Indel marker for distinguishing cassava varieties and application of Indel marker

Abstract

The invention provides an Indel marker for distinguishing cassava varieties and application of the Indel marker. A primer pair of the Indel marker comprises F: AAAAACGACACAAATTCGATACAA and R: TCCGAATCAAGAGATTTGTTAGAC, and the Indel marker is used for identifying the cassava varieties. The InDel primer pair is used for carrying out PCR amplification on cassava, the amplification product is subjected to gel electrophoresis separation detection or sequencing, the cassava variety w14 and the wild cassava Suriinan can be distinguished according to an electrophoretic band or a sequencing result, detection can be carried out at any time in any growth period of cassava, and the InDel primer pair has important significance in distinguishing cassava germplasm.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and bioinformatics, specifically to an Indel marker for distinguishing cassava varieties and its application. Background Technology

[0002] Cassava (Manihot esculenta Crantz) has diverse varieties, each with unique characteristics suitable for different climates and soil conditions. When selecting cassava varieties, local environmental conditions and planting objectives should be considered. Therefore, accurate differentiation of cassava varieties is crucial for cassava cultivation and breeding. Molecular markers, based on genomic DNA sequence polymorphism, reveal essential genetic differences by detecting nucleotide variations (such as SNPs, InDels) or differences in repeating units (such as SSRs). Their technological advantages are threefold: 1. Rich polymorphism, covering both coding and non-coding regions of the entire genome; 2. Co-dominant inheritance, accurately distinguishing homozygous / heterozygous genotypes; 3. Strong environmental stability, with negligible epigenetic interference. Therefore, they are widely used in plant genetic diversity assessment, germplasm resource identification and classification, molecular breeding, and trait mapping research. Insertion-deletion polymorphism (InDel) markers are based on short fragments (typically 1-50 bp) of insertion or deletion variations in the genomic sequence. They detect genetic polymorphisms through specific primer amplification and differences in product length, offering advantages such as site stability, ease of detection, and functional correlation. Compared to SNP and SSR markers, InDel is irreplaceable in detecting genomic structural variations and has significantly lower development costs. It has been widely used for genetic diversity assessment, atlas construction, gene localization, and purity testing.

[0003] Wild-type cassava W14 is a closely related wild variety, difficult to distinguish from wild Surinamese cassava, and is easily confused during cassava variety breeding. Therefore, developing InDel molecular markers related to cassava variety identification has a positive promoting effect on cassava variety breeding. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide an Indel marker for distinguishing cassava varieties and its application.

[0005] A first aspect of the present invention is to provide an InDel-labeled primer pair comprising: F: AAAAACGACACAAATTCGATACAA and R: TCCGAATCAAGAGATTTGTTAGAC.

[0006] A second aspect of the present invention is to provide a kit comprising the InDel-labeled primer pair described in the first aspect of the present invention.

[0007] The kit also includes reagents required for PCR reactions and / or electrophoresis.

[0008] A third aspect of the present invention is to provide the application of the InDel-labeled primer pairs described in the first aspect of the present invention, or the kit described in the second aspect of the present invention, in the identification of cassava variety w14 and / or wild cassava Suriname.

[0009] A fourth aspect of the present invention is to provide a method for identifying cassava variety w14 and / or wild cassava Suriname, using the InDel-labeled primer pair described in the first aspect of the present invention or the kit described in the second aspect of the present invention.

[0010] Preferably, the method includes the following steps: (1) extracting DNA from the cassava leaves to be tested; (2) performing PCR amplification on the cassava leaf DNA using the InDel marker primer pair described in the first aspect of the present invention or the kit described in the second aspect of the present invention; (3) if a target band or target fragment of 195bp is identified in the test sample, the test sample is cassava variety w14; if a target band or target fragment of 267bp is identified in the test sample, the test sample is wild cassava Suriname.

[0011] The fifth aspect of the present invention is to provide a method for identifying cassava variety w14 and / or wild cassava Suriname from cassava samples, using the InDel-labeled primer pair as described in claim 1 or the kit as described in claim 2 or 3.

