Pharmaceutical formulations for treatment of crystalline-like retinal degeneration

By optimizing the buffer system, stabilizer, and salt ion concentration of the recombinant AAV virus formulation, the problems of formulation instability and retinal inflammation were solved, achieving a therapeutic effect with high titer stability and low inflammatory response, which meets pharmacopoeia standards.

CN121646483APending Publication Date: 2026-03-10CHIGENOVO CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-08-09
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Existing recombinant AAV virus formulations lack stability and safety in their formulation component selection, resulting in unstable viral titers, easy aggregation, reduced activity during freeze-thaw cycles and high temperatures, and the potential to trigger retinal inflammatory reactions, thus affecting treatment efficacy.

Method used

A stable drug formulation is formed by using a combination of specific types of buffer systems (such as phosphate buffer), specific types of stabilizers (such as poloxamer 188), specific salt ion concentrations, and pH values. This formulation contains recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, and phosphate. The formulation of the drug composition is optimized to improve stability and safety.

Benefits of technology

This study achieved high titer stability of recombinant AAV virus, reduced AAV aggregates, improved gene expression after multiple freeze-thaw cycles, and reduced local retinal inflammation, meeting pharmacopoeia standards and enhancing the safety and efficacy of clinical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

Pharmaceutical formulations for the treatment of crystalline-like retinal degeneration (BCD) comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate and water for injection, and having a pH of 7.0-7.6. The pharmaceutical preparation has extremely good virus titer stability, extremely few AAV aggregates, high mRNA expression of target genes after multiple freezing and thawing and / or excellent high-temperature stability, animal in-vivo experiments prove that the formula preparation has excellent performance in the aspect of reducing local inflammatory response of retina, and further clinical tests prove that the formula preparation has good clinical application prospects in the aspect of reducing local inflammatory response of retina. The pharmaceutical preparation provided by the invention conforms to the technical specifications of related safety and effectiveness of Chinese pharmacopoeia and United States Pharmacopoeia (USP).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a pharmaceutical composition for subretinal intravesical injection to treat crystalline retinal degeneration (BCD), comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, and phosphate buffer. Background Technology

[0002] Bietti's crystalline dystrophy (BCD) is a rare retinal degeneration disease characterized by the presence of a lens (a transparent covering) in the cornea, small, yellow or white crystalline deposits in the light-sensitive tissues of the retina, and progressive atrophy of the retina, choroidal capillaries, and choroid. These deposits damage the retina, leading to gradual vision loss. Research indicates that BCD is a genetic disorder caused by mutations in the CYP4V2 gene. It is generally believed that these mutations disrupt the function of enzymes involved in fatty acid metabolism, thus affecting lipid breakdown.

[0003] The applicant previously filed Chinese patent CN113106124B, which discloses a recombinant AAV virus expressing CYP4V2, comprising an AAV (adeno-associated virus) vector that expresses a polynucleotide encoding CYP4V2 via a promoter. Experiments have demonstrated that this recombinant AAV vector exhibits good expression performance, rapid expression speed, and more stable expression intensity. It can be expressed not only in retinal retinopathy (RPE) cells but also effectively in the photoreceptor layer, demonstrating a broad expression range. It can effectively reduce lipid deposition in CYP4V2 gene-mutant RPE cells, thus enabling its use in the treatment of benign prostatic hyperplasia (BCD).

[0004] In drug development and application, formulation components play a crucial role in the stability and compatibility of the drug's biologically active ingredients. For formulations containing recombinant AAV virus, unsuitable formulations may cause instability of the AAV capsid protein, leading to the release of the genome, which can be reflected in viral titer stability; or they may cause AAV aggregation, forming aggregates, which can be reflected in AAV particle size (see [link to relevant documentation]). Figure 1 Meanwhile, formulations containing recombinant AAV virus may undergo repeated freeze-thaw cycles and high-temperature processes during manufacturing, transportation, and use, which poses challenges to the stability of the formulations.

[0005] In July 2021, the US gene therapy company Adverum suspended its clinical trial of the AAV gene therapy drug ADVM-022 for the treatment of diabetic retinopathy macular edema (DME) due to serious adverse reactions such as inflammation in the subjects. Therefore, recombinant AAV viral agents, especially when administered ocularly, must have low immunostimulatory activity to be suitable for clinical application. Furthermore, immune responses can significantly reduce transduction efficiency, which can decrease the efficacy of the administered gene therapy and / or require higher doses.

[0006] For gene therapy products using AAV as a vector, there are no fixed formulations and excipients in this field, because the effects of various excipients on the stability, safety, and efficacy of different types of AAV products are often unpredictable. It is necessary to design and conduct experimental studies based on the specific properties of the recombinant AAV virus in order to find a suitable, safe, stable, and effective formulation.

[0007] Regarding the recombinant AAV viral vector for treating BCD in the aforementioned Chinese patent CN113106124B, since it is usually administered via subretinal injection, there is a need to develop a pharmaceutical formulation / injection composition for treating crystalline retinal degeneration that has good stability, safety (e.g., low retinal irritation) and efficacy. Summary of the Invention

[0008] Therefore, the problem solved by this invention is to provide a pharmaceutical formulation for treating crystalline retinal degeneration, which has excellent viral titer stability, very few AAV aggregates, high mRNA expression of the target gene after multiple freeze-thaw cycles, and / or excellent high-temperature stability. In vivo animal experiments have demonstrated that the formulation of this invention performs excellently in reducing local retinal inflammation. Further clinical trials have demonstrated that the pharmaceutical formulation of this invention complies with the relevant safety and efficacy technical specifications of the Chinese Pharmacopoeia and the United States Pharmacopeia (USP).

[0009] The solution to this problem is based on the fact that the inventors have discovered that, for the AAV gene therapy drug of the present invention, specific types of buffer systems (such as phosphate buffer systems), specific types of stabilizers (such as poloxamer, especially poloxamer 188), specific salt ion concentrations, specific pH values, or combinations thereof are crucial for obtaining a stable, safe and minimally irritating ocular (retinal) formulation.

[0010] Therefore, a first aspect of the present invention relates to a pharmaceutical preparation comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate and water for injection, and wherein the pH of the pharmaceutical preparation is approximately 7.0 to 7.6.

[0011] In some embodiments, the recombinant AAV virus comprises an AAV vector (i.e., a packaged recombinant AAV genome) that expresses a polynucleotide encoding CYP4V2 via a promoter. Preferably, the AAV vector comprises, in a 5' to 3' orientation, a promoter, a polynucleotide encoding CYP4V2, and a polyadenylate signal site, wherein the promoter is operatively linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.

[0012] In some embodiments, the CAG promoter comprises the nucleotide sequence shown in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises the amino acid sequence shown in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises the nucleotide sequence shown in SEQ ID NO: 3; and / or the polyadenylation signal site comprises a BGH polyA signal, preferably the nucleotide sequence shown in SEQ ID NO: 4; more preferably, the AAV vector further comprises a Kozak sequence as shown in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding CYP4V2; most preferably the AAV vector further comprises the same or different ITR sequences on the 5' side of the CAG promoter and on the 3' side of the polyadenylation signal site, preferably the ITR sequence is from AAV2.

[0013] In some embodiments, the AAV vector comprises, in the 5' to 3' orientation, the following genomic sequence: ITR-CAG-Kozak-CYP4V2-BGH-ITR, preferably including the genomic sequence shown in SEQ ID NO: 6; and / or the serotype of the capsid protein of the recombinant AAV virus is AAV8. In a preferred embodiment, the capsid protein of the recombinant AAV virus is the AAV8 capsid protein, which is composed of 60 capsid protein subunits, wherein the capsid protein subunits comprise VP1 as shown in SEQ ID NO: 7, VP2 as shown in SEQ ID NO: 8, and VP3 as shown in SEQ ID NO: 9, in an amino acid sequence of 1:1:10.

