SSCP (single strand conformation polymorphism) molecular marker related to rice grain traits and application of SSCP molecular marker

Abstract

The invention provides an SSCP molecular marker related to rice grain traits and application of the SSCP molecular marker, and belongs to the technical field of molecular biology and genetic breeding. The invention provides an SSCP (single strand conformation polymorphism) molecular marker related to rice grain traits, which is located at the 37bp position of SEQ ID NO.1, and the polymorphism is T / C; the grain traits comprise any one or more than two of endosperm traits, amylose content and amylopectin chain length. The SSCP molecular marker provided by the invention can accurately identify endosperm traits, amylose content, amylopectin length and the like of rice grains, can be used for breeding excellent rice varieties, and has the advantages of high detection efficiency, high accuracy, convenience in operation and lower cost. The SSCP molecular marker provided by the invention is beneficial to clarification of a molecular basis for formation of the powderness endosperm, and also provides a technical support for precise selection of rice quality breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to an SSCP molecular marker related to rice grain traits and its application. Background Technology

[0002] Rice is a crucial food crop in my country, and its yield and quality directly impact national food security and people's living standards. In recent years, with the widespread application of hybrid rice technology, rice yields have significantly increased. However, improving rice quality, especially endosperm traits, still faces many challenges. Floury endosperm, a common type of rice endosperm, directly affects the processing quality, appearance, and taste of rice. Therefore, elucidating the formation mechanism of floury endosperm and identifying related genes has significant theoretical and applied value.

[0003] Floury endosperm in rice is typically characterized by loosely arranged and loosely structured starch granules, severely impacting rice milling quality and market value. Existing research indicates that the formation of floury endosperm is closely related to the composition, content, and accumulation patterns of starch and protein in the endosperm, particularly the content of amylose, the structure of amylopectin, and the distribution of storage proteins. Therefore, regulating the expression of genes related to floury endosperm through genetic means is one effective approach to improving rice quality.

[0004] Discovering key genes closely related to floury endosperm traits and developing corresponding polymorphic molecular markers will help to quickly and accurately identify target plants in the early stages of breeding, thus accelerating the breeding process of high-quality and high-yield new rice varieties.

[0005] However, there is currently a lack of a low-cost, high-sensitivity molecular marker tool that can be used in the early stages of breeding to enable rapid detection of polymorphisms in floury endosperm-related genes, thereby supporting efficient and precise selection in rice quality breeding. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide an SSCP molecular marker related to rice grain traits, which can accurately identify rice grain traits and thus facilitate the breeding of rice with superior grain traits.

[0007] The objective of this invention is achieved through the following technical solution: This invention provides an SSCP molecular marker associated with rice grain traits, wherein the SSCP molecular marker site is located at the 37th bp of SEQ ID NO.1 and has a polymorphism of T / C; The grain traits include any one or more of the following: endosperm traits, amylose content, and amylopectin chain length.

[0008] Preferably, the grain properties also include any one or more of the following: gel consistency, viscosity, texture, and thermodynamic properties.

[0009] This invention provides a primer pair for detecting the SSCP molecular marker described in the above technical solution, consisting of an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0010] This invention provides a kit for detecting the SSCP molecular markers described in the above-described technical solution, comprising the primer pairs described in the above-described technical solution.

[0011] Preferably, the kit also includes buffer, dNTP mixture and DNA polymerase required for PCR reaction.

[0012] This invention provides the application of the SSCP molecular marker, primer pairs, or kit described in the above technical solutions in the identification of rice grain traits and / or in screening germplasm resources with different rice grain traits.

[0013] Preferably, when the SSCP molecular marker is C, the rice grains have a powdery endosperm and a low amylose content; when the SSCP molecular marker is T, the rice grains have a transparent endosperm and a high amylose content.

[0014] This invention provides a method for identifying the characteristics of rice grains, comprising the following steps: Using the genomic DNA of the rice plant to be tested as a template, PCR-SSCP analysis was performed using the primer pairs described in the above technical scheme, and the genotype of the rice plant to be tested was determined based on the polyacrylamide gel electrophoresis results.

[0015] This invention provides the application of the SSCP molecular marker, primer pair, or kit described in the above-mentioned technical solutions in rice breeding.

[0016] This invention provides a base sequence with SEQ ID NO.4 OsFE5 Application of genes in regulating rice grain traits.