[0012] Preferably, the method includes the following steps: (1) Extract DNA from the cassava leaves to be tested; (2) PCR amplification of cassava leaf DNA was performed using the InDel-labeled primer pair as described in claim 1, or the kit as described in claim 2 or 3; (3) If a target band or target fragment of 195 bp is identified in the test sample, the test sample is cassava variety w14; if a target band or target fragment of 267 bp is identified in the test sample, the test sample is wild cassava Suriname; if a target band or target fragment of 297-300 bp is identified in the test sample, the test sample is a variety other than cassava variety w14 and wild cassava Suriname.

[0013] The InDel primers of this invention are used to perform PCR amplification on cassava. The amplification products are separated and detected by gel electrophoresis or sequencing. The cassava variety w14 and wild cassava Suriname (referred to as wild cassava) can be distinguished based on the electrophoretic bands or sequencing results. This method can be used at any time during the growth of cassava and is of great significance for distinguishing cassava germplasm. Attached Figure Description

[0014] Figure 1 The results for InDel primer amplification and polymorphism detection of some samples are as follows: cp18: Clear single bands were obtained for each sample, and no difference in band size was observed (no polymorphism); mt6: Bands were consistent for all samples (no polymorphism); cp6: Wild cassava showed differences, others showed no differences; cp7: Wild cassava and w14 showed consistent bands, but differences were observed for other samples; cp22: Band size differences were only detected between the closely related wild species W14 and wild cassava Suriname (wild cassava), other cassava materials showed no differences. In the figure, M represents the molecular weight standard; the lanes are arranged in the order of C1, C2, C3..., and the arrows indicate W14 and wild cassava Suriname.

[0015] Figure 2 This is a partial electrophoresis diagram of the amplification products of different cassava varieties using the InDel-labeled primer pairs of the present invention; M in the diagram is the molecular weight standard; the lanes are arranged in the order of C1, C2, C3... and the arrows indicate W14 and wild cassava Suriname (wild cassava). Detailed Implementation

[0016] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0017] 1. Experimental materials

[0018] The 26 cassava varieties selected for the experiment (see Table 1) were collected in March 2024 from the National Cassava Germplasm Resource Nursery of the Institute of Tropical Crops Germplasm Resources, Chinese Academy of Tropical Agricultural Sciences (Danzhou City, Hainan Province). Main experimental reagents: 2x RapidTap Master Mix (Vazyme), DL2000 Plus DNA Marker (Vazyme). Main experimental instruments: PCR amplification instrument (Bio-Rad), electrophoresis apparatus (Liuyi Instrument Factory).

[0019] Table 1. Cassava family lineage information

[0020]

[0021] Table 2. Family history of 26 cassava samples

[0022]

[0023] 2. Extraction of cassava genomic DNA

[0024] Take 26 cassava samples. Using tweezers, place 0.1g of tender cassava leaves into pre-numbered 2ml centrifuge tubes and add steel balls. Grind using a high-speed grinder (Hanchen Guangyi) for 5 minutes. If unsuccessful, repeat the grinding process. Extract cassava DNA using the modified CTAB method (Li Kaimian). The specific steps are as follows:

[0025] (1) Pour 800 μL of CTAB lysis buffer preheated to 65°C into a centrifuge tube, and use a vortex shaker to mix thoroughly. Then place the tube in a 65°C water bath for 30 minutes, inverting it every 10 minutes to mix thoroughly and promote complete lysis of the lysis buffer.

[0026] (2) Take the centrifuge tube containing the sample into the fume hood, add 300 μL of chloroform and isoamyl alcohol mixture (24:1), and mix by inverting for 10 minutes, then let stand for 10 minutes.

[0027] (3) Centrifuge at 12000rpm for 10 minutes at 4℃. Use a pipette with the tip cut off to slowly aspirate 350ul of the supernatant into a newly numbered centrifuge tube, and add 2 times 700ul of pre-cooled anhydrous ethanol. Let stand and wait for the DNA flocculent to form.

[0028] (4) Centrifuge at 11000rpm for 5 minutes at 4℃, pour out the excess liquid, leaving only the white flocculent precipitate, then add 400ul of 75% alcohol, and invert the centrifuge tube to ensure that the flocculent precipitate is removed from the bottom of the tube. Repeat the above steps twice.

