Application of SNP (Single Nucleotide Polymorphism) molecular marker as well as camellia oleifera peel thickness detection method and camellia oleifera breeding method

Abstract

The invention is a divisional application, and the application number of the original application is 2023118696897. The invention discloses application of an SNP (Single Nucleotide Polymorphism) molecular marker as well as a camellia oleifera peel thickness detection method and a camellia oleifera breeding method. The SNP molecular marker is positioned at 329bp of a sequence shown in SEQ ID NO: 1, and a nucleotide base is C or G; the thickness of the camellia oleifera pericarp can be quickly and accurately identified through the SNP molecular marker related to the thickness of the camellia oleifera pericarp. The camellia oleifera breeding period can be shortened, the camellia oleifera yield, economic benefits and commercial value can be improved, a theoretical breeding foundation is laid for people to plant high-yield large-fruit camellia oleifera in the future, a reference is provided for related research of other camellia oleifera peel thicknesses, and the method has important theoretical guiding significance for the camellia oleifera industry in China.

Description

[0001] This application is a divisional application of the original application with the application date of December 29, 2023, the application number of 2023118696897, and the invention name of: a SNP molecular marker related to the thickness of oil tea fruit peel and its application. TECHNICAL FIELD

[0002] The present application belongs to the field of agricultural molecular biology, and specifically relates to the use of a SNP molecular marker, and a detection method and breeding method for the thickness of oil tea fruit peel. BACKGROUND

[0003] Oil tea is a woody oil crop, widely distributed in the middle and lower reaches of the Yangtze River, with a long history of cultivation. Gaohzhou oil tea (Camellia drupifera) belongs to large fruit oil tea, and has the advantages of large fruit, high kernel oil content, tall plant, and high fruit setting rate compared with ordinary oil tea (Camellia oleifera), with high yield potential. However, the fruit peel will occupy more energy for accumulation of fruit peel thickness during fruit growth, which restricts the accumulation of kernel and oil. If the fruit peel thickness can be predicted early in the early breeding stage, the cultivation of fruit peel thin varieties can make up for the waste of resources in the later production.

[0004] However, the genetic background of oil tea is complex, the gene heterozygosity is high, the breeding cycle is long, the efficiency is low, and the fruit peel thickness is a quantitative trait controlled by multiple genes, which brings great difficulty to the breeding of oil tea and the study of its genetic rules. Moreover, traditional methods require continuous tracking and detection of each sample for many years, which is time-consuming and labor-intensive. If individuals can be selected at the genomic level early on without relying on phenotypic information, selection efficiency can be significantly improved, breeding progress can be accelerated, and selection time can be shortened. Therefore, there is an urgent need to provide a method for rapid discrimination of oil tea fruit peel thickness using molecular markers. SUMMARY

[0005] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application provides a SNP molecular marker related to the thickness of oil tea fruit peel.

[0006] The present application also provides a primer set for detecting the above-mentioned SNP molecular marker.

[0007] The present application also provides a kit.

[0008] The present application also provides a gene chip.

[0009] The present application also provides the application of the above-mentioned molecular marker, primer set, kit and / or gene chip.

[0010] The present application also provides a detection method for the above-mentioned SNP site.

[0011] This invention also proposes a method for detecting the thickness of camellia peel.

[0012] According to a first aspect of the present invention, a SNP molecular marker related to the thickness of Camellia oleifera pericarp is proposed, said SNP molecular marker comprising at least one of the following (1)-(10):

[0013] (1) The first SNP molecular marker is located at nucleotide 27899742 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is A or C;

[0014] (2) The second SNP molecular marker is located at nucleotide 27899812 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;

[0015] (3) The third SNP molecular marker is located at nucleotide 27900267 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;

[0016] (4) The fourth SNP molecular marker, which is located at nucleotide 27900460 on chromosome HIC_4 of the Camellia oleifera reference genome, and the nucleotide base at this site is T or C;

[0017] (5) The fifth SNP molecular marker, which is located at nucleotide 27900829 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;