[0017] The beneficial effects of this invention are: This invention provides a SSCP molecular marker associated with rice grain traits. The SSCP molecular marker site is located at 37 bp of SEQ ID NO.1, with a polymorphism of T / C. The grain traits include any one or more of endosperm traits, amylose content, and amylopectin chain length. The SSCP molecular marker provided by this invention can accurately identify rice grain endosperm traits, amylose content, and amylopectin length, and can be used for molecular marker-based selection of superior rice varieties. It has the advantages of high detection efficiency, high accuracy, convenient operation, and low cost. The SSCP molecular marker provided by this invention helps to elucidate the molecular basis of floury endosperm formation and also provides technical support for precise selection in rice quality breeding. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0019] Figure 1 It is a wild-type Nipponbare mutant. fe5 Comparison of seed morphology; A represents wild-type Nipponbare and mutant. fe5 Photo of 100 seeds, scale bar 10mm; B represents wild type and mutant. fe5 Comparison of brown rice morphology, scale bar 1mm; C represents wild type and mutant. fe5 Comparison of brown rice cross-sections, scale bar 1mm; D represents wild-type Nipponbare and its mutant. fe5 The scanning electron microscope results of the grains are shown in the following scale bars from top to bottom: 1 mm, 30 μm, and 10 μm. Figure 2 It is a wild-type Nipponbare mutant. fe5 Quality trait index diagram; A represents wild-type Nipponbare and mutant. fe5 Amylose content; B represents wild-type Nipponbare and its mutant. fe5 Total starch content; C represents wild-type Nipponbare and mutant. fe5 The viscosity of the gel; D and E represent the viscosity of wild-type Nipponbare and mutant gels at different urea concentrations. fe5 The expansion volume of refined rice flour; F represents wild-type Nipponbare and the mutant. fe5 The highest viscosity value, lowest viscosity value, and final viscosity value; G represents wild-type Nipponbare and the mutant. fe5 Thermodynamic property analysis; Figure 3 for OsFE5 Map-based cloning of genes; A is OsFE5 Initial location of the locus; B is OsFE5 Fine mapping of loci; in A and B, n represents the number of extreme individuals used for mapping; C is... OsFE5Gene structure. UTR: untranslated region, Intron: endon, Exon: exon; Figure 4 Wild-type Japanese Haru fe5 Amino acid sequence and secondary structure prediction of OsFE5 protein in mutants; Figure 5 Wild-type Japanese Haru fe5 Tertiary structure and domain prediction of OsFE5 protein in mutants; A is the predicted tertiary structure of OsFE5 protein; B is a schematic diagram of protein domains and amino acid alteration sites, S: serine, P: proline; Figure 6 For the determination of OsFE5 enzyme activity; A and B are reaction equations; C is the determination of enzyme activity at different post-flowering days; DAF: number of days after flowering; Figure 7 SSCP gel electrophoresis image of molecular markers; F: mutant fe5 M: Japan Sunny; Floury endosperm F2plants: with fe5 Nine endosperm plants with identical mutant phenotypes; Normal F2 plants: Nine normal endosperm plants with identical wild-type Nipponbare phenotypes; Figure 8 Wild-type Nipponbare, fe5 Seed morphology of mutants and overexpression lines; A is wild-type Nipponbare seed; B is mutant. fe5 Grains; C represents overexpression of OE#1; D represents overexpression of OE#2; scale bar is 10 mm. Detailed Implementation

[0020] This invention provides an SSCP molecular marker associated with rice grain traits, wherein the SSCP molecular marker site is located at 37bp of SEQ ID NO.1 and has a polymorphism of T / C; the grain traits include any one or more of endosperm traits, amylose content, and amylopectin chain length.

[0021] As an optional embodiment of the present invention, the grain properties further include any one or more of the following: gel consistency, viscosity, texture and thermodynamic properties.

[0022] The SSCP molecular markers provided by this invention are closely related to rice traits. When the SSCP molecular marker is C, the rice grains have a powdery endosperm, low amylose content, low grain gel consistency, low grain hardness, low brittleness, high viscosity, high elasticity, low chewiness, low adhesiveness, and low content of the long-chain and high content of the short-chain amylopectin. When the SSCP molecular marker is T, the rice grains have a transparent endosperm, high amylose content, high grain gel consistency, high grain hardness, high brittleness, low viscosity, low elasticity, high chewiness, high adhesiveness, and high content of the long-chain and low content of the short-chain amylopectin. Furthermore, when the SSCP molecular marker is C, the OsFE5 enzyme activity in rice is low; when the SSCP molecular marker is T, the OsFE5 enzyme activity in rice is high.

[0023] The SSCP molecular marker provided by this invention can accurately identify traits such as endosperm characteristics, amylose content, and amylopectin length in rice grains. It can be used for molecular marker-based breeding of superior rice varieties and has the advantages of high detection efficiency, high accuracy, convenient operation, and low cost.

[0024] This invention provides a primer pair for detecting the SSCP molecular marker described in the above technical solution, consisting of an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0025] This invention provides a kit for detecting the SSCP molecular marker described in the above-described technical solution, comprising the primer pairs described in the above-described technical solution. As an optional embodiment of this invention, the kit further comprises a buffer solution, a dNTP mixture, and DNA polymerase required for the PCR reaction.