[0014] In some embodiments, the pharmaceutical preparation is in the form of an injectable aqueous solution, and / or the titer of the recombinant AAV virus in the pharmaceutical preparation is about 1.0 × 10⁻⁶. 11 vg / ml to approximately 1.0×10 13 vg / ml, preferably about 2.0×10 11 vg / ml to approximately 8.0 × 10 12 vg / ml, more preferably about 2.5×10 11 vg / ml to approximately 2.0 × 1012 vg / ml, for example, approximately 2.5 × 10 11 vg / ml, approximately 1.0×10 12 vg / ml and approximately 2.0 × 10 12 vg / ml, preferably about 2.5×10 11 vg / ml, approximately 5.0 × 10 11 vg / ml or approximately 1.0 × 10 12 vg / ml.

[0015] In some embodiments, the poloxamer includes poloxamer 188, preferably at a concentration of about 0.0001% by weight to about 0.01% by weight, more preferably about 0.0002% by weight to about 0.005% by weight, and most preferably about 0.001% by weight, based on the weight of the pharmaceutical preparation.

[0016] In some embodiments, the concentration of sodium chloride in the pharmaceutical preparation (injectable aqueous solution) is from about 120 to about 360 mM, preferably from about 150 mM to about 180 mM, and most preferably about 150 mM.

[0017] In some embodiments, the phosphate is selected from disodium hydrogen phosphate or its hydrate, sodium dihydrogen phosphate or its hydrate, dipotassium hydrogen phosphate or its hydrate, potassium dihydrogen phosphate or its hydrate, sodium phosphate or its hydrate, potassium phosphate or its hydrate, or any combination thereof, preferably a combination of disodium hydrogen phosphate or its hydrate and sodium dihydrogen phosphate or its hydrate, or a combination of dipotassium hydrogen phosphate or its hydrate and potassium dihydrogen phosphate or its hydrate, more preferably a combination of disodium hydrogen phosphate or its hydrate (disodium hydrogen phosphate dodecahydrate) and sodium dihydrogen phosphate or its hydrate (sodium dihydrogen phosphate monohydrate), preferably with a molar ratio of about 1:10 to about 10:1, more preferably about 1:5 to about 5:1, for example about 1:1 or about 8:2; and / or the concentration of the phosphate in the pharmaceutical preparation, based on all phosphates in the pharmaceutical preparation, is about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably about 10 mM to about 20 mM, and most preferably about 10 mM.

[0018] In some embodiments, the pH of the pharmaceutical preparation of the present invention is about 7.0 to 7.6, preferably about 7.0, about 7.2, about 7.3 or about 7.6, and most preferably about 7.3.

[0019] In some embodiments, the pharmaceutical preparation is in the form of an injectable aqueous solution, comprising the recombinant AAV virus, about 120 to about 360 mM of sodium chloride, about 0.001% by weight of poloxamer 188, about 10 mM of phosphate and water for injection, wherein the phosphate comprises disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pH is about 7.3.

[0020] In some embodiments, the pharmaceutical preparation is in the form of an injectable aqueous solution, comprising the recombinant AAV virus, about 150 mM sodium chloride, about 0.001% by weight of poloxamer 188, about 10 mM phosphate and water for injection, and having a pH of about 7.3, wherein the phosphate comprises about 8 mM disodium hydrogen phosphate dodecahydrate and about 2 mM sodium dihydrogen phosphate monohydrate.

[0021] In some embodiments, the pharmaceutical preparation is a colorless, clear, and transparent liquid, and / or has an osmotic pressure of about 270 to about 330 mOsmol / kg.

[0022] In a second aspect, the present invention relates to a method for treating, alleviating, and / or preventing diseases or conditions associated with retinal pigment epithelium (RPE) atrophy, the method comprising administering to a subject a therapeutically effective amount of the pharmaceutical preparation described above.

[0023] In some embodiments, the disease or condition is crystalline retinal degeneration (BCD).

[0024] In some implementations, the subject is a human.

[0025] In some embodiments, the pharmaceutical preparation is administered via subretinal intravenous injection, preferably in a volume of about 50 to 300 μL; the dosage is about 1 x 10⁻⁶ μL. 10 vg / eye ~ approx. 1x10 12 vg / eye, preferably about 5×10 10 vg / eye ~ approx. 2.5×10 11 vg / eye.

[0026] The present invention also provides the pharmaceutical formulations described above for treating, alleviating and / or preventing diseases or conditions associated with retinal pigment epithelial (RPE) atrophy in subjects, preferably for treating, alleviating and / or preventing crystalline retinal degeneration (BCD), more preferably the subjects being humans.

[0027] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description

[0028] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, wherein: Figure 1 This is a schematic diagram showing the release of the genome due to the instability of the AAV capsid protein in the formulation and the formation of AAV aggregates; Figure 2 These are the particle size detection results of ZVS101e in different formulations; Figure 3 These are the denaturation curves of ZVS101e in different formulations; Figure 4 These are the aggregation curves of ZVS101e in different formulations; Figure 5 It is the mRNA expression of the target gene (CYP4V2) after freeze-thaw cycles with different formulations; Figure 6 It is the mRNA expression of the target gene (CYP4V2) after being placed at high temperature with different formulations; Figure 7 These are color photographs of the fundus of mice taken 2 weeks after subretinal drug administration in Example 4; Figure 8 These are color photos and OCT images of mouse eyes taken 2 weeks after subretinal drug administration in Example 5; Figure 9 This refers to the mRNA expression level of transgenic hCYP4V2 (human CYP4V2) in the retina and RPE layer of mice in each group in Example 5; Figure 10 This refers to the mRNA expression levels of endogenous mCYP4V3 in the retina and RPE layer of mice in each group in Example 5. Figure 11 This refers to the mRNA expression levels of the inflammatory factors mCD11b and mNLRP3 in the retina and RPE layer of mice in each group in Example 5; and Figure 12 This refers to the increase in the number of ETDRS letters in some patients in Example 7. Detailed Implementation

[0029] Terminology Definition Unless otherwise stated, the terms used herein have their general technical meanings as understood by those skilled in the art. For definitions and terms in this art, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).

[0030] In this application, the term "AAV" is the standard abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells, where some functions are provided by co-infected helper viruses. General information and reviews of AAV can be found, for example, Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169–228, and Berns, 1990, Virology, pp. 1743–1764, Raven Press, (New York).

[0031] In this application, the term "AAV vector" generally refers to a vector containing one or more polynucleotides of interest (or transgenes) flanked by an AAV terminal repeat sequence (ITR). When present in a host cell that has been transfected with a vector encoding and expressing the rep and cap gene products, such an AAV vector can be replicated and packaged into an infectious viral particle. The terms "recombinant AAV virus," "recombinant AAV viral particle," or "AAV vector particle" refer to a viral particle composed of at least one AAV capsid protein and a capsidized polynucleotide AAV vector. If the particle contains heterologous polynucleotides (i.e., polynucleotides other than the wild-type AAV genome, such as transgenes to be delivered to mammalian cells), it is generally referred to as an "AAV vector particle" or simply "AAV vector." Therefore, the production of AAV vector particles necessarily includes the production of AAV vectors such that the vector is contained within the AAV vector particle.

[0032] In this application, the term "promoter" generally refers to a deoxyribonucleic acid (DNA) sequence that enables the transcription of a specific gene. A promoter can be recognized by RNA polymerase, which initiates transcription to synthesize RNA. During RNA synthesis, the promoter can interact with transcription factors that regulate gene transcription, controlling the initiation time and extent of gene expression (transcription). A promoter comprises a core promoter region and a regulatory region, located in the regulatory sequence controlling gene expression, upstream of the gene transcription start site (at the 5' direction of the DNA antisense strand), and does not itself have a coding function.