[0018] (6) The sixth SNP molecular marker, wherein the sixth SNP molecular marker is located at nucleotide 27901276 on chromosome HIC_4 of the Camellia oleifera reference genome, and the nucleotide base at this site is C or G;

[0019] (7) The seventh SNP molecular marker, which is located at nucleotide 27901300 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is C or T;

[0020] (8) The eighth SNP molecular marker, wherein the eighth SNP molecular marker is located at nucleotide 27901344 on chromosome HIC_4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;

[0021] (9) The ninth SNP molecular marker, wherein the ninth SNP molecular marker is located at nucleotide 27902119 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is T or G;

[0022] (10) The tenth SNP molecular marker, wherein the tenth SNP molecular marker is located at nucleotide 27902242 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;

[0023] The reference genome of Camellia oleifera is the wild Camellia oleifera diploid (https: / / github.com / Hengfu-Yin / CON_genome_data) reference genome.

[0024] According to a second aspect of the present invention, a primer set for amplifying the above-mentioned SNP molecular markers is provided.

[0025] According to a third aspect of the present invention, a kit is provided comprising the aforementioned primer set.

[0026] According to a fourth aspect of the present invention, a gene chip is provided, the gene chip comprising the aforementioned primer set.

[0027] According to a fifth aspect of the present invention, the application of the above-described SNP molecular markers, primer sets, kits, and / or gene chips in any of the following 1)-10):

[0028] 1) Detect the thickness of the camellia peel;

[0029] 2) Identification and screening of Camellia oleifera with different peel thicknesses;

[0030] 3) Select and breed camellia varieties with a pericarp thickness of 4-7 mm;

[0031] 4) Select and breed camellia varieties with a pericarp thickness greater than 8mm;

[0032] 5) Select and breed camellia varieties with a pericarp thickness of 4-8 mm;

[0033] 6) Select and breed camellia varieties with a pericarp thickness of less than 4 mm;

[0034] 7) Select and breed camellia varieties with a pericarp thickness greater than 12mm;

[0035] 8) Molecular marker-assisted breeding of Camellia oleifera;

[0036] 9) Camellia oleifera breeding;

[0037] 10) Prepare products for Camellia oleifera breeding.

[0038] In some embodiments of the present invention, the application is in the genotyping of Camellia oleifera.

[0039] According to a sixth aspect of the present invention, a method for detecting the thickness of Camellia oleifera pericarp using the above-mentioned SNP molecular markers is provided, the method comprising the following steps:

[0040] S1. Extracting genomic DNA from Camellia oleifera;

[0041] S2. Perform polymorphism detection of the SNP molecular marker on the genomic DNA extracted in step S1, and determine the thickness of the camellia peel based on the detection results.

[0042] In some embodiments of the present invention, when the SNP molecular marker is the first SNP molecular marker, if the detected site base is A, the thickness range of the Camellia oleifera pericarp is 4~7mm; if the detected site base is C, the thickness of the Camellia oleifera pericarp is greater than 8mm.

[0043] When the SNP molecular marker is the second SNP molecular marker, if the detected site base is G, the thickness of the Camellia oleifera pericarp is 4-8 mm; if the detected site base is A, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is less than 4 mm.

[0044] When the SNP molecular marker is the third SNP molecular marker, if the detected site base is G, the thickness of the Camellia oleifera pericarp is less than 4 mm; if the detected site base is A, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is 4-8 mm.

[0045] When the SNP molecular marker is the fourth SNP molecular marker, if the detected site base is T, the thickness of the Camellia oleifera pericarp is less than 4 mm; if the detected site base is C, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is 4-8 mm.

[0046] When the SNP molecular marker is the fifth SNP molecular marker, if the detected site base is G, the thickness of the Camellia oleifera pericarp is less than 4 mm; if the detected site base is A, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is 4-8 mm.

[0047] When the SNP molecular marker is the sixth SNP molecular marker, if the detected site base is C, the thickness of the Camellia oleifera pericarp is 4-8 mm; if the detected site base is G, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is less than 4 mm.