[0026] This invention provides the application of the SSCP molecular marker, primer pairs, or kit described in the above-mentioned technical solutions in the identification of rice grain traits and / or in screening germplasm resources with different rice grain traits. As an optional embodiment of this invention, when the SSCP molecular marker is C, the rice grain has a powdery endosperm and low amylose content; when the SSCP molecular marker is T, the rice grain has a transparent endosperm and high amylose content. As an optional embodiment of this invention, when the SSCP molecular marker is C, the content of the long-chain amylopectin is low and the content of the short-chain amylopectin is high; when the SSCP molecular marker is T, the content of the long-chain amylopectin is high and the content of the short-chain amylopectin is low. As an optional embodiment of this invention, the rice to be tested includes Nipponbare rice and its mutant. fe5Rice populations obtained after rice hybridization. As an optional embodiment of the present invention, when the SSCP molecular marker is C, the rice grains have a powdery endosperm, low amylose content, low grain gel consistency, low grain hardness, low brittleness, high viscosity, high elasticity, low chewiness, low adhesiveness, and low content of the long-chain and high content of the short-chain amylopectin. When the SSCP molecular marker is T, the rice grains have a transparent endosperm, high amylose content, high grain gel consistency, high grain hardness, high brittleness, low viscosity, low elasticity, high chewiness, high adhesiveness, and high content of the long-chain and low content of the short-chain amylopectin.

[0027] This invention provides a method for identifying rice grain traits, comprising the following steps: using the genomic DNA of the rice plant to be tested as a template, performing PCR-SSCP analysis using the primer pairs described in the above technical solution, and determining the genotype of the rice plant to be tested based on the polyacrylamide gel electrophoresis results.

[0028] As an optional embodiment of the present invention, the PCR-SSCP analysis includes PCR amplification using the primer pair, obtaining amplification products, and then performing single-strand conformation polymorphism (SSCP) electrophoresis on the obtained amplification products. The electrophoresis results are then compared with those of mutants. fe5 Genotypes with the same banding pattern were marked as aa; those with banding patterns matching wild-type rice were marked as AA; heterozygous genotypes were denoted as Aa. Genotyping was performed on the plants in the population, and the presence or absence of the dominant gene A and the recessive gene a was detected based on the banding pattern of the specific molecular marker SSCP. Rice with genotype aa exhibited the same characteristics as the mutant. fe5 Consistent traits: Rice with genotype AA exhibits traits consistent with wild-type rice. That is, rice with genotype aa has a mealy endosperm, low amylose content, reduced long-chain amylopectin content, and increased short-chain amylopectin content; rice with genotype AA has a transparent endosperm, high amylose content, increased long-chain amylopectin content, and reduced short-chain amylopectin content. Furthermore, rice with genotype aa has a mealy endosperm, low amylose content, low grain viscosity, low grain hardness, low brittleness, high viscosity, high elasticity, low chewiness, low adhesiveness, and low long-chain and high short-chain amylopectin content. Rice with genotype AA has transparent endosperm, high amylose content, high grain viscosity, high grain hardness, high brittleness, low stickiness, low elasticity, high chewiness, high adhesiveness, high content of long-chain amylopectin, and low content of short-chain amylopectin.

[0029] This invention provides the application of the SSCP molecular marker, primer pairs, or kit described in the above-mentioned technical solutions in rice breeding. The SSCP molecular marker provided by this invention enables directional selection of endosperm traits during the breeding process and also provides a key technology for improving and cultivating specialized functional rice suitable for products such as rice flour.

[0030] This invention provides a base sequence with SEQ ID NO.4 OsFE5 Application of genes in regulating rice grain traits. The results of this invention, through examples, demonstrate that... OsFE5 Genes in mutants fe5 Overexpression in rice can improve mutants. fe5 The characteristics of rice cause its endosperm to transform into transparent endosperm and increase its amylose content.

[0031] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0032] Example 1 1. Mutant fe5 Identification and analysis A floury endosperm mutant was obtained by treating the japonica rice variety Nipponbare with ethyl methanesulfonate (EMS). fe5 This mutant rice, both brown and milled, exhibits a milky-white and opaque endosperm appearance. After multiple generations of cultivation, the mutant's endosperm phenotype remains stable. Under backlighting, wild-type brown rice grains show uniform translucency, while the mutant... fe5 Brown rice grains are milky white, with significantly reduced translucency (e.g.) Figure 1 (A). Observation under an optical microscope revealed that the wild type exhibited a transparent endosperm phenotype, while the mutant... fe5 It then exhibits a powdery endosperm phenotype ( Figure 1 B, Figure 1 (C)

[0033] In addition, scanning electron microscopy was used to observe wild-type and mutant strains. fe5 Cross-section of mature seeds after liquid nitrogen treatment and subsequent brittle fracture. Wild-type seeds were observed to have starch granules that were regular polygons, tightly packed with almost no gaps. Mutant fe5 The cross-section shows that the starch granules are spherical, uneven in size and loosely arranged, containing both complex starch granules and free starch granules, with cavities between the starch granules. Figure 1 (D).

