, per 10 μl volume, includes 1 μl of genomic DNA, 0.3 μL of upstream primer, 0.3 μL of downstream primer, 5 μl of PCR mix, and the remainder sterile water. In another embodiment, the PCR amplification program of the present invention is as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 59°C annealing for 30 s, 72°C extension for 1 min, for a total of 35 cycles; 72°C extension for 5 min; and storage at 4°C.

[0028] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides a SNP molecular marker related to the hydraulic properties of beef and its application, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1 1. Experimental population: 564 Pingliang Red Cattle from Jingchuan County, Pingliang City, Gansu Province.

[0030] 2. System hydraulic phenotyping The experimental group was uniformly fed and managed after weaning, and fattened to 24-36 months of age before being slaughtered in batches. After slaughter, the carcasses were cooled at 4°C for 72 hours. Approximately 1 kg of lateral loin tissue was cut from the left half of the carcass and divided into 1 cm × 1 cm × 1 cm cubes. The water-holding capacity of the meat samples was determined using a texture analyzer with a compressive weight of 25 kg and a compression time of 300 seconds. Each sample was measured three times, and the average value was taken.

[0031] 3. Genotyping Blood samples were collected from the experimental population to extract whole-genome DNA. Library construction and sequencing for whole-genome resequencing were performed by BGI Genomics Co., Ltd. in Shenzhen. Trimmomatic was used to remove adapters and low-quality sequences, and BWA was used for alignment to the ARS-UCD1.2 reference genome. Picard MarkDuplicates were used to label repetitive sequences generated by PCR amplification. Whole-genome genetic variations were detected using GATK's HaplotypeCaller, and CombineGVCFs and GenotypeGVCFs were used to merge the VCF files of multiple samples. GATK's SelectVariants and VariantFiltration were used to filter and retain high-confidence genetic variations. PLINK was used to filter low-quality SNPs, ultimately yielding 22,694,505 SNPs.

[0032] 4. Genome-wide association analysis To identify genetic loci associated with line hydraulics, genome-wide association analysis was performed using the FarmCPU model and the generalized linear model (GLM) from the rMVP package in R4.3.3 software, based on the resequencing data from step 3 and the line hydraulic phenotypic data from step 2. The results are as follows: Figure 1 As shown, nucleotide 5986079 of chromosome 7 is significantly associated with water-holding capacity. Among these, the significance detected by the FarmCPU model... P The value is 3.07 × 10 -6 The p-value obtained from the generalized linear model (GLM) analysis was 2.94 × 10⁻⁶. -6 .

[0033] 5. Analysis of the hydraulic association between SNP locus genotype and beef line To investigate the impact of different genotypes of the SNP molecular marker at 5986079 bp on the hydraulic capacity of beef, the Kruskal-Wallis nonparametric test was first used to assess the overall differences in hydraulic capacity among different genotypes. Then, the Dunn test was used to perform pairwise comparisons between groups with significant differences. The results are as follows: Figure 2 As shown, the SNP marker genotypes are AA, AG, and GG. Individuals with the AA genotype have the highest water efficiency in beef strains, followed by the AG genotype, which is higher than the GG genotype.

[0034] Example 2 A new experimental population of 45 Pingliang Red Cattle was selected to verify the genotype of the SNP molecular marker site at 5986079 bp on chromosome 7 and its hydraulic association with beef cattle lines. 1. The hydraulic phenotypes of 45 Pingliang Red Cattle were determined according to the method in Example 1.

[0035] 2. Extract genomic DNA from all individuals in the experimental population; 3. Using the genomic DNA obtained in step 2 as a template, PCR amplification was performed using upstream and downstream primers to obtain the amplification products; wherein, Upstream primer: 5'-TCTGGAAAATTCCCTAAGAGGGC-3' (SEQ ID NO:2); Downstream primer: 5'-TGATTCAGTTTTGTCTCATTCACTG-3' (SEQ ID NO:3); The PCR amplification reaction system (10 μl) is as follows: 1 μl genomic DNA, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μl PCR mix, and sterile water to make up to 10 μl; The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; 72℃ extension for 5 min; and storage at 4℃.