[0029] (5) Pour out the waste liquid in the centrifuge tube, leaving white flocculent material, and put it in the fume hood to dry the remaining liquid in the centrifuge tube.

[0030] (6) Add 100 μL of dd water and 0.75 μL of RNAse enzyme, then shake and centrifuge, and then incubate in a water bath at 37°C for 30 minutes.

[0031] (7) The concentration and OD value of DNA in the cassava samples were detected using an ultra-micro spectrophotometer, and the presence of a blocking band in the DNA samples was detected using 1.5% agarose gel electrophoresis. Store at -20℃.

[0032] 3. Design of InDel-labeled primers

[0033] Using chloroplast and mitochondrial genome data of cassava varieties obtained through sequencing, and combined with published cassava chloroplast and mitochondrial reference genome sequences downloaded from NCBI, multiple sequence alignment was performed on the DNA sequences using the MAFFT plugin in Polysuit software. InDel sites were then screened using GeneDoc software based on the alignment results. A total of 85 InDel sites were detected, with variation lengths ranging from 1 to 184 bp. Most of the differences were concentrated between the closely related wild species W14 and wild Suriname cassava. Based on the InDel length and distribution characteristics, 23 chloroplast sites (cp1-cp23) and 6 mitochondrial sites (mt1-mt6) with site differences ≥10 bp or differences between different varieties were selected for primer synthesis and amplification detection.

[0034] For each detected InDel site, 100bp sequences upstream and downstream were extracted, and the target sequence was then imported into the online primer design platform Primer3Plus (https: / / www.primer3plus.com / ). Primer design parameters were as follows: primer length 15-30bp, primer GC content between 40% and 60%, Tm value preferably close to 58-60℃; Tm values ​​of the left and right primers differing by 1-2℃, and product size 150-200bp. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. PCR amplification was performed on the DNA from young leaves of different cassava varieties obtained in "2. Cassava Genomic DNA Extraction". PCR reaction system (20 μL): DNA template (50~100 ng / mL) 3 μL, 2×Rapid Tap Master Mix (Vazyme) 10 μL, upstream primer (20 ng / μL) 0.3 μL, downstream primer (20 ng / μL) 0.3 μL, ddH2O 6.4 μL. PCR amplification program: pre-denaturation 5 min (94℃); denaturation 15 s (94℃), annealing 15 s (52 ℃~60 ℃), extension 15 s (72 ℃), for a total of 32 cycles; extension 5 min (72 ℃), then hold at 4℃. The amplified products were detected by gel electrophoresis on a 3% agarose gel. The gel imaging system was then used to photograph and record the results, analyze the band types, and screen for sites and primer sequences that could distinguish w14 from wild cassava Suriname.