[0048] When the SNP molecular marker is the seventh SNP molecular marker, if the detected site base is C, the thickness of the Camellia oleifera pericarp is 4~7mm; if the detected site base is T, the thickness of the Camellia oleifera pericarp is greater than 8mm.

[0049] When the SNP molecular marker is the eighth SNP molecular marker, if the detected site base is G, the thickness of the Camellia oleifera pericarp is 4-8 mm; if the detected site base is A, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is less than 4 mm.

[0050] When the SNP molecular marker is the ninth SNP molecular marker, if the detected site base is T, the thickness of the Camellia oleifera pericarp is in the range of 4~8mm; if the detected site base is G, the thickness of the Camellia oleifera pericarp is greater than 12mm.

[0051] When the SNP molecular marker is the tenth SNP molecular marker, if the detected site base is A, the thickness of the Camellia oleifera pericarp is in the range of 4~7 mm; if the detected site base is G, the thickness of the Camellia oleifera pericarp is greater than 8 mm.

[0052] In some embodiments of the present invention, in step S1, the extraction of genomic DNA from Camellia oleifera is performed using a simplified CTAB method (hexadecyltrimethylammonium bromide method).

[0053] In some embodiments of the present invention, in step S2, sequencing is used to detect SNP sites.

[0054] A method for breeding Camellia oleifera includes the following steps: using the above-mentioned SNP molecular marker method to detect the pericarp thickness of Camellia oleifera, selecting Camellia oleifera with a pericarp thickness range of 4~7mm, Camellia oleifera with a pericarp thickness greater than 8mm, Camellia oleifera with a pericarp thickness range of 4~8mm, Camellia oleifera with a pericarp thickness less than 4mm, or Camellia oleifera with a pericarp thickness greater than 12mm for subsequent breeding.

[0055] The SNP molecular markers related to the thickness of Camellia oleifera fruit peel according to embodiments of the present invention have at least the following beneficial effects: The thickness of Camellia oleifera fruit peel can be rapidly and accurately identified through the SNP molecular markers of the present invention. This can shorten the Camellia oleifera breeding cycle and increase tea oil yield, economic benefits, and commercial value, laying a theoretical foundation for future cultivation of high-yield, large-fruited Camellia oleifera, and providing a reference for other related studies on Camellia oleifera fruit peel thickness, thus having significant theoretical guiding significance for my country's Camellia oleifera industry.

[0056] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0057] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0058] Figure 1 This is a graph showing the normality test results of the peel thickness phenotypic data in Example 1 of the present invention;

[0059] Figure 2 This is a graph showing the normality test results of the peel thickness phenotypic data in Example 1 of the present invention;

[0060] Figure 3 This is a Manhattan diagram showing the relationship between SNP locus genotypes and individual pericarp thickness in Example 1 of this invention.

[0061] Figure 4 This is an agarose gel electrophoresis image from Example 1 of the present invention, where M is the maker and 1-12 are PCR products, respectively.

[0062] Figure 5 This is a sequencing result diagram of SNP1 in Example 1 of the present invention;

[0063] Figure 6 This is a sequencing result diagram of SNP2 in Example 1 of the present invention;

[0064] Figure 7 This is a sequencing result diagram of SNP3 in Example 1 of the present invention;

[0065] Figure 8 This is a sequencing result diagram of SNP4 in Example 1 of the present invention;

[0066] Figure 9 This is a sequencing result diagram of SNP5 in Example 1 of the present invention;

[0067] Figure 10 This is a sequencing result diagram of SNP6 in Example 1 of the present invention;

[0068] Figure 11 This is a sequencing result diagram of SNP7 in Example 1 of the present invention;

[0069] Figure 12 This is a sequencing result diagram of SNP8 in Example 1 of the present invention;

[0070] Figure 13 This is a sequencing result diagram of SNP9 in Example 1 of the present invention;

[0071] Figure 14 This is a sequencing result diagram of SNP10 in Example 1 of the present invention. Detailed Implementation

[0072] The following will describe the concept and technical effects of the present invention clearly and completely with reference to the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0073] An embodiment of the present invention is: a SNP molecular marker related to the thickness of Camellia oleifera pericarp.