[0034] 2. Mutants fe5 Quality trait analysis (1) Analysis of amylose and total starch content Preparation of wild-type and mutant fe5 100 mg of refined rice flour was weighed into a small beaker, 1 mL of anhydrous ethanol was added, followed by 9 mL of 1 mol / L sodium hydroxide solution, and the mixture was allowed to stand at room temperature for 24 hours. Simultaneously, 2.5 mL of 0.09 mol / L sodium hydroxide solution was added to another small beaker, and the same procedure was performed, allowing the mixture to stand for 24 hours. This beaker served as a blank control for the sample. The spectrophotometric counting value was set to 620 nm, and the absorbance of different samples was measured three times for each sample. The average value was calculated using a standard curve function to obtain the amylose content. The total starch content was determined using the Total Starch Content Assay Kit (spectrophotometric method) from Hefei Lier Biotechnology Co., Ltd., according to the instructions provided with the kit.

[0035] The results of the determination of amylose and total starch content showed that... Figure 2 As shown. Mutant fe5 The amylose content was significantly lower in the wild type compared to the wild type. Figure 2 In group A), the total starch content did not differ significantly. Figure 2 (B)

[0036] (2) Determination of gel consistency The consistency of the gel was determined according to the NY147-88 standard. Weigh 0.1 g of dried rice flour sample to constant weight and pour it into a long glass tube. Place the glass tube on a test tube rack and add 0.2 mL of thymol blue and 2 mL of 0.2 mol / L sodium hydroxide solution to the bottom of the glass tube. Gently shake to mix all the liquid and rice flour evenly. Open the water bath lid and vertically place the glass tube into boiling water. Select a glass bulb of matching size to plug the glass test tube. Clamp the glass tube with heat-insulating clamps, controlling the height of the rice gelatin to no more than two-thirds of the total height of the test tube, and allow the rice gelatin to gelatinize for 8 minutes. Then, let the glass tube stand at room temperature for 10 minutes until it is no longer hot to the touch, and then place it on ice for 30 minutes. Afterward, remove the glass tube and wipe it dry, then place it horizontally for 1.5 hours until the rice gelatin no longer flows, maintaining the ambient temperature between 23℃ and 27℃ during this period. The consistency of the gel was measured as the total length from the bottom of the test tube to the front of the rice gel. Two glass tubes were used for each sample.

[0037] The average length of wild-type rice gum is 80.53 mm, while that of the mutant is... fe5 The average length of the rice gum was 99.13 mm, and analysis of variance showed a significant difference between the two. This result indicates that the mutant gene may have affected the mutant. fe5 The rice's gel consistency, causing the gel consistency to decrease ( Figure 2 (C). The larger the length value of the rice paste, the longer the flow distance of the rice paste, the thinner the rice paste, and therefore the lower the viscosity.

[0038] (3) Structural analysis of amylopectin Weigh 10 mg of refined rice flour into a 1.5 mL centrifuge tube, and add 500 µL of 0M, 1M, 2M, 3M, 4M, 5M, 6M, 7M, and 8M urea solutions (adjusted to pH 6.0 with acetic acid), respectively. Set up three replicates for each concentration, and shake at 25℃ and 200 rpm for 24 h. Centrifuge at 8000 rpm for 15 min at room temperature, and let stand for 1 h. The swelling volume is a quantified measure of the solubility of rice flour in urea solution; swelling volume = 500 - supernatant volume.

[0039] The results showed that when the urea solution concentration was 0–3 M, the mutant… fe5 The solubility of refined rice flour was slightly lower than that of the wild type, but there was no significant difference between the two; at a urea solution concentration of 4 M, the mutant... fe5 The solubility suddenly increases and is greater than that of the wild type; at urea solution concentrations of 5–8 M, the mutant… fe5 Solubility was also greater than that of the wild type, but the difference was not significant. Figure 2 D, Figure 2 (E). This indicates that the mutant fe5 The structure of amylopectin changes compared to wild-type amylopectin.

[0040] (4) Viscosity analysis The viscosity profile of rice starch was determined using a Rapid Viscometer Analyzer (RVA, model: Newport Scientific 3-D, Septech Instruments Ltd., Australia) and analyzed using TCW (Thermal Cycle for Windows) software. When the moisture content of the refined rice flour was 12.0%, 3.0 g of rice flour and 25.0 mL of distilled water were added to a metal cup.