[0035] Table 1. Statistics of 23 chloroplast loci and 6 mitochondrial loci

[0036] Site name Truncated sequence F (upstream primer) R (downstream primer) cp1 ACAGGTAAGATCCAATTACCTCAGATCGGATTATATTTATTTGATACACTGTTGTCAATATGAATGTGAATATATTGAAAAAAAAAAATACACAATGAAGAAAAAAAATAGGTATAAAATAGGTATGAATAGAGTATGAATAGAATAAGAGAAGGGGGGGATAGTAGAGAAAAGGTTATAGAAAGCTATATATGTATACGAATTACCCACACCCTGCATTTCATTAAGTAAAT TCCAATTACCTCAGATCGGATT TAATGAAATGCAGGGTGTGG cp2 ATGAAGAAGTGTCAGAAAGAATTTAATTTAACTTAACCCCATATTTTATTGTATGAATATTTTTTGATTTACAATTCTAATATTAGAAATAAGACAAAGAAATAAGATAAGATCTTTTTGAATCTTCAAGTGACTCCATAGGACAGATTCGCCTATCTCACATTTCTTCGAGTCCCAAGGACTCATAAAAAATCCTTAAAAAGATT AACTTAACCCCATATTTTATTGTATGA CCTTGGGACTCGAAGAAATG cp3 ACATTTTTAAATATTAAAGAAAACAAAAAAAGGTTCGCTAAATTTTAAAGAAAAGATAAAAAAAAAATTCCAAAGTCATCACCGAAACCGGAAAGAGAGGGATTCGAACCCTCGGTACGAATAACTCGACCGAAACCGGAAAGAGAGGGATTCGAACCCTCGGTACGAATAACTCGTACAACGGATTAGCAATCCGACGCTTTAGTCCACTCAGCCATCTCTCCCGATTGAAAAAGGATAATTAATTA CCAAAGTCATCACCGAAACC TTTTCAATCGGGAGAGATGG cp4 ACCAGTATTTACAATCTTTACTTCCCTATTATATTGCTCAATACGTTCGCGGATAATATTACTAATCTCGTCGGCTCGAATGGTTACCATGAGTATTTCTTAATTATTTTTTTTTTCAAAAAAAAAAAAATAATGCCTACAGTAGAAGGACTAATCAGTTATTTCTTTTATCGCGCCAAACATGCCAAGATTAGCATTGATGGTACGTAAATGCAAC GCTCAATACGTTCGCGATA TGCTAATCTTGGCATGTTTG cp5 TAATTGTTCCGATGGAACCTTCTCTTTTCCCGGAGATTGGACGTTGATATACGATCCAAGCGATTAATTTCTTTCTATTCTTTACTTTCTTTATTACTATTAACAAATCACATGTAACAAATCCAAATAATTACAGACCGCGATTAATTAAAATATTAATTAATAATAAAAGGATGAATCCGCTCTTAGGAATCA TGTTCCGATGGAACCTTTCTC TGATTCCTAAGAGCGGATTCA cp6 AAGCTTCTTGCTCCTAGTTATTCTATAGGAAAAAATCACTGTTCCCTTCCTCCATAGAAAAGTTTATTCGAAGTCATAACATAAGACATAGAAGAGACTTTTAAAATATCTTTCTTTTAAAATATCTTTCTTTGATTCCAGAACACAAAATCAATTTATCAATTTATATTGATATATATACCTATATGAGATTTATATATA AAGCTTCTTGCTCCTAGTTATTCTAT TGATAAATTGATTTTGTGTTCTGGA cp7 AATTCATGAAATTCTTTGATTGGTTCTTCCCAGAGAAACGATCTGTTTTATTTGACTGATAGGGATAACAAACAATTAATTATAACAAATTTGTTATAAGAAATATAAAAATTTGTTATAAGAAATATAAAAATGTAACAAATACTAAAAAAAATACTAAATAATAAATACAAAGAGATCTTATCTTATTCGAAACGCCTTGTGATTTTCAACCAATTCTG TGGTTCTTCCCAGAGAAACG TCACAAGGCGTTTCGAATAA cp8 