[0033] In this application, the term "operable link" generally refers to placing a regulatory sequence necessary for the expression of a coding sequence in an appropriate position relative to the coding sequence to achieve the expression of the coding sequence. For example, the first nucleic acid sequence is operably linked to the second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. In some embodiments, this may refer to the arrangement of coding sequences and transcriptional control elements in an expression vector. The control elements may include promoters, enhancers, and termination elements. For example, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably linked to the coding sequence. In some embodiments, "operable link" may also refer to the linking of a target gene to a vector such that the transcriptional and translational control sequences within the vector perform their intended functions of regulating the transcription and translation of the target gene.

[0034] In this application, the term "CYP4V2" generally refers to a protein, which is member 2 of subfamily V of the cytochrome P450 family 4. The term "cytochrome P450," also known as cytochrome P450 or CYP450, generally refers to a family of heme proteins, belonging to the class of monooxygenases, involved in the metabolism of endogenous substances or exogenous substances including drugs and environmental compounds. Based on the degree of homology in their amino acid sequences, members are further divided into three levels: family, subfamily, and enzyme individual. The cytochrome P450 enzyme system can be abbreviated as CYP, where families are represented by Arabic numerals, subfamilies by uppercase letters, and enzyme individuals by Arabic numerals, such as CYP4V2 in this application. The human CYP4V2 gene (HGNC: 23198) is 19.28 kb in length, located at 4q35, and has 11 exons. It plays an important role in fatty acid metabolism (Kumar S., Bioinformation, 2011, 7:360-365). CYP4V2 is expressed in almost all tissues, but at high levels in the retina and retinal pigment epithelium, while it is expressed at slightly lower levels in the cornea and other tissues. Mutations in the CYP4V2 gene may be associated with crystalline retinopathy and / or posterior retinitis pigmentosa.

[0035] In this application, the term "polyadenylation sequence," also known as the polyadenylation tail or PolyA tail, generally refers to a single chain of tens to hundreds of adenosine nucleotides added to the 3' end of transcribed mRNA. Polyadenylation typically occurs during and after the transcription of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) in the cell nucleus, and this reaction is usually carried out by polyadenylation polymerase. In eukaryotes, polyadenylation is a mechanism that can break the 3' end of the mRNA molecule. The polyadenylation sequence can protect mRNA from exonuclease attack and is important for mRNA nuclear export, translation, and stability.

[0036] In this application, the term "polyadenylation signal site" generally refers to a base sequence located at the 3' end of messenger RNA (mRNA) that can be recognized by polyadenylation-associated cleavage factors. It is typically also a cis-regulatory signal on the mRNA. Generally, the tailing process (i.e., polyadenylation) begins after transcription termination. Under the regulation of the polyadenylation signal site, polyadenylation-associated cleavage factors add tens to hundreds of single adenosine nucleotides to the 3' UTR of the mRNA. Common tailing signals include SV40, BGH, HSV, and TK signals.

[0037] In this application, the term "prevention" generally refers to the prophylactic administration of a pharmaceutical preparation to a healthy subject to prevent the occurrence of a disease or condition. It may also include the prophylactic administration of a pharmaceutical preparation to a patient in the pre-treatment stage of an allergic disease to be treated. "Prevention" does not require the complete elimination of the possibility of the disease or condition occurring; in other words, "prevention" generally means a reduction in the likelihood of the disease or condition occurring in the presence of the administered pharmaceutical preparation.

[0038] In this application, the term "relief" refers to reducing, shortening, or delaying a symptom, disease, condition, or phenotype. The symptom, disease, condition, or phenotype may include subjective perceptions of the subject, such as pain, dizziness, or other physiological disturbances, or medically detectable indicators, such as lesions detected through medical testing.

[0039] In this application, the term "treatment" generally refers to a clinical intervention used to alter the natural processes of an individual or cell in a clinicopathological process. It may include improving disease status, eliminating lesions, or improving prognosis.

[0040] In this application, the term "about" includes the numerical value and refers to a range of acceptable deviations from a particular value, taking into account errors associated with the measurement of the numerical value (i.e., limitations of the measurement system), as determined by a person skilled in the art. For example, "about" may mean within one or more standard deviations of the value, or within ±30%, ±20%, ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, or ±0.5% of the numerical value. Invention Details CYP4V2 The AAV vector in this application may contain a polynucleotide encoding CYP4V2. In this application, CYP4V2 may comprise a class of proteins whose dysfunction or mutations in their encoding genes may lead to crystalline retinal degeneration, including but not limited to CYP4V2 or functional variants thereof from humans, chimpanzees, gorillas, rhesus monkeys, dogs, cattle, mice, rats, chickens, fruit flies, nematodes, or frogs. For example, the CYP4V2 may comprise human CYP4V2. In this application, the polynucleotide encoding CYP4V2 may encode the amino acid sequence shown in SEQ ID NO: 2. For example, the polynucleotide encoding CYP4V2 may encode an amino acid sequence that is at least 90% homologous to the amino acid sequence shown in SEQ ID NO: 2, such as any amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous.

[0042] In some cases, the polynucleotide encoding CYP4V2 described in this application may comprise a synonymous mutation of the naturally occurring polynucleotide encoding CTP4V2. In some cases, the polynucleotide encoding CYP4V2 described in this application may comprise the nucleotide sequence shown in SEQ ID NO: 3. For example, the polynucleotide encoding CYP4V2 may comprise a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID NO: 3, such as any polynucleotide sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous.

[0043] The 5' end of the polynucleotide encoding CYP4V2 in this application may contain a kozak sequence, for example, the kozak sequence may contain the nucleotide sequence shown in SEQ ID NO: 5.

[0044] Promoter The AAV vector described in this application may contain a promoter. In this application, the promoter may contain an RPE cell-specific promoter, a retinal cell-specific promoter, a corneal cell-specific promoter, an ocular cell-specific promoter, or a constitutive promoter. The promoter may also contain a mammalian β-actin promoter or a viral promoter. The promoter may also contain a CAG promoter (hybrid CMV early enhancer / chicken β-actin promoter, also known as a CAGGS promoter, CB promoter, or CBA promoter), a human β-actin promoter, a small CBA (smCBA) promoter, a CBS promoter or a CBh promoter, a short elongation factor 1α (EFS) promoter, an elongation factor 1α (EF-1α) promoter, a CMV promoter, a PGK promoter, a UBC promoter, a GUSB promoter, a UCOE promoter, a VMD2 (also known as BEST1) promoter, an OPEFS promoter, a CYP4V2 autopromoter, an RPE65 promoter, or a hybrid or derivative thereof. For example, the promoter may be a CAG promoter.

[0045] For example, the promoter may comprise the nucleotide sequence shown in SEQ ID NO: 1. For example, the promoter may comprise a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID NO: 1, such as any polynucleotide sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous.

[0046] In this application, the promoter can be operatively linked to the polynucleotide encoding CYP4V2. In some cases, the promoter can be located at the 5' end of the polynucleotide encoding CYP4V2.

[0047] Polyadenylation signal site In this application, the AAV vector may further include a polyadenylated acid (PAA) signal site. The PAA signal site may include an SV40 signal site, a BGH signal site, a WPRE signal site, a WPRE-SV40 signal site, a WPRE-BGH signal site, or a derivative thereof.

[0048] In some cases, the polyadenylated signal site can be recognized by polyadenylation-associated cleavage factors, thereby generating SV40 polyadenylated sequences, BGH signal polyadenylated sequences, HSV signal polyadenylated sequences, TK signal polyadenylated sequences, WPRE signal polyadenylated sequences, etc. For example, the polyadenylated signal site can be a BGH signal site, which may contain the nucleotide sequence shown in SEQ ID NO: 4. For example, the polyadenylated signal site may contain a nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID NO: 4, such as any polynucleotide sequence that is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous.

[0049] In some cases, the polyadenylate signal site may be located at the 3' end of the polynucleotide encoding CYP4V2.

[0050] Recombinant AAV virus expressing CYP4V2 In the pharmaceutical formulation of the present invention, the recombinant AAV virus includes an AAV vector expressing a polynucleotide encoding CYP4V2 via a promoter, wherein the AAV vector comprises, in a 5' to 3' orientation, a promoter, a polynucleotide encoding CYP4V2, and a polyadenylate signal site, wherein the promoter is operatively linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.