[0041] mutant fe5 All three parameters of RVA showed significant differences compared to the wild type. Specifically, the highest viscosity value increased significantly, while the lowest and final viscosity values ​​decreased significantly. Figure 2 (F). Because the amylopectin chain length distribution is closely related to the highest viscosity, and the proportion of short chains is positively correlated with it while the proportion of long chains is negatively correlated, it is speculated that this mutant gene may cause the mutant to... fe5 An increase in the content of the short-chain portion of amylopectin leads to an increase in the maximum viscosity. Other studies have shown a positive correlation between amylose content and maximum viscosity. fe5 A decrease in amylose content should indicate a decrease in its maximum viscosity, but... fe5The highest viscosity value was higher than that of the wild type, suggesting that the amylopectin chain length distribution plays a decisive role in viscosity parameters such as the highest viscosity. Furthermore, the amylose content was positively correlated with both the lowest and final viscosity; the significant decrease in both the lowest and final viscosity values ​​in the mutant indicates that the mutant... fe5 The amylose content decreased significantly, which is consistent with the previous conclusions.

[0042] (5) Analysis of texture and thermodynamic properties wild type and mutant fe5 Rice samples were prepared from mature grains according to GB / T 15682-2008. The texture data of the prepared rice samples were tested using a texture analyzer (model: TA-XTC-18, Shanghai Baosheng Co., Ltd.) and a cylindrical probe (model: TA / 36R, Shanghai Baosheng Co., Ltd.). The test method was set as a complete texture test of rice. During the test, the sample was placed in the extrusion device, with the probe positioned directly above the device. Each sample was tested in five replicates. After the test, the analysis was performed using the TA.XTC-18 software (Shanghai Baosheng Co., Ltd.) provided with the instrument.

[0043] The gelatinization temperature and other parameters of refined rice flour were determined using a differential scanning calorimeter (DSC, model: TAZnotruments 0604262Q, TA Instruments, USA). The instrument was calibrated using an indium temperature baseline, with an initial temperature of 30°C and an end temperature of 110°C, and ramp mode selected. The gelatinization temperature analysis software was TA Universal Analysis 20.0 (TA Instruments, USA), which is included with the instrument. Each sample was measured twice.

[0044] Wild type and mutant fe5 The results of texture determination are shown in Table 1. Wild-type Nipponbare and mutant... fe5 Thermodynamic property analysis results are as follows Figure 2 As shown in G.

[0045] Table 1 Wild type and mutant fe5 Texture determination results

[0046] For wild type and mutant fe5 After conducting full texture testing, all nine parameters showed significant differences (Table 1). Emphasis was placed on three parameters: brittleness, hardness, and viscosity. Mutants fe5 The hardness and brittleness of the mutant decreased compared to the wild type, while its stickiness increased. Amylose content was positively correlated with brittleness and hardness, and negatively correlated with stickiness. Therefore, it can be concluded that the mutant... fe5Compared to wild-type amylose, the content is lower. This is consistent with the previous conclusions.

[0047] Thermodynamic property analysis results show that, compared with the wild type, the mutant fe5 T p T e The numerical values ​​decreased significantly, ΔHg values ​​increased significantly, and T0 decreased, but the differences were not significant. Figure 2 (G in the gene). Amylose and amylopectin participate in influencing the thermodynamic properties of refined rice flour by jointly forming the starch crystal structure. This mutant gene causes changes in the amylose content and alters the chain length distribution of amylopectin.

[0048] 3. Mutants fe5 Genetic analysis and map-based cloning mutant fe5 The F1 hybrid population was obtained by crossing with the japonica rice variety Nipponbare. The F1 population was then self-crossed to obtain the F2 population, which included mutants. fe5 In the F2 genetic analysis population constructed from wild-type Nipponbare, the normal phenotype and the mutant phenotype had 1577 and 530 seeds, respectively. Calculations show that χ²... 2 =0.013<χ 2 0.05 =3.841, the chi-square result shows that the actual ratio matches the theoretical ratio of 3:1, therefore the mutant can be identified. fe5 The shape of the powdery endosperm is regulated by a single recessive gene.

[0049] With mutants fe5 A hybrid was constructed by crossing the indica rice variety Guiyin 206 (https: / / blog.sina.com.cn / s / blog_677ecbfb0100iyun.html). Ten plants with normal phenotype and ten plants with mutant phenotype were selected from the segregating population. DNA was extracted, and a mixed pool was constructed. BSA was used for localization, revealing that the mutation site was located between the RM145 marker and the 5JC198710009 marker on rice chromosome 5. Figure 3 (A). Fine mapping was performed using the remaining mutant single plants and molecular markers in Table 2, ultimately pinpointing a 103 kb interval between 5YS19640 and 5YS19743 (using the Nipponbare japonica rice genome as a reference genome, the reference genome website is https: / / www.gramene.org). Figure 3 (B). To further identify candidate genes, predictions were made using the bioinformatics website (https: / / www.gramene.org), revealing 17 open reading frames (ORFs) within this interval (Table 2). Through analysis of wild-type Nipponbare and... fe5Whole-genome resequencing of the mutant revealed a mutation in a gene within that region. First-generation sequencing confirmed a T-to-C substitution at position 37 bp in exon 18 of LOC_Os05g33570. This gene was named... OsFE5 ( Figure 3 (C)