[0074] 1. Obtaining SNP molecular markers

[0075] (1) Selection of materials

[0076] The *Camellia oleifera* materials used in this invention were sourced from the Zhongkai *Camellia oleifera* base in Huizhou, and were harvested in late October 2022 (October 19-25), totaling 100 germplasm resources. The harvested fruits were uniformly oriented and intact across all three sides of the tree, with 30 fruits collected from each germplasm resource for phenotypic data collection. The harvested leaves were used for molecular library construction.

[0077] 2. Sample processing and phenotypic analysis

[0078] Phenotypic analysis of the pericarp thickness of 100 harvested samples of Camellia oleifera was performed. The specific analysis method is as follows: the pericarp of the Camellia oleifera was cut along the transverse diameter with a knife, and the widest and narrowest points were measured. Finally, the mean and standard deviation of three fruits were calculated. The results of the pericarp thickness of the 100 fruits are as follows. Figures 1-2 As shown.

[0079] 3. Genotype data collection and analysis

[0080] Genotypic data for all samples were obtained through sequencing, with the specific steps as follows:

[0081] (1) Genomic DNA was extracted from tea leaves using a modified CTAB method.

[0082] (2) Construction of RAD-seq library

[0083] The library construction method is referenced in (Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers), as follows:

[0084] 1) Digest the genome obtained in step (1) with Taq I and ligate the P1 adapter (containing barcode);

[0085] 2) Randomly interrupt and connect to connector P2;

[0086] 3) Sequences containing both P1 and P2 adapters were screened by PCR;

[0087] 4) Select fragments of 400bp-700bp for sequencing. On average, each sample yielded 3G of data, with an average sequencing depth of 15×.

[0088] 4. Genome-wide association analysis and locus mining

[0089] Genome-wide association analysis (GWAS) was performed using Plink software. Specifically, after quality control of the genome, highly homogeneous SNPs with minor allele frequencies ≥0.05 and locus integrity ≥0.8 were used as genotypes. GWAS was conducted using three software programs: TASSEL, FaST-LMM, and EMMAX, with the pericarp thickness of *Camellia oleifera* from Gaozhou as the phenotype, combined with genotype data. Ultimately, an association result was obtained for each variant locus. The calculated p-values ​​were further used to plot Manhattan plots, as shown below. Figure 3 As shown in Table 1, 10 SNP loci associated with the pericarp thickness of Camellia oleifera in Gaozhou were selected based on the P-value. The specific SNP locus information is shown in Table 1. The reference genome of Camellia oleifera is the wild Camellia oleifera diploid genome (https: / / github.com / Hengfu-Yin / CON_genome_data).

[0090] Table 1. Statistical information of 10 SNP sites

[0091]

[0092] 5. Correlation analysis between genotype and phenotype

[0093] After analyzing the phenotypes of the above 10 SNP markers and the pericarp thickness of 100 Camellia oleifera germplasm resources, it was found that the above SNP markers were significantly correlated with the pericarp thickness of Camellia oleifera. The range of pericarp thickness corresponding to different SNP markers is shown in Table 2.

[0094] Table 2

[0095]

[0096] 6. Specificity verification

[0097] The aforementioned 10 SNP molecular markers were used to genotype 20 different Camellia oleifera samples (completely different from the 100 Camellia oleifera samples mentioned above). The genotyping method is as follows:

[0098] (1) Collection of tea leaf samples from Gaozhou and extraction of DNA

[0099] The camellia oil leaf samples to be tested were from Gaozhou camellia oil from the Xinfeng base. Twenty samples were randomly selected, and DNA was extracted using a modified CTAB method.

[0100] (2) Amplify nucleotide fragments containing SNP sites

[0101] Using the genomic DNA extracted from the Gaozhou tea leaf samples as templates, the fragments were amplified using forward primer F and reverse primer R.

[0102] The primer sequences are as follows:

[0103] F:ATGGAATCTTCAGCAAAAACCAAGTTGG (SEQ ID NO:2);

[0104] R: CTTATAAAACTCCATGACACAGAAGTTGC (SEQ ID NO: 3).