[0051] In a preferred embodiment, the CAG promoter comprises the nucleotide sequence shown in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises the amino acid sequence shown in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises the nucleotide sequence shown in SEQ ID NO: 3; and / or the polyadenylation signal site comprises a BGH polyA signal, preferably the nucleotide sequence shown in SEQ ID NO: 4; more preferably, the AAV vector further comprises a Kozak sequence as shown in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding CYP4V2; most preferably the AAV vector further comprises the same or different ITR sequences on the 5' side of the CAG promoter and on the 3' side of the polyadenylation signal site, preferably the ITR sequence is from AAV2.

[0052] In a more preferred embodiment, the AAV vector comprises the following genomic sequence in the 5' to 3' orientation: ITR-CAG-Kozak-CYP4V2-BGH-ITR, preferably comprising the genomic sequence shown in SEQ ID NO: 6.

[0053] In a preferred embodiment, the serotype of the capsid protein of the recombinant AAV virus is AAV8.

[0054] In a preferred embodiment, the capsid protein of the recombinant AAV virus expressing CYP4V2 of the present invention is the AAV8 capsid protein (see WO 03 / 052051A2). In a more preferred embodiment, the capsid protein of the recombinant AAV virus expressing CYP4V2 of the present invention is the AAV8 capsid protein, which is composed of 60 capsid protein subunits, said capsid protein subunits comprising (for example, in a ratio of 1:1:10) three capsid proteins, namely VP1 with the amino acid sequence shown in SEQ ID NO: 7, VP2 with the amino acid sequence shown in SEQ ID NO: 8, and VP3 with the amino acid sequence shown in SEQ ID NO: 9.

[0055] The method for producing recombinant AAV virus using the recombinant AAV viral vector described above is well known to those skilled in the art. In short, the method generally involves (a) introducing the AAV vector of the present invention (including a CYP4V2-expressing genome construct, i.e., the recombinant AAV genome to be packaged) into host cells, (b) introducing an AAV helper construct into host cells, wherein the helper construct includes viral functions lacking relative to the wild-type rAAV genome, and (c) introducing a helper viral construct into host cells. All functions required for AAV vector replication and packaging (such as the AAV rep protein and the AAV cap protein) need to be present to enable AAV genome replication and packaging into the AAV vector. The above introduction into host cells can be performed using standard molecular biology techniques and can be performed simultaneously or sequentially. Finally, the host cells are cultured to produce the AAV vector and purified using standard techniques. Typically, a three-plasmid system comprising (a), (b), and (c) above is co-transfected into host cells (e.g., 293F cells) and cultured in suspension without serum. Purification methods can include steps such as lysis clarification, affinity chromatography, ion exchange chromatography ultrafiltration, and filtration.

[0056] In a preferred embodiment, the recombinant AAV virus expressing CYP4V2 of the present invention can be prepared according to the methods described in CN113106124B and US17 / 812,425, and is a recombinant AAV2 / 8 virus.

[0057] Adjuvant (a) Sodium chloride In injectable formulations, sodium chloride typically functions to regulate osmotic pressure. In this invention, the inventors unexpectedly discovered through animal experiments that the sodium chloride concentration in AAV formulations has a significant impact on local retinal irritation in animals. AAV formulations containing inappropriate concentrations of sodium chloride can induce a local ocular immune response, causing inflammatory cell infiltration in the vitreous cavity and leading to cell damage, as confirmed by the mRNA expression levels of inflammatory factors.

[0058] Therefore, in a preferred embodiment, the concentration of sodium chloride in the pharmaceutical preparation (injection) of the present invention is from about 120 mM to about 360 mM, preferably from about 150 mM to about 180 mM, and most preferably from about 150 mM.

[0059] (b) Polosham Poloxamer, traded as Pluronic, is a high-molecular-weight nonionic surfactant. It is a triblock copolymer of polyoxyethylene-polyoxypropylene-polyoxyethylene (PEO-PPO-PEO), and its general formula is HO(C2H4O). a -(C3H6O) b -(C2H4O) a H, in which the polyoxyethylene chain is relatively hydrophilic and the polyoxypropylene chain is relatively lipophilic, the physical properties of the compound are different depending on the molecular weight and the proportion of ethylene oxide or propylene oxide in the molecule, therefore it is a nonionic polymeric surfactant.

[0060] Poloxamer 407 is composed of approximately 70% ethylene oxide and 30% propylene oxide, with an average molecular weight of 11,500 Da, a melting point of 56°C, and is odorless, tasteless, readily soluble in water, acids, and alkalis, and stable to metal ions. It exhibits a unique reverse thermogelation property, meaning it is a liquid at low temperatures and becomes a gel at body temperature. With low toxicity, minimal irritation, and good biocompatibility, it is an ideal material for controlled drug release and is widely used in medicine, pharmacy, and other fields. Poloxamer 407 has been used in ophthalmic gels such as ciprofloxacin lactate, levofloxacin, and diclofenac sodium.

[0061] Poloxamer 188 is commonly used in the pharmaceutical industry as a lubricant for emulsions, ointments, and suspensions; a solubilizer and dispersant for tablets or capsules; and also as a carrier for solid dispersions. Its average molecular weight ranges from 7680 to 9510 Da, and it is readily soluble in water regardless of molecular weight. While readily soluble in water, poloxamer 188 is insoluble or has very low solubility in propylene glycol, exhibiting strong surface activity and gelling properties. Poloxamer 188 is both lipophilic and water-soluble, dissolving in the aqueous phase and uniformly dispersed in the lipophilic polycaprolactone, forming a uniform porous structure on the surface of microspheres.

[0062] In this invention, the inventors unexpectedly discovered through formulation design and screening experiments that, for the recombinant AAV virus expressing CYP4V2 of this invention, poloxamer 188 showed significantly better performance than poloxamer 407 in terms of virus titer determination, freeze-thaw stability, high-temperature stability, and bioactivity detection in the formulation of this invention.

[0063] Therefore, in a preferred embodiment of the present invention, the pharmaceutical formulation of the present invention includes poloxamer as an excipient, particularly poloxamer 188, preferably at a concentration of about 0.0001% by weight to about 0.01% by weight, preferably about 0.0002% by weight to about 0.005% by weight, and most preferably about 0.001% by weight, based on the weight of the pharmaceutical formulation.

[0064] (c) Buffer solution Buffer solutions (buffered salt solutions) in pharmaceutical preparations are typically used to maintain the pH of the solution system from significant changes due to the addition of small amounts of acid or alkali. Commonly used buffer solutions include inorganic salt buffers (phosphates, carbonates, etc.) and organic salt buffers (acetates, citrates, succinates, glycines, maleates, etc.).

[0065] In this invention, the inventors unexpectedly discovered through formulation design and screening experiments that, for the recombinant AAV virus expressing CYP4V2 of this invention, phosphate showed significantly better performance than citrate in terms of virus titer determination, freeze-thaw stability, high-temperature stability, and bioactivity detection in the formulation of this invention.

[0066] Therefore, in a preferred embodiment of the present invention, the excipients comprising the pharmaceutical formulation of the present invention include phosphates, preferably selected from disodium hydrogen phosphate or its hydrate, sodium dihydrogen phosphate or its hydrate, dipotassium hydrogen phosphate or its hydrate, potassium dihydrogen phosphate or its hydrate, sodium phosphate or its hydrate, potassium phosphate or its hydrate, or any combination thereof, preferably a combination of disodium hydrogen phosphate or its hydrate and sodium dihydrogen phosphate or its hydrate, or a combination of dipotassium hydrogen phosphate or its hydrate and potassium dihydrogen phosphate or its hydrate, more preferably a combination of disodium hydrogen phosphate dodecahydrate and sodium dihydrogen phosphate monohydrate, preferably a molar ratio of about 1:10 to about 10:1, more preferably about 1:5 to about 5:1, for example about 1:1 or about 8:2. In another preferred embodiment, the concentration of the phosphate in the pharmaceutical formulation, based on all phosphates in the pharmaceutical formulation, is about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably about 10 mM to about 20 mM, and most preferably about 10 mM.