[0050] OsFE5 The 18th exon base sequence is shown in SEQ ID NO.1, specifically as follows: GTGGGCATCTGTGGTGAACATGGTGGAGAGCCTCTG C CAGTCGCTTTCTTTGCGAAGGCTGGGCTGGACTATGTTTCTTGTTCGCCTTTCAG.

[0051] Table 2 Candidate genes within the target region

[0052] 4. Protein structure analysis and three-dimensional structure prediction The Uniprot website (https: / / www.uniprot.org / ) was used to analyze the domains and functional characteristics of the protein. The SWISS-Model website (https: / / swissmodel.expasy.org) was used to predict and map the secondary and tertiary structures of the protein. The results showed that in the mutant... OsFE5 The base substitution resulted in a mutation at amino acid position 851 of the protein sequence encoded by this gene, changing from serine to proline. Figure 4 The mutation did not alter the secondary structure of the protein. Figure 4 The overall spatial folding patterns of the wild-type and mutant proteins are somewhat similar, indicating that the mutation did not completely disrupt the core three-dimensional framework of the protein. However, there are significant conformational differences in the red helical region, forming a ring structure. Figure 5 The difference (A) lies in the domain that binds to phosphoenolpyruvate (PEP), and its alteration may affect PEP-related catalytic activity. Figure 5 (B)

[0053] 5. Determination and analysis of enzyme activity Wild-type (WT) and [other varieties] were collected at 5, 10, 15, 20, 25, and 30 days after flowering. fe5 For each mutant spikelet, take 8-10 seeds, remove the husks, and extract enzyme solutions according to the following steps and measure their activity.

[0054] Take 8-10 shelled seeds and add 400 µL of pre-cooled extraction buffer (containing 100 mM Tris-HCl, pH 8.0, 10 mM MgSO4, 1 mM EDTA, and 2 mM PI (K)). + The homogenate (containing 5 mM pyruvate, 14 mM 2-mercaptoethanol, and 1% (v / v) Sigma protease inhibitor) was ground in a mortar on ice. The homogenate was centrifuged at 42000 g for 3 minutes at 4°C, and the supernatant was collected and desalted by gel filtration before being used for PPDK activity assay. PPDK activity was detected spectrophotometrically at 30°C using a PEPC / malate dehydrogenase coupling method. The desalted extract was preheated at 30°C for 10 minutes before the assay to ensure sufficient thermal reactivation of PPDK, and the reaction was initiated by the addition of ATP.

[0055] OsFE5 Encoding pyruvate dikinase (PPDK), it catalyzes the reversible reaction of pyrophosphate, AMP, and phosphoenolpyruvate (PEP) to produce pyruvate and ATP. PEP is a core intermediate metabolite in the glycolysis / gluconeogenesis pathway. Figure 6 China A Figure 6 (B). Enzyme activity analysis at different days after flowering (DAF) showed that in the wild type, the enzyme activity of OsFE5 increased to a peak in the early stage (5-10 DAF) and then gradually decreased; however... fe5 The OsFE5 enzyme activity of the mutant was significantly lower than that of the WT mutant and continued to decrease. Figure 6 The mutation (C) indicates that this mutation severely weakens the catalytic function of OsFE5, leading to an obstruction of the conversion of pyruvate to PEP and abnormal carbon metabolic flux. Simultaneously, PPi accumulation occurs; and PPi accumulation inhibits the activity of AGPase (ADP-glucose pyrophosphorylase), a key enzyme in starch synthesis that produces ADP-glucose (the direct substrate of starch synthesis). In summary, fe5 The mutant weakens the catalytic function of OsFE5, thereby interfering with PEP-mediated carbon metabolism flux and inducing PPi accumulation to inhibit AGPase activity, thus producing a powdery endosperm.

[0056] Example 2: Endosperm phenotype and grain quality improvement and molecular-assisted breeding 1. Formulating breeding combinations Rice materials that need improvement and mutants fe5 Materials were hybridized to obtain F1 seeds, which were then self-crossed to obtain the F2 population. Note: Phenotypic segregation occurred in the F2 population; some individual plants exhibited the same phenotype as the mutant parents (meaty endosperm phenotype), while others showed the same phenotype as the normal parents.