[0036] 4. Sequencing the amplified products to identify the genotype corresponding to the amplified product at position 5986079 bp on chromosome 7.

[0037] The results are shown in Table 1 and Figure 3 As shown, the genotype of the SNP marker locus in 14 Pingliang Red cattle was AA, the genotype of the SNP marker locus in 21 Pingliang Red cattle was AG, and the genotype of the SNP marker locus in 10 Pingliang Red cattle was GG. Among the SNP molecular markers, the AA genotype individuals had the highest water content in beef, followed by the AG genotype, which was higher than the GG genotype.

[0038] Table 1. Hydraulic capacity (%) corresponding to different genotypes at 5986079 bp on chromosome 7.

[0039] As can be seen from the above, the SNP molecular markers provided by this invention are significantly correlated with beef line water capacity, which can accurately assess beef line water capacity, screen cattle breeds with high beef line water capacity, genetically improve beef line water capacity, and accelerate the breeding process of cattle breeds with high beef line water capacity.

[0040] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with beef water-hydraulic traits, characterized in that, The polymorphic base is A or G at 5986079 bp of chromosome 7 of the international bovine reference genome ARS-UCD1.2 version.

2. A DNA fragment associated with hydraulic traits of beef, characterized in that, The nucleotide sequence of the DNA fragment is shown as SEQ ID NO:

1.

3. A primer for detecting the SNP molecular marker of claim 1 or the DNA fragment of claim 2, characterized in that, The primer comprises an upstream primer and a downstream primer; The upstream primer comprises a nucleotide sequence shown as SEQ ID NO:2; The downstream primer comprises a nucleotide sequence shown as SEQ ID NO:

3.

4. A kit for detecting the SNP molecular marker of claim 1 or the DNA fragment of claim 2, characterized in that, The primer comprises the primer of claim 3.

5. Application of the reagent for detecting the SNP molecular marker of claim 1 or the reagent for detecting the DNA fragment of claim 2 or the primer of claim 3 or the kit of claim 4 in one or more of the following aspects: (1) evaluating beefiness; (2) screening high beefiness cattle breeds; (3) genetic improvement of beefiness; (4) breeding and / or assisted breeding of high beefiness cattle breeds.

6. Use according to claim 5, characterized in that, The cattle breed comprises Pingliang Red Cattle.

7. Use according to claim 5, characterized in that, The beef comprises beef tenderloin.

8. A method of assessing beef water-holding capacity, characterized by, The method comprises the following steps: PCR amplification of the whole genome DNA of the to-be-tested cattle breed by using the primer of claim 3 or the primer in the kit of claim 4, to obtain a PCR amplification product; identifying the genotype corresponding to the SNP molecular marker of claim 1 in the PCR amplification product; if the genotype is AA, the beefiness of the to-be-tested cattle breed is high; if the genotype is GG, the beefiness of the to-be-tested cattle breed is low; if the genotype is AG, the beefiness of the to-be-tested cattle breed is between the to-be-tested cattle breed with genotype AA and the to-be-tested cattle breed with genotype GG.

9. A method for breeding and / or assisted breeding of a high beef line of a water buffalo, characterized in that, The method comprises the following steps: PCR amplification of the whole genome DNA of the to-be-tested cattle breed by using the primer of claim 3 or the primer in the kit of claim 4, to obtain a PCR amplification product; identifying the genotype corresponding to the SNP molecular marker of claim 1 in the PCR amplification product, and selecting a cattle breed individual with genotype AA for pure breeding.

10. The method according to claim 8 or 9, characterized in that, The identification method comprises sequencing; and the whole genome DNA comprises whole genome DNA of a blood sample.

Images