[0067] (d) pH value The pH value of injectable drug preparations is usually comparable to the physiological pH value of the human body, and is typically in the range of about 7.0 to about 7.6.

[0068] In this invention, the inventors discovered through formulation design and screening experiments that, for the recombinant AAV virus expressing CYP4V2 of this invention, the formulation at pH 7.3 showed significantly better performance in virus titer determination, freeze-thaw stability, high-temperature stability, and bioactivity assays. In particular, the inventors unexpectedly found that the formulation of this invention exhibited the highest expression level of the target gene (CYP4V2) mRNA after repeated freeze-thaw cycles (e.g., 5 times) at pH 7.3.

[0069] Therefore, in a preferred embodiment of the present invention, the pH of the pharmaceutical preparation of the present invention is about 7.0 to 7.6, preferably about 7.0, about 7.2, about 7.3 or about 7.6, and most preferably about 7.3.

[0070] Pharmaceutical preparation This invention provides a pharmaceutical formulation for treating crystalline retinal degeneration (BCD), comprising a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, with a pH of approximately 7.0 to 7.6.

[0071] In a preferred embodiment of the present invention, the pharmaceutical preparation of the present invention is in the form of an injectable aqueous solution, comprising the recombinant AAV virus, about 120 to about 360 mM of sodium chloride, about 0.001% by weight of poloxamer 188, about 10 mM of phosphate and water for injection, wherein the phosphate comprises disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pH is about 7.3.

[0072] In a preferred embodiment of the present invention, the pharmaceutical formulation is an injectable aqueous solution comprising the recombinant AAV virus, approximately 150 mM sodium chloride, approximately 0.001% by weight of poloxamer 188, approximately 10 mM phosphate, and water for injection, with a pH of approximately 7.3. The phosphate comprises approximately 8 mM disodium hydrogen phosphate dodecahydrate and approximately 2 mM sodium dihydrogen phosphate monohydrate. The sodium chloride, disodium hydrogen phosphate dodecahydrate, and sodium dihydrogen phosphate monohydrate in the above formulation of the present invention maintain a stable pH and ensure isotonicity between the formulation and plasma, thus guaranteeing the stability of the injection and the safety of medication. The amounts of each excipient in the above formulation are within the maximum limits specified by the NMPA / FDA and comply with the standards of Part II and Part IV of the 2020 edition of the Chinese Pharmacopoeia.

[0073] In a preferred embodiment of the present invention, the pharmaceutical preparation of the present invention is a colorless, clear, and transparent liquid with an osmotic pressure of about 270 to about 330 mOsmol / kg.

[0074] In a preferred embodiment of the present invention, the pharmaceutical formulation is in the form of an injectable aqueous solution, and / or the titer of the recombinant AAV virus in the pharmaceutical formulation is about 1.0 × 10⁻⁶. 11 vg / ml (vg / ml represents the number of viral genome copies per milliliter) to approximately 1.0 × 10⁻⁶. 13 vg / ml, preferably about 2.0×10 11 vg / ml to approximately 8.0 × 10 12 vg / ml, more preferably about 2.5×10 11 vg / ml to approximately 2.0 × 10 12 vg / ml, for example, approximately 2.5 × 10 11 vg / ml, approximately 1.0×10 12 vg / ml and approximately 2.0 × 10 12 vg / ml, preferably about 2.5×10 11 vg / ml, approximately 5.0 × 10 11 vg / ml or approximately 1.0 × 10 12 vg / ml.

[0075] In a particularly preferred embodiment, the pharmaceutical formulation of the present invention has the composition shown in Table A:

[0076] Therapeutic method The present invention also provides a method for treating, alleviating, and / or preventing diseases or conditions associated with retinal pigment epithelium (RPE) atrophy, the method comprising administering to a subject a therapeutically effective amount of the pharmaceutical preparation according to the present invention. Preferably, the pharmaceutical preparation is an injectable formulation.

[0077] In a preferred embodiment of the invention, the disease or condition is crystalline retinal degeneration (BCD).

[0078] In a preferred embodiment of the invention, the subject is a human.

[0079] In another preferred embodiment of the invention, the pharmaceutical preparation is administered via subretinal intracavitary injection, preferably in a volume of about 50 to 300 μL; the dosage is about 1 x 10⁻⁶. 10 vg / eye~1x10 12 vg / eye, preferably about 5×10 10 vg / eye ~ approx. 2.5×10 11 vg / eye. Subretinal drug delivery requires one or more fine needles, one or more syringes, and may be accompanied by vitrectomy.

[0080] For example, the dosage form of the pharmaceutical preparation of the present invention can be an injection, and its strength can be about 1.0 × 10⁻⁶. 12 vg / ml, 0.3 ml / bottle; or approximately 2.5 × 10 11 vg / ml, 0.3 ml / bottle. Example

[0081] For gene therapy products that use AAV8 as a vector to express CYP4V2 for the treatment of BCD, the inventors screened the types and concentrations of buffer salt ions, types of surfactants, pH, etc. in the injection formulation, involving a total of 18 different formulation combinations. The inventors also conducted virus titer determination, freeze-thaw stability, high temperature stability and bioactivity tests on the recombinant AAV virus (ZVS101e) expressing CYP4V2 in different formulation systems to determine the final formulation.

[0082] Example 1. Screening of pharmaceutical formulation components 1) Preparation of recombinant AAV virus expressing CYP4V2 Recombinant AAV virus expressing CYP4V2 was prepared according to the method described in CN113106124B or US17 / 812,425 to obtain recombinant AAV2 / 8 virus ZVS101e.

[0083] The product information for ZVS101e is as follows: Vector: AAV8 Genome sequence (ITR sequences at both ends, both from AAV2): ITR-CAG-kozak-CYP4V2-BGH-ITR The CAG promoter contains the nucleotide sequence shown in SEQ ID NO: 1; the amino acid sequence of CYP4V2 contains the amino acid sequence shown in SEQ ID NO: 2; the polynucleotide encoding CYP4V2 contains the nucleotide sequence shown in SEQ ID NO: 3; the BGH polyA signal contains the nucleotide sequence shown in SEQ ID NO: 4; the Kozak sequence is shown in SEQ ID NO: 5; and the ITR sequence is from AAV2. The above genome sequence is shown in SEQ ID NO: 6.

[0084] Capsid protein: AAV8 It is composed of 60 capsid protein subunits, wherein the capsid protein subunits contain VP1 with an amino acid sequence as shown in SEQ ID NO: 7, VP2 with an amino acid sequence as shown in SEQ ID NO: 8, and VP3 with an amino acid sequence as shown in SEQ ID NO: 9, in a ratio of 1:1:10.

[0085] 2) Formulation design and screening Two aqueous buffer systems were first designed: a phosphate buffer system and a sodium citrate buffer system. Simultaneously, two surfactant formulations were explored: poloxamer 188 and poloxamer 407 (BASF). Based on different salt ion concentrations, the following 12 formulations were designed for ZVS101e:

[0086] After configuration, use a 100 kDa ultrafiltration tube to filter the ZVS101e virus (target titer of 2.0 × 10⁻⁶). 12 (vg / mL) Ultrafiltration was performed into the 12 formulation buffers mentioned above. Specific ultrafiltration procedure: Take 0.5 mL of the original virus solution, fill with buffer to 15 mL, centrifuge until 0.5 mL remains, fill again, centrifuge until 0.5 mL remains. Finally, add buffer to 1.2 mL, aliquot into 0.1 mL vials, for a total of 12 vials.