[0057] 2. Select individual rice plants and extract DNA. The specific steps are as follows: Take approximately 200 mg of vigorously growing leaves or primary roots, chop them, and place them in a 2 mL centrifuge tube. Add 800 μL of CTAB extraction buffer and incubate at 65°C for 30 min. Add 800 μL of chloroform, shake vigorously to ensure complete reaction with the CTAB solution, and centrifuge at 8000–12000 rpm for 10 min at 4°C. Place the centrifuged sample on ice, and transfer approximately 400–600 μL of the supernatant to a 1.5 mL centrifuge tube. Add an equal volume of isopropanol and incubate at -20°C for approximately 0.5 h. After removing the sample, centrifuge at 8000 rpm for approximately 5 min at 4°C and discard the supernatant. Add 1 mL of 70% ethanol solution to the centrifuge tube to wash the precipitate, and centrifuge at 8000 rpm for 5 min at 4°C. Air dry the centrifuge tube at room temperature. Add 100–200 μL of double-distilled water and store at -20°C for later use.

[0058] 3. PCR amplification of the target fragment The primer pair sequences used to amplify the SSCP molecular marker are shown below: The upstream primer F is: 5'-GGTTAGCCTTTCACTGGAGC-3' (SEQ ID NO.2); The downstream primer R is: 5'-CCGACCTGAAAGGCGAACAA-3' (SEQ ID NO.3); The PCR reaction system (10 μL) is shown in Table 3.

[0059] Table 3 PCR reaction system (10 μL)

[0060] The PCR reaction procedure is shown in Table 4.

[0061] Table 4 PCR reaction procedure

[0062] 4. Single-strand conformational polymorphism (SSCP) electrophoresis Wild-type Nipponbare and mutant fe5 Since there are only single base polymorphism differences (SNPs), single-strand conformational polymorphism (SSCP) molecular markers were developed.

[0063] The specific operation process is as follows: (1) Prepare a 10% polyacrylamide gel solution as shown in Table 5 and slowly pour it into the gap between the two assembled glass plates.

[0064] Table 5 SSCP Formulation System

[0065] (2) After the adhesive in the gap between the glass plates has solidified, remove the agar sealing strip at the bottom, put the glass plate into the vertical electrophoresis tank, add 1× electrophoresis solution to the electrophoresis tank until the electrophoresis solution level is 0.5 cm higher than the lowest point of the concave plate, and slowly pull out the comb.

[0066] (3) Set the voltage to 300 V and the electrophoresis time to 30 min, and preheat the gel block until it is slightly warm.

[0067] (4) Take 0.4~1.2 μL of PCR product and add 15 μL of 2× loading buffer. Treat the product at 100℃ for 10 min using a PCR instrument, and then quickly place it on ice to cool the product.

[0068] (5) Quickly add 2.5 μL of the cooled denatured product to the sample well and complete the sample loading quickly. After the sample loading is completed, turn on the electrophoresis apparatus to start electrophoresis. Set the voltage to 250 V and electrophoresis for five minutes, then reduce the voltage to 100~150 V and continue electrophoresis.

[0069] (6) After electrophoresis, remove the gel block and stain it with 10% silver nitrate solution for 10 min. Treat the gel block with a colorimetric solution containing 1.5% NaOH, 0.019% NaHCO3 and 0.0375% formaldehyde until bands appear. Take a picture to record the banding results of SSCP. Figure 7 ).

[0070] After denaturation, the double-stranded amplification product forms two single-stranded DNA molecules, while retaining the undenatured double-stranded amplification fragment at the bottom edge of the gel image.

[0071] With mutant fe5 Genotypes with the same band pattern were marked as aa, those with the same band pattern as wild-type Nipponbare were marked as AA, and heterozygous genotypes were marked as Aa. Genotypes of plants in the population were identified, and the presence or absence of dominant gene A and recessive gene a was detected based on the band pattern of the specific molecular marker SSCP.

[0072] That is, the judgment rule is that if the band is the same as the wild type, it is judged as AA; if the band is different from the wild type, it is judged as AA. fe5 If the mutants are identical, the result is classified as aa; if the bands have two types, the result is classified as Aa.

[0073] Among them, the endosperm of the Normal F2 plants was transparent; the seeds of the nine Floury endosperm F2 plants were also floury, with milky white and opaque endosperm. The amylose content in the seeds of Normal F2 plants was significantly higher than that of the F2 plants with floury endosperm. The average length of rice gum in the seeds of Normal F2 plants was significantly lower than that in the F2 plants with floury endosperm. The amylopectin structure analysis results of the seeds of Normal F2 plants were the same as those of the wild-type plants; the amylopectin structure analysis results of the seeds of the F2 plants with floury endosperm were the same as those of the mutants. fe5 Plant viscosity analysis of F2 plants with mealy endosperm showed that the highest viscosity value was significantly higher than that of Normal F2 plants, while the lowest and final viscosity values ​​were significantly lower. The hardness, brittleness, chewiness, and adhesiveness of F2 plant kernels were significantly lower than those of Normal F2 plants; however, their viscosity and elasticity were significantly higher.