[0105] (3) Sequencing to identify SNP loci genotypes

[0106] The PCR products obtained in the aforementioned steps were first detected by 1.5% agarose gel electrophoresis, and the result showed a single specific band (see...). Figure 4 The target fragment is 1311 bp, and then unidirectional sequencing is performed on a sequencer to identify the genotypes at positions 32, 53, 180, 211, 223, 329, 338, 364, 374, and 563 bp (i.e., the SNP markers of this invention) in the sequence of SEQ ID NO: 1. Exemplary diagrams of the sequencing peaks at the SNP sites are shown below. Figures 5-14 As shown.

[0107] The sequence SEQ ID NO:1 is as follows:

[0108]

[0109] The typing and phenotypic results of 20 Camellia oleifera samples are shown in Table 3-12.

[0110] Table 3

[0111]

[0112] Table 4

[0113]

[0114] Table 5

[0115]

[0116] Table 6

[0117]

[0118] Table 7

[0119]

[0120] Table 8

[0121]

[0122] Table 9

[0123]

[0124] Table 10

[0125]

[0126] Table 11

[0127]

[0128] Table 12

[0129]

[0130] The test results are shown in Tables 3-12. As can be seen from the tables, the SNP molecular markers of the present invention can be accurately used for the detection of Camellia oleifera peel thickness, and can realize the rapid breeding of varieties with different Camellia oleifera peel thicknesses.

[0131] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.

Claims

1. Use of a SNP molecular marker, characterized in that, The SNP molecular marker is located at 329bp of the sequence shown in SEQ ID NO:1, and the nucleotide base is C or G. The SNP molecular marker is used in any one of the following 1) to 7): 1) detecting the thickness of the fruit peel of Camellia oleifera; 2) identifying and screening Camellia oleifera with different fruit peel thickness; 3) breeding Camellia oleifera with fruit peel thickness greater than 8mm; 4) breeding Camellia oleifera with fruit peel thickness in the range of 4-8mm; 5) breeding Camellia oleifera with fruit peel thickness less than 4mm; 6) Camellia oleifera breeding; 7) preparing products for Camellia oleifera breeding; The Camellia oleifera breeding is Camellia oleifera fruit peel thickness breeding. When the SNP molecular marker detects that the base at the site is C, the fruit peel thickness of Camellia oleifera is in the range of 4-8mm, when the base at the site is detected to be G, the fruit peel thickness of Camellia oleifera is greater than 8mm, and when the site is detected to be a heterozygous genotype, the fruit peel thickness is in the range of less than 4mm.

2. Use according to claim 1, characterized in that, The sequences of the primer set for detecting the SNP molecular marker are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. A method for detecting the thickness of the fruit peel of Camellia oleifera using SNP molecular markers, characterized in that, The SNP molecular marker is located at 329bp of the sequence shown in SEQ ID NO:1, and the nucleotide base is C or G. The method for detecting the thickness of the fruit peel of Camellia oleifera by using the SNP molecular marker comprises the following steps: S1, extracting genomic DNA from Camellia oleifera; S2, detecting the polymorphism of the SNP molecular marker on the genomic DNA extracted in step S1, and determining the fruit peel thickness of the Camellia oleifera to be tested according to the detection result; When the SNP molecular marker detects that the base at the site is C, the fruit peel thickness of Camellia oleifera is in the range of 4-8mm, when the base at the site is detected to be G, the fruit peel thickness of Camellia oleifera is greater than 8mm, and when the site is detected to be a heterozygous genotype, the fruit peel thickness is in the range of less than 4mm.

4. The method of claim 3, wherein, In S1, the genomic DNA is extracted from Camellia oleifera by using the simplified CTAB method.

5. The method of claim 3, wherein, In S2, the polymorphism is detected by sequencing.

6. A method for breeding of Camellia oleifera, characterized in that, The method comprises the following steps: using the method of any one of claims 3-5 to select Camellia oleifera with fruit peel thickness in the range of 4-8mm or Camellia oleifera with fruit peel thickness less than 4mm for subsequent breeding.

Images