CCCAATTTTGGTTCTTTATTTGATTAAAAATTTTCTATTTTGATTTTTATAGTTTATAGTTAGAATTGATGGTACGTACCATACCTATCCAACAATCTAATATAAAAATTATAAATTATAAATGACTCGCGATTCACTCGGGTTCTGGGCCATAATCATTATGCAGGAGAGATGGCCGAGTGGTTCAAGGCGTAGCATTGGAACTGCTAT CCCAATTTTGGTTCTTTATTTGA AATGCTACGCCTTGAACCAC cp9 AAAACTGAACTAAAGGATAAATATGATAAATGAAGCAAAATCTACTATCTACTAAATTAGTATACTACAAAGAATAATGAGGTGGATTGTATCAATATCCGGACCTTATTCCTTATTGTATATATACCAATAATGTATATAGAAAAAAGGTCCTTTTCTTGTTCTTGATTTGTTCTGCAGAGATTTAACTACAACTTTTA GGATAAATATGATAAATGAAGCAAAA TGCAGAACAAATTCAAGAACAAGA cp10 AAATTCAGAGAAACCCTGGAATTAAAATGGGCAATCCTGGCCAAATCCTGTTTTCCGAAAACAAACAAAGTAAAGACAGAATAAAATAAAAAAGAAAATAAAAAATAAAGGGGGGGGGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAATGGAGTTGACTGCGTTGCATTAGTAAAGTAAAGAAATCCTTCCG CAATCCTGAGCCAAATCCTG ACTAATGCAACGCAGTCAACTC cp11 CATTGGCGCGCGTGTAAACGAGGTGCTCTACCTAACTGAGCTATAGCCCTTGTGTTTGTGATACATATTTTATCATGTTGATAATTTCTTGTCAAGATGAATATTATATGATCCAACATCCTATTTCTTTGATCTCTTTGATCGGTATTGCTTATAAAAAATATCCCATTTATAATTAATATTACATTTATAATCCATCGA GCGTGTAAACGAGGTGCTCT TTTTTATAAGCAATACCGATCAAAGA cp12 CGGATTCCATCTCTTTGTGATGATAAATGACCTACTTAACTCAGTGGTTAGAGTATTGCTTTCATACGGCGATAGTCATTGGTTCAAATCCAATAGTAGGTAGAACTTATTAGATAAGTAGGTAGAACTTATTAGATATCAGAATCAATGCTATCTAATAAGTTTTTTGACCCACCTTATTTTAATTTTATTGATTTTTGATCTTTTTCGTTCCATTCTATT ACGGCGATAGTCATTGGTTC TGGAACGAAAAAGATCAAAAATC cp 13 TAGGCATCTTGCCCGGGGGAAAAGCTACATCTAGCACTGGCCCGATGATTTGAGCGATACGCCCCAGGTTCTTTTTTTCAAGCGCGGAAACTCCCGGACCAGAAGTAGTAGGATTGATTCTCATAATAATAAAAATAATAAATAAAAATAAAAAATATGTTGAATTTTTTTTTATTTTCTAGTCCAAAATAAATGTTCGACG CCCGATGATTTGAGCGATAC CGTCGAACATTTATTTTGGACTAGA cp 14 GTTAGTACTCAATTTCGTTGAGACCATCTAAAAAATCCAATTCAATTGTTTACTTATTTTCAATTTCAATGAGTGAATTTTCAAGTTCAACTAACTCATTTTAAAAAATTAAAAAATATAAATATCAAGTGGATGAATAAAAAGGCTTCAGAAAGCCTTTCATTTGTCTATCATTATAGATAATACTATCCATATTTTCTATGGAATT CTCAATTTCGTTGAGACCATCT GGCTTTCTGAAGCCTTTTTATTC cp 15 AGAAACTTGAAAAACAAGGAATGGGTTGCGCCATATATATGAAAGAGTATACAATAATGATGTATTTGGTGAATCAAATACCATGGTCTAATAGCAAAATTCTGTTCTGATTAGTTGATAATATTGGTTGATAACTTTGTGAAAGATTCCTGTGAAAGGTTTCATTAACTCCTAATTCATGTCGAGTAGACCTTGTTGTTGTGAG CTCAATTTCGTTGAGACCATCT