[0087] (1) According to the method reported in the literature (Martinez-Fernandez de la Camara, C., et al. (2021). "Accurate Quantification of AAV Vector Genomes by Quantitative PCR." Genes (Basel) 12(4)), the viral titer of ZVS101e in different preparations was detected:

[0088] The results (Table 2) showed that the viral titer of ZVS101e in citrate buffer (Formulas 15 and 16) differed significantly from the target titer; the viral titer of ZVS101e in formulations using poloxamer 407 as a surfactant (Formulas 10 and 11) also differed significantly from the target titer (such differences not only distort experimental results and affect quantification, but also seriously affect product quality control); while the viral titer of ZVS101e in formulations using phosphate and poloxamer 188 as surfactants differed less from the target titer, making them more suitable as components of ZVS101e formulations.

[0089] (2) Results of particle size analysis of ZVS101e in different formulations The particle size and distribution of ZVS101e in different formulations were analyzed using an Unchained Labs Uncle all-in-one protein stability analyzer (brand: Unchained Labs; model: Uncle). Dynamic light scattering (DLS) results are shown (see...). Figure 2 The particle sizes of formulations 01, 03, 04, 05, 09, 10, 15 and 16 are between 26 and 29 nm, with only slight aggregation peaks; while the particle size distribution of formulations 06, 07, 08 and 11 is relatively discrete, with more obvious aggregation peaks.

[0090] (3) Detect the denaturation and aggregation curves of ZVS101e in different formulations. The denaturation and aggregation curves of ZVS101e in different formulations were detected using the Unchained Labs Uncle All-in-One Protein Stability Analyzer. The results are shown (see [link to results]). Figure 3 and Figure 4 The denaturation curves are quite similar, suggesting that the AAV conformation, denaturation process, titer, and buffer conditions are similar. A significant upward trend is observed near 70℃, indicating AAV aggregation. The aggregation curves show a significant increase in the aggregation degree of formulations 4, 6, and 8, suggesting the formation of larger aggregates.

[0091] (4) Summary The viral titer stability, particle size distribution, and aggregation of ZVS101e in different formulations were evaluated in the above experiments (see Table 3). Formulations 01, 03, 05, and 09 showed better performance. Therefore, further screening can be conducted under conditions of 10 mM–20 mM PB (phosphate buffer), 120–360 mM NaCl, 0.001% poloxamer 188, and pH 7.2.

[0092]

[0093] Example 2. Screening of salt ion concentration and pH in formulation To further determine the salt ion concentration and pH in the formulation, we designed six formulations and used a 2.0 × 10⁻⁶ pH value. 12 The target titer for ZVS101e injection was determined using vg / mL, as shown in the table below:

[0094] (pH 7.3 solution preparation: 10 mM PB includes approximately 8 mM disodium hydrogen phosphate dodecahydrate and approximately 2 mM sodium dihydrogen phosphate monohydrate; for other pH solutions, adjust the pH to pH 7.0 or pH 7.6 by adding appropriate amounts of 1M NaOH solution or 1M HCl solution to the pH 7.3 solution; P188 is poloxamer 188) We used Millipore 50 kD ultrafiltration centrifuge tubes to displace the purified ZVS101e stock solution into six different aqueous solutions listed in Table 4, with a target titer of 2.0 × 10⁻⁶. 12 After filtration through a 0.22 μm PVDF syringe with a concentration of vg / mL, the total volume was approximately 5 ml, which was then aliquoted into three vials, each containing approximately 1.4 ml. Freeze-thaw tests (1 freeze-thaw cycle and 5 freeze-thaw cycles) and high-temperature stability tests (37°C for 7 days) were performed. Sample stability was assessed by detecting genomic titer and target gene mRNA expression.

[0095] 1) Freeze-thaw test A) Genome titer Genomic titers were measured after one freeze-thaw cycle and after five freeze-thaw cycles, as shown in Table 5. The results showed that the genomic titers were normal after freeze-thaw replacement of all six solutions, and there were no significant differences among the six formulations.

[0096]

[0097] B) mRNA expression of the target gene (CYP4V2) Samples subjected to one freeze-thaw cycle and five freeze-thaw cycles were used for mRNA expression detection. The samples were infected with 293T cells at an MOI of 1e5. Cell lysis was performed after 3 days, and RNA was extracted using the TaKaRa MiniBEST Universal RNA Extraction Kit. The expression levels of the target gene mRNA and the internal reference gene mRNA (ACTB-β actin) were detected. The instrument used was an ABI 7500. The reverse transcription and qPCR detection kit was the HiScript II U+ One Step qRT-PCR Probe Kit, Vazyme, Q222-CN-00. Primers and probes were synthesized by Anhui General Biotechnology, with the following sequences (5'→3'): CYP4V2-qPCR-F ATTGTGAAGTGGCAGGTTACA (SEQ ID NO: 10) CYP4V2-qPCR-R GGGAAGTATCTCGGATCTCTG (SEQ ID NO: 11) CYP4V2-qPCR-P CATAGGGGAATGATGACGCTT (SEQ ID NO: 12) ACTB-qPCR-F CTGGCCACATTGTGAACTT (SEQ ID NO: 13) ACTB-qPCR-R AACGGTGAAGGTGACAGCA (SEQ ID NO: 14) ACTB-qPCR-P ATGCTCGCTCCAACCGAC (SEQ ID NO: 15) The mRNA expression results of the freeze-thaw test are shown in the figure. Figure 5 .

[0098] mRNA detection results showed that the mRNA expression in solution 18 (formulation 18, 150 mM NaCl, pH 7.3) and solution 19 (formulation 19, 150 mM NaCl, pH 7.6) was slightly higher, with the highest expression level in solution 150 mM NaCl, pH 7.3.

[0099] 2) High-temperature stability test A) Genome titer The genomic titers of the six formulations were measured at 0 point and after being placed at 37°C for 7 days, as shown in Table 6. The results showed that the titer of formulation 17 decreased slightly after being placed at 37°C for 7 days, while the other formulations showed no significant difference.

[0100]

[0101] B) mRNA expression of the target gene (CYP4V2) mRNA expression was detected in samples from six formulations at 0°C and after 7 days of incubation at 37°C (MOI=1e5). These samples were used to infect 293T cells, and lysed cells were harvested 3 days later. RNA was extracted and reverse transcribed to detect the expression levels of the target gene mRNA and the internal reference gene mRNA. The mRNA expression results after high-temperature incubation of different formulations are shown in the table below. Figure 6 .

[0102] Based on the mRNA expression results, mRNA was expressed under all conditions. After being placed at 37℃ for 7 days, the expression level of the 180 mM NaCl experimental groups (formulas 20, 21, and 22) gradually decreased with increasing pH; while the expression level of the 150 mM NaCl experimental groups (formulas 17, 18, and 19) remained relatively stable.

[0103] Taking into account the results of the above formulation stability screening tests, we selected formulation 18 as the formulation for further research on ZVS101e.

[0104] Example 3. Stability comparison study of ZVS101e and AAV8-Cas9 in formulation 18. To explore whether Formulation 18 is applicable to all AAV viruses with AAV8 serotype, or only to ZVS101e (AAV8 viral capsid and CYP4V2 expression vector), we conducted a comparative stability study of ZVS101e and AAV8-Cas9 (construction of AAV8-Cas9 is described in CN113038972B) in a formulation based on Formulation 18 (stability test conditions: storage < -60°C). The results are shown in Table 7.

[0105]

[0106] The results show that, after a 3-month stability study, ZVS101e showed good stability in formulation 18, while the genomic titer of AAV8-Cas9 decreased significantly in the same formulation.

[0107] Example 4. Comparison of short-term irritation from subretinal injection of different excipient solutions in wild-type mice We also evaluated the local ocular irritation of different formulations after subretinal injection in mice. Since local retinal inflammatory reactions caused by injection procedures or formulations can be observed through fundus photography, fundus photography was the main observation indicator in this experiment.