[0074] Example 3 Gene complementation experiment For details on the pUN1301 vector, please refer to the reference [Jin X, Chen J, Khan A, et al. Triacylglycerollipase, OsSG34, plays an important role in grain shape and appearance quality in rice[J]. The Plant Journal, 2024, 117(3): 840-855.].

[0075] Constructed using homologous recombination method OsFE5 Overexpression vector. Using wild-type Nipponbare spikelet cDNA as a template, the target gene sequence was amplified to include the Sma I restriction site found on the pUN1301 vector. Homologous recombination with the pUN1301 vector yielded the overexpression vector pUN1301-. FE5 The bacteria were transferred into Agrobacterium EHA105 to obtain recombinant bacteria, which can also be called bacteria carrying pUN- FE5 Agrobacterium.

[0076] Target gene OsFE5 The CDS is shown in SEQ ID NO.4, specifically as follows: C CAGTCGCTTTCTTTGCGAAGGCTGGGCTGGACTATGTTTCTTGTTCGCCTTTCAGGGTCCCAATTGCTAGGCTAGCTGCAGCTCAGGTGCTCCTCTGA.

[0077] In the above sequence information, the bolded and unbolded portions represent different exons. The bolded bases marked by horizontal lines represent wild-type Nipponbare and... fe5 The difference in bases of this gene between mutants.

[0078] Select fe5 Brown rice was disinfected with 75% alcohol for 1 minute, then soaked in 20% sodium hypochlorite solution for 20 minutes, and then rinsed thoroughly with sterile water. After drying in a laminar flow hood, it was placed on induction medium and cultured for 5-8 days to obtain callus tissue. The cultured tissue contained pUN- FE5 Agrobacterium, adjusting the OD of the bacterial solution 600 =0.2~0.4, co-cultured with callus tissue. The callus tissue was isolated from the co-culture medium and transferred to selection medium. It was cultured in the dark at 28℃ for 2 weeks until new granular resistant callus tissue appeared. After one week of pre-differentiation, it was transferred to differentiation medium until the callus tissue germinated green spots and grew into seedlings. The seedlings were planted, and finally, seeds of the overexpressing positive plants were harvested.

[0079] Wild-type rice Nipponbare (WT) with a floury endosperm mutant fe5 The overexpression (OE) material constructed using this gene was used as the experimental subject, planted under the same conditions, and its seeds were harvested at maturity for subsequent phenotypic observation and comparison.

[0080] The results are as follows Figure 8 As shown, the brown rice grains of both wild-type Nipponbare (WT) and overexpression (OE) materials exhibit a translucent appearance; in stark contrast, the floury endosperm mutant... fe5 The grains exhibit a distinctly milky-white, powdery texture. This result indicates that... fe5 The loss of gene function led to the formation of powdery endosperm traits, while overexpression of this gene could effectively restore the transparent phenotype of grains, thus confirming the key role of this gene in maintaining normal rice grain development.

[0081] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SSCP molecular marker associated with a grain trait in rice, characterized in that, The SSCP molecular marker site is located at 37bp of SEQ ID NO. 1, and the polymorphism is T / C; The grain traits include any one or two or more of endosperm traits, amylose content and amylopectin chain length.

2. The SSCP molecular marker according to claim 1, characterized in that, The grain traits also include any one or two or more of gel consistency, stickiness, texture and thermodynamic properties.

3. A primer pair for detecting the SSCP molecular marker of claim 1 or 2, characterized in that, The primer pair comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

4. A kit for detecting the SSCP molecular marker of claim 1 or 2, characterized by, The kit further comprises a buffer, a dNTP mixture and a DNA polymerase required for PCR reaction.

5. The kit of claim 4, wherein 6. The SSCP molecular marker of claim 1 or 2, the primer pair of claim 3, or the kit of claim 4 or 5 is used in identification of rice grain traits and / or in screening of germplasm resources with different rice grain traits. When the SSCP molecular marker is C, the rice grain has a chalky endosperm and low amylose content; and when the SSCP molecular marker is T, the rice grain has a transparent endosperm and high amylose content.

7. Use according to claim 6, characterized in that, The method comprises the following steps:

8. A method for identifying the characteristics of rice grains, characterized in that, The genotype of the rice plant to be tested is determined by using the primer pair of claim 3 to perform PCR-SSCP analysis on the genomic DNA of the rice plant to be tested, and by judging the result of polyacrylamide gel electrophoresis.

9. The SSCP molecular marker of claim 1 or 2, the primer pair of claim 3, or the kit of claim 4 or 5 is used in rice breeding. OsFE5 10. A gene having a base sequence of SEQ ID NO. 4 ​ application in regulating rice grain traits.

Images