GGCTTTCTGAAGCCTTTTTATTC cp 16 AAAAAAAAATTGAGACTGTGGCGGATGCCTGAAATAAATGCAAAGCCAATGTTTTTATATGCGTAGATAGAGGATCATATGAGGGAGCTTCCCCCCCTTTTTTTTTTAAATCTGACGAATTCGATGAATTCCTTCTAAACTAAAGATTCACATCAGAATAGTGCGAGTTGATGAAAGTTACTTCGGAAAAAAAAAAGAAAGT GCGGATGCCTGAAATAAATG TTCATCAACTCGCACTATTCTGA cp 17 CAACCACGATTTTTTTTTGTTTGAGGCATTTCGCCTCGAAATAAGAAACTGTATTGATATTGGGTATCGAATAAAAATATTATAAATATTATAAAGAAAACTAAGTAGTAAATAGAAATAGATAAAAATGATAAATAAATAGTGGGTTCCATCGTTTATATGGTTACTTTTTAAACGGTGAGGTCTTCTCTATACACCGGAGCCCCCTCC TTTTTGTTTGAGGCATTTCG GGGCTCCGGTGTATAGAGAA cp 18 ATCTTATAATTTTTTTGTCTTATAACACTTCAGGTGCTAATGAAACTATTTTAGTAAAATTTAACTGTCTCAATTCCCGGGCGATTGCACCAAAATTCGAGTTCCCTTTGGATTTCCTTCTTGATCAATGACAACTGCAGCGTTGTCATCATATCGTATTATCATACCATTATCACGTTTGAGTTCTTTACAAGTACGTAC AACACTTCAGGTGCTAATGAAAC AAAGAACTCAAACGTGATAATGG cp 19 CGTTTACAACAGAAAAAACTTCCTCTGATGAATTGTATAATCGTTGGAATTATAAGAATGACAAAAAAAAGAAACCCTAAATAATGAATTTTAAACAGAGTAGTAAATTAATAAGAAGATTAACGCATAAAATAAATAAAATAAGAGATAAAAAAGAGATGCGACCACTTCCTACATTTTTTATACCCTCTCCTACAAAG AACAGAAAACTCTCCTCTGATGAA GGAAGTGGTCGCATCTCTTT cp20 TAATTAAACCCTAAGGGTGTAAATTTTTTACTATATGTACAGCTATTGTACTAATCTCATCCTTTCTCAAATCTCAAAAAGGCATTCTAAATTTTTTTTTCGAAATAATTATGGATAGAATTAAAAATATATTAATAGATTTTCAATCCAAATTAAGTCGGACGCAATTCTCATCAATCAATCAATAGTTGGAATTTGT ACTAATCTCATCCTTTCTCCAAATCTCA CAAATTCCAACTATTGATTGAT cp21 TATATATATTCTTACCATACTGAACCGACTGGCATTATTAGTATCGAACCAATAACGATTCATACAAGCTAAATCTTCTAATCGAAAATTTGCCAAAGAAAATTGTAATTTAATTAGTTTCTTTTTATTCTATCAAAATGTTTGCTTTTAACCAAAATGGGGACTACAATTTTTTATGTTATTGCCGTTGAAAATTTCTGTATTATA CATACTGAACCGACTGGCATT CAGAAATTTTCAACGGCAAT cp 22 GTATAAAGAAAAAGATATTCTAAAGAAAAATAGAGGGTCATTTTTCATTTTAAAATCTAAAAAACGACACAAATTCGATACAAATATACAAAATATACAAATAAATAGTAAATAAATATTAAAAATAAATTTTAAATAAACTAAAAGAAACTATCAAAATAGAAATGATTTTAAAATTTTATTTTGTAGTGATTTTCGTAGTAATTCAAAGAAAGTTTTTTGAATAAAGTTATACAACAGTTTTTACTACTTATTATTTTATTTTATTTATTTACTTCTTATTTATTAATCTTATTTATTAATATTTATAATATTTATTAATATATTTATTAATATTTATATTGATAATATTTAATTATTGTAATCTTAGTTTTCTATTTTATTTATCTATTTTATTTATCAAGAGTTGTCTAACAAATCTCTTGATTCGGAATCACGAGAGTATAAGTAGATGTCATAGATGATAAATT