[0108] The experimental system consisted of 4-8 week old wild-type C57BL / 6J mice (commercially purchased from Vitaliva). The specific grouping and drug administration are shown in the table below:

[0109] (10 mM PB includes approximately 8 mM disodium hydrogen phosphate dodecahydrate and approximately 2 mM sodium dihydrogen phosphate monohydrate; P188 is poloxamer 188) Two weeks after the completion of subretinal intraretinal drug administration, fundus photography was performed to assess local retinal irritation. Fundus photography results showed ( Figure 7 Localized pigmentary degeneration was observed in the fundus of mice in all experimental groups, with slightly more severe degeneration in groups 1, 2, and 4. In other words, compared to the formulation (10 mM PB, 150 mM NaCl, 0.001% P188, pH 7.3), the formulation (10 mM PB, 150 mM NaCl, 0.001% P188, pH 7.3) caused significantly less irritation to the mouse retina, which was unexpected since the only difference between the two formulations was the NaCl concentration.

[0110] Example 5. Short-term safety comparison of different formulations of ZVS101e administered subretinally in BCD mice. To investigate whether the differences in retinal inflammatory responses induced by the above formulations persisted when AAV virus was present, we prepared two batches of ZVS101e injection using two different formulations. Batch 1 used a formulation of 10 mM PB, 150 mM NaCl, 0.001% P188, and pH 7.3; batch 2 used a formulation of 10 mM PB, 180 mM NaCl, 0.001% P188, and pH 7.3. To compare the safety of the two batches of drugs and their corresponding formulations, two weeks after subretinal injection in BCD mice (purchased from Beijing Biocytogen Biotechnology Co., Ltd., Cyp4v3- / -), fundus photography was used to observe local retinal inflammation, OCT was used to observe changes in retinal structure, and ERG was used to observe visual function. After the above in vivo tests, the mice were euthanized, and the left eye was used for paraffin sectioning to observe retinal tissue structure; the right eye was used to extract RNA to detect the mRNA expression levels of transgenic hCYP4V2 and inflammatory factors.

[0111]

[0112] The results of the fundus photography showed ( Figure 8 Compared to the control group without injection, all mice in the injection group showed local physical damage to the retina at the injection site, and local pigment degeneration was also observed in the fundus of the mice. The degree of retinal degeneration in the excipient-2 and batch-2 groups was more severe than that in the excipient-1 and batch-1 groups, respectively.

[0113] The retina and RPE layer of the right eye of mice in each group were separated, and RNA was extracted (TaKaRa, MiniBEST Universal RNA Extraction Kit) and reverse transcribed (TaKaRa, PrimeScript™ RT reagent Kit with gDNA Eraser) to detect the mRNA expression levels of transgenic hCYP4V2, endogenous mCYP4V3, and inflammatory factors. The detection instrument (ABI, 7500) and PCR detection kit (ABI, Real-Time PCR SYBR Master Mix) were used. PCR primers were synthesized at Suzhou Genewiz Biotechnology Co., Ltd., and their sequences are as follows: CYP4V2-qPCR-F AGTTCCAGCCTGAGCGGTTCTT (SEQ ID NO: 16) CYP4V2-qPCR-R CCTCAGGATGCACGAAAGAATGG (SEQ ID NO: 17) mCYP4V3-qPCR-F CTTAGCGAGGACTGTGAAGTGG (SEQ ID NO: 18) mCYP4V3-qPCR-R GAAAGAACCGCTCTGGTCGGAA (SEQ ID NO: 19) mACTB-qPCR-F CATTGCTGACAGGATGCAGAAGG (SEQ ID NO: 20) mACTB-qPCR-R TGCTGGAAGGTGGACAGTGAGG (SEQ ID NO: 21) mCD11b-qPCR-F TACTTCGGGCAGTCTCTGAGTG (SEQ ID NO: 22) mCD11b-qPCR-R ATGGTTGCCTCCAGTCTCAGCA (SEQ ID NO: 23) mNLRP3-qPCR-F TCACAACTCGCCCAAGGAGGAA (SEQ ID NO: 24) mNLRP3-qPCR-R AAGAGACCACGGCAGAAGCTAG (SEQ ID NO: 25) like Figure 9 , Figure 10 and Figure 11As shown, RNA level detection results indicated that both batch-1 and batch-2 could successfully express hCYP4V2 mRNA in mouse retina and RPE cells, with batch-1 showing higher expression efficiency; there was no significant difference in endogenous mCYP4V3 expression levels among the groups; inflammatory factor detection results showed that compared with excipient-1 and batch-1 groups, excipient-2 and batch-2 groups had higher expression levels of the inflammatory factor mNLRP3 in mouse retina and RPE, and increased levels of macrophage marker mCD11b in mouse retina of excipient-2 and batch-2 groups.

[0114] The above results further demonstrate that, for the gene therapy AAV product of the present invention, the formulation of 10 mM PB, 150 mM NaCl, 0.001% P188, and pH 7.3 is a safer, more stable, and more effective formulation.

[0115] Example 6. GLP safety pharmacology, pharmacokinetics, and toxicology studies of ZVS101e formulated with formulation 18 in cynomolgus monkeys and rats. Based on the above formulation stability screening test and mouse test, we selected formulation 18 as the formulation of ZVS101e.

[0116] To further verify the safety and efficacy of its clinical application, we conducted GLP safety pharmacology, pharmacokinetics and toxicology studies in cynomolgus monkeys and BN rats (the relevant GLP experiments were conducted by Zhaoyan (Suzhou) New Drug Research Center Co., Ltd.).

[0117] In cynomolgus monkeys, a single bilateral subretinal injection of the excipient (a separate formulation), low- and high-dose ZVS101e injection, was administered, with a recovery period of 13 weeks (see Table 10). No abnormalities related to the test product were observed in the cardiovascular, respiratory, and nervous systems of the animals. At 4 and 13 weeks post-administration, the viral genome was widely distributed in ocular tissues, with the highest distribution in the retina and choroid; and mRNA was expressed in most ocular tissues, with abundant mRNA expression in the choroid and retina. Histopathological results showed no gross abnormalities in the cynomolgus monkeys, except for mild or slight lymphocytic infiltration, local retinal layer disorder, atrophy, or hyperplasia in the high-dose group.

[0118]

[0119] In rats, a single bilateral subretinal injection of the excipient (a separate formulation), low- and high-dose ZVS101e injection (see Table 11), resulted in a recovery period of 13 weeks. At 4 and 13 weeks post-administration, the viral genome was widely distributed in ocular tissues, with the highest concentrations in the retina / choroid and sclera. mRNA was expressed in most ocular tissues, with high levels in the retina / choroid, sclera, and iris. No systemic toxicity was observed. Mild or mild dose-related retinal morphological or structural abnormalities were observed in the eye.

[0120]

[0121] The above results indicate that the formulation has good safety and local ocular tolerability when injected subretinally in rats and monkeys; at the same time, the diluted ZVS101e of the formulation also has good safety and can effectively infect and express the target gene mRNA in the retina.

[0122] Example 7. Human clinical safety and efficacy study of ZVS101e using formulation 18 as the formulation. Using formulation 18 as the formulation of ZVS101e, and after GMP-level production and strict QC quality control, as well as thorough and scientific in vivo and in vitro pharmacodynamic studies and GLP toxicology studies, ZVS101e has demonstrated significant preclinical safety and efficacy, which can effectively support its clinical application.

[0123] In 2021, we initiated a subretinal intraretinal drug delivery clinical trial (NCT04722107) of ZVS101e for patients with BCD at Beijing Tongren Hospital, Capital Medical University (7.5 × 10⁻⁶). 10 (vg / eye, dosage volume 150 μL / eye), this is the world's first clinical trial targeting BCD. Enrollment of all 12 patients has been completed, with 6 patients followed up for more than one year. No serious drug-related adverse reactions occurred in any subject during the study, demonstrating the good clinical safety of ZVS101e. Simultaneously, subjects showed improvement in visual function, with best-corrected visual acuity (BCVA) improving (Chaikitmongkol, V., et al. (2018). "Repeatability and Agreement of Visual Acuity Using the ETDRSNumber Chart, Landolt C Chart, or ETDRS Alphabet Chart in Eyes With or Without Sight-Threatening Diseases."). JAMA OphthalmolIndicators such as 136(3): 286-290 showed significant improvement, indicating that ZVS101e has good clinical efficacy (see results for some patients). Figure 12 ).

[0124] Those skilled in the art should understand that although the present invention has been specifically described with reference to the above embodiments, the present invention is not limited to these specific embodiments. Based on the methods and technical solutions taught in this invention, those skilled in the art can make appropriate modifications or improvements without departing from the spirit of the present invention, and the equivalent embodiments obtained therefrom are all within the scope of the present invention.

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

Claims

1. A pharmaceutical preparation comprising: a recombinant AAV virus expressing CYP4V2, sodium chloride, poloxamer, phosphate, and water for injection, and the pH of the pharmaceutical preparation is about 7.0-7.

6.

2. The pharmaceutical preparation according to claim 1, wherein the recombinant AAV virus comprises an AAV vector expressing a polynucleotide encoding CYP4V2 as a genomic sequence through a promoter, preferably the AAV vector comprises, in the 5’ to 3’ direction, in order: a promoter, a polynucleotide encoding CYP4V2, and a polyadenylation signal site, wherein the promoter is operably linked to the polynucleotide encoding CYP4V2, and preferably the promoter is a CAG promoter.

3. The pharmaceutical preparation according to claim 2, wherein the CAG promoter comprises the nucleotide sequence set forth in SEQ ID NO: 1; the amino acid sequence of CYP4V2 comprises the amino acid sequence set forth in SEQ ID NO: 2, preferably the polynucleotide encoding CYP4V2 comprises the nucleotide sequence set forth in SEQ ID NO: 3; and / or the polyadenylation signal site comprises a BGH polyA signal, preferably the nucleotide sequence set forth in SEQ ID NO: 4; more preferably, the AAV vector further comprises a Kozak sequence as set forth in SEQ ID NO: 5 between the CAG promoter and the polynucleotide encoding CYP4V2; most preferably the AAV vector further comprises identical or different inverted terminal repeat (ITR) sequences from AAV2 on the 5’ side of the CAG promoter and on the 3’ side of the polyadenylation signal site.

4. The pharmaceutical preparation according to any one of claims 2-3, wherein the AAV vector comprises the genomic sequence set forth in ITR-CAG-Kozak-CYP4V2-BGH-ITR, preferably the genomic sequence set forth in SEQ ID NO: 6, in the 5’ to 3’ direction; and / or the capsid protein of the recombinant AAV virus is of serotype AAV8.

5. The pharmaceutical preparation according to any one of claims 1-4, wherein the capsid protein of the recombinant AAV virus is an AAV8 capsid protein, which is composed of 60 capsid protein subunits comprising VP1 with the amino acid sequence set forth in SEQ ID NO: 7, VP2 with the amino acid sequence set forth in SEQ ID NO: 8, and VP3 with the amino acid sequence set forth in SEQ ID NO: 9, in a ratio of 1:1:

10.

6. The pharmaceutical preparation according to any one of claims 1 to 5, wherein the pharmaceutical preparation is in the form of an aqueous solution for injection, and / or the titer of the recombinant AAV virus in the pharmaceutical preparation is from about 1.0 x 10 11 vg / ml to about 1.0 x 10 13 vg / ml, preferably from about 2.0 x 10 11 vg / ml to about 8.0 x 10 12 vg / ml, more preferably from about 2.5 x 10 11 vg / ml to about 2.0 x 10 12 vg / ml, for example, about 2.5 x 10 11 vg / ml, about 1.0 x 10 12 vg / ml and about 2.0 x 10 12 vg / ml, also preferably about 2.5 x 10 11 vg / ml, about 5.0 x 10 11 vg / ml or about 1.0 x 10 12 vg / ml.

7. The pharmaceutical preparation according to any one of claims 1-6, wherein the poloxamer comprises poloxamer 188, preferably at a concentration of about 0.0001 wt% to 0.01 wt%, preferably about 0.0002 wt% to 0.005 wt%, most preferably about 0.001 wt%, by weight of the pharmaceutical preparation.

8. The pharmaceutical formulation of any one of claims 1 to 7, wherein the concentration of the sodium chloride in the pharmaceutical formulation is about 120 mM to 360 mM, preferably about 150 mM to 180 mM, most preferably 150 mM.

9. The pharmaceutical formulation of any one of claims 1 to 8, wherein 1) the phosphate salt is selected from disodium hydrogen phosphate or a hydrate thereof, sodium dihydrogen phosphate or a hydrate thereof, dipotassium hydrogen phosphate or a hydrate thereof, potassium dihydrogen phosphate or a hydrate thereof, sodium phosphate or a hydrate thereof, potassium phosphate or a hydrate thereof, or any combination thereof, preferably a combination of disodium hydrogen phosphate or a hydrate thereof and sodium dihydrogen phosphate or a hydrate thereof, or a combination of dipotassium hydrogen phosphate or a hydrate thereof and potassium dihydrogen phosphate or a hydrate thereof, more preferably a combination of disodium hydrogen phosphate or a hydrate thereof (e.g. disodium hydrogen phosphate dodecahydrate) and sodium dihydrogen phosphate or a hydrate thereof (e.g. sodium dihydrogen phosphate monohydrate), preferably in a molar concentration ratio of about 1:10 to about 10:1, more preferably about 1:5 to about 5:1, for example about 1:1 or about 8:2; and / or 2) the concentration of the phosphate salt in the pharmaceutical formulation is about 5 mM to about 50 mM, preferably about 8 mM to about 30 mM, more preferably about 10 mM to about 20 mM, most preferably about 10 mM, based on all phosphate salts in the pharmaceutical formulation.

10. The pharmaceutical formulation of any one of claims 1 to 9, in the form of an aqueous solution for injection, comprising the recombinant AAV virus, about 120 to about 360 mM sodium chloride, about 0.001% by weight of poloxamer 188, about 10 mM phosphate salt, and water for injection, the phosphate salt comprising disodium hydrogen phosphate and sodium dihydrogen phosphate, and the pH of the pharmaceutical formulation is about 7.

3.

11. The pharmaceutical formulation of claim 10, comprising the recombinant AAV virus, about 150 mM sodium chloride, about 0.001% by weight of poloxamer 188, about 10 mM phosphate salt, and water for injection, and the pH of the pharmaceutical formulation is about 7.3, wherein the phosphate salt comprises about 8 mM disodium hydrogen phosphate dodecahydrate and about 2 mM sodium dihydrogen phosphate monohydrate.

12. The pharmaceutical formulation of any one of claims 1 to 11, which is a colorless, clear, transparent liquid, and the osmotic pressure is about 270 ~ about 330 mOsmol / kg.

13. A method of treating, alleviating, and / or preventing a disease or disorder associated with retinal pigment epithelium (RPE) atrophy, the method comprising administering to a subject a therapeutically effective amount of the pharmaceutical formulation of any one of claims 1 to 12.

14. The method of claim 13, wherein the disease or disorder is Best’s crystalline retinopathy (BCD), preferably the subject is a human.

15. The method of claim 14, wherein the pharmaceutical preparation is for administration by subretinal cavity injection, preferably in a volume of about 50 to 300 μL; in an amount of about 1 x 10 10 vg / eye ~ 1 x 10 12 vg / eye, preferably about 5 x 10 10 vg / eye ~ about 2.5 x 10 11 vg / eye.

Citation Information

Patent Citations

  • Water-soluble foaming solid fragrance

    CN113038972B

  • AAV vectors expressing CYP4V2 and their applications

    CN113106124B

  • Vector and method for treating bietti's crystalline dystrophy

    US12065663B2

  • Adeno-associated virus (AAV) serotype 8 sequences, vectors containing same, and uses therefor

    WO2003052051A2