AAAACGACACAAATTCGATACAA TCCGAATCAAGAGATTTGTTAGAC cp 23 CTTTGAAATCCTCGGACCATTCAGGAGTTTTTAAAAAAAGTATACGAATGATATTTTTAATTATTATTAATGAAGGTAATAGAATATATTTTCTAAAAATGGATTGGGTTACTAAAATAAAACCTCTTGTTATTTGAGCAAAAAAGAATATCATCCCAGGCTTCGGCTATTTCTACCAGATCGATTGTCTCTGTTGTGGGTTCTTCTATTTTGTTGTCTTCTATTTTGTTGTCTTCTTCTTCTTCTTCTATTTTGTTGTCTTCTTCTTTCTTCTATTTTGTTGTCTTCTCTTTTGTCCTCTTTTTTTTTTTCTTACTTTCTTTTGTTTTTTTTTCTTTATATTCGAAAGTATGAATTCTGCGTTTTTATACATCCAATTTATAAACATTGTTTTTAACATTTTT TCGGACCATTCAGGAGTTTT AAAACGCAGAATTCATACTTTCG mt1 ATGTTCGAGACTTACCTAGATGGACAAGCCTTAACGCCCTCGATTCCTTTAGCAGTGGCATTGTGAAAATGGAAAGAAGAGCTCCTACCTAGTCAAAAAGTAAAAAAAATTCTTGGACCTTGGAATCGATCAAGTGTTCACTCACACACACAACCTATGGGCGAAATCACTCAAGCTCCTGTTCCTTATTCCTTAGGGAGTG CTTAACGCCCTCGATTCCTT ACAGGAGCTTGAGTGATTTCG mt2 GGAGGAGATGCGCCCGATAGACGAGAAGGCTCGGTTACCGCTCCGAAAGAAATCCCACTTCCTCATGAATTTATCTTGAATCGGGATCTTTTGGCTCAACTTTATCCCAGTTTTGCTGAGGGAGCAACCCCATTTTTCACCTTGAATTGGTCAAAATATTCGGACTTTCTTACTTTTCGTGGAGGATTAGATCCAGTGACTGGGGGTCTATGG TTACCGCTCCGAAAGAAATC TGGATCTAATCCTCCACGAAA mt3 AGGCAATGGAACAAGTCCCATGTCTCATTCTTTTTTAGGGTCCCCTCGCACCTTAGCGCTGCCTCTGGTTTTTCGTCTTGTGCAGCCTTTTTTTGTTTTTCTTTTTTTTTTCCTTTACTTTCCCCTTCCTCCCCTTTGCCATTGTCACTACTGGTACCTGACCCCGTCGGCTCGACATTTTTGCAAACACCGACCCTTACTC TGGAACAAGTCCCATGTCTC GAGTAAGGGTCGGTGTTTGC mt4 GAAGAAAGGGAAATAGCAAGAGCTCATTCGGATAAAAACCCGAAGAGGCGGTCTAGGTGAGAGCTAAAGCGTTGGGAAAAGGATACCTTGCCGAGTCGAAAACCCGAAAAAAAGCGCTTCGACCAAACTTGAGAGGTCGTGTGAAGCATCTCCTGGAGAACGAGTTCGATCTCCCATTGGTCTTTGGGAGCTAGCATATGGGGGCAA TTCGGATAAAAACCCGAAGA CAAAGACCAATGGGAGATCG mt5 TGCGCCCTAAGTTTTCAAAGCAAAGGCTTTTAAAGTAAAACATAAATAAAACAGAAAGTAGTCTCCGCCAGAAACTTTTAATTAAGATAGGAATATACTAGATTGCACAAAAAGATTGCACAAAAAATTGTTTTTGCATTAATTCAAAGCCCAAAAAGGTCCGTTGAGCGCCTCGTGGGTATGTCATAATAGATCCGAACACTTGCCCTGGAT TGCGCCCTAAGTTTTCAAAG AGGGCAAGTGTTCGGATCTA mt6 TCCGTTGAGCGCCTCGTGGGTATGTCATAATAGATCCGAACACTTGCCCTGGATCGACTTCCAGATCATAATTGCTCTAGTGAATAACTAAAGAAACTAGATAAATATAAATGGGAGATAGAAAAGAAAGAAACTAATTATAAGCATCTCTCATAGGTTCACTAATTACTTTTCTTGACTATTGGCGGGTCTCTTTATATGTGTTG ACTTGCCCTGGATCGACTT GAGACCCGCCAATAGTCAAG

[0037] Experimental results showed that all candidate InDel sites were successfully amplified, exhibiting five typical polymorphism patterns: a. All samples showed consistent bands with no obvious polymorphism; b. W14 differed from other varieties, while other materials showed consistent bands; c. Wild Suriname cassava differed from other varieties; d. W14 showed consistent band differences with wild Suriname cassava, while other materials showed no differences; e. W14 showed significant band differences with wild Suriname cassava, while other varieties showed no differences. Finally, the site cp 22 and primer pair (F: AAAAACGACACAAATTCGATACAA and R: TCCGAATCAAGAGATTTGTTAGAC) were selected to identify the cassava variety w14 and wild Suriname cassava. Figure 1 ).

[0038] 4. Differentiating between cassava variety W14 and wild Surinamese cassava

[0039] cp22 and primers (F: AAAAACGACACAAATTCGATACAA; R: TCCGAATCAAGAGATTTGTTAGAC) were selected and used to amplify DNA from young leaves of different cassava varieties by PCR. The PCR reaction system (20 μL) consisted of: 3 μL DNA template (50–100 ng / mL), 10 μL 2×Rapid Tap Master Mix (Vazyme), 0.3 μL upstream primer (20 ng / μL), 0.3 μL downstream primer (20 ng / μL), and 6.4 μL ddH2O. The PCR amplification program was as follows: pre-denaturation for 5 min (94 ℃); denaturation for 15 s (94 ℃), annealing for 15 s (52 ℃–60 ℃), extension for 15 s (72 ℃), for a total of 32 cycles; extension for 5 min, followed by holding at 4 ℃. A 3% agarose gel was prepared for gel electrophoresis to detect the amplification products. The gel imaging system was then used to photograph and record the results, and the band types were statistically analyzed. DNA was extracted from six different cassava plants of each variety as biological replicates.

[0040] Experimental results showed that all cassava varieties were successfully amplified, and the electrophoresis results of some cassava varieties were as follows: Figure 2As shown in Table 3, the banding patterns of all cassava varieties are statistically analyzed. W14 exhibits a 195 bp band, wild Suriname cassava exhibits a 267 bp band, while other varieties show bands ranging from 297 to 300 bp. W14 and wild Suriname cassava can be distinguished by comparing the band positions. This indicates that the InDel marker primer pair cp22 can specifically identify W14 and / or wild Suriname cassava from 26 cassava varieties. This result suggests that the InDel marker has potential application value in the identification of specific germplasm and in maternal genetic studies.

[0041] Table 3. Stripe types of 26 cassava varieties

[0042]

[0043] The specific embodiments of the present invention have been described in detail above, but they are merely examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. An InDel marker primer pair, characterized in that, The InDel marker primer pair comprises F: AAAAACGACACAAATTCGATACAA and R: TCCGAATCAAGAGATTTGTTAGAC.

2. A kit characterized in that, It comprises the InDel marker primer pair of claim 1.

3. The kit of claim 2, wherein It further comprises reagents required for performing PCR reaction and / or electrophoresis.

4. Use of the InDel marker primer pair of claim 1, or the kit of claim 2 or 3 in identifying cassava variety w14 and / or wild cassava Suriname.

5. A method for distinguishing between cassava varieties w14 and / or wild cassava Suriname, characterized in that, The InDel marker primer pair of claim 1, or the kit of claim 2 or 3 is used.

6. The method of claim 5, wherein, It comprises the following steps: (1) extracting DNA from cassava leaves to be tested; (2) performing PCR amplification on the cassava leaf DNA using the InDel marker primer pair of claim 1, or the kit of claim 2 or 3; (3) if the presence of a 195bp target band or target fragment is identified in the product to be tested, the product to be tested is cassava variety w14; if the presence of a 267bp target band or target fragment is identified in the product to be tested, the product to be tested is wild cassava Suriname.

7. A method for identifying cassava variety w14 and / or wild cassava surinam from a cassava sample, characterized in that, The InDel marker primer pair of claim 1, or the kit of claim 2 or 3 is used.

8. The method of claim 7, wherein, It comprises the following steps: (1) extracting DNA from cassava leaves to be tested; (2) performing PCR amplification on the cassava leaf DNA using the InDel marker primer pair of claim 1, or the kit of claim 2 or 3; (3) if the presence of a 195bp target band or target fragment is identified in the product to be tested, the product to be tested is cassava variety w14; if the presence of a 267bp target band or target fragment is identified in the product to be tested, the product to be tested is wild cassava Suriname; if the presence of a 297-300bp target band or target fragment is identified in the product to be tested, the product to be tested is a variety other than cassava variety w14 and wild cassava Suriname.

Images