Beauveria bassiana strain with high yield of beauveria bassiana, microbial preparation and application of beauveria bassiana strain and microbial preparation in production of bombyx batryticatus
By screening and cultivating Beauveria bassiana strains with high beauveria bassiana yield, the problem of low beauveria bassiana yield in silkworm production was solved, and the content and yield of medicinal components in silkworm were significantly improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-10
- Publication Date
- 2026-03-13
AI Technical Summary
In existing technologies, the yield and quality of artificially produced silkworm pupae are low, and the production of beauveria bassiana is also low, resulting in a low yield of pupae and low content of medicinal components during the production process.
A strain of Beauveria bassiana with high beauveria bassiana yield (CCTCC No: M2022052) was screened and provided. Through liquid and solid fermentation culture, a highly efficient microbial preparation was prepared for the preparation of silkworm pupa, which improved the beauveria bassiana content and the yield of silkworm pupa.
It increased the yield of beauveria bassiana, with the beauveria bassiana content in the silkworm pupae reaching 0.023% to 0.034%, which is 2 to 3 times that of ordinary strains, significantly improving the content and yield of medicinal components in silkworm pupae.
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of silkworm production technology, and more specifically, relates to a Beauveria bassiana strain with high Beauveria bassiana yield, a microbial preparation, and its application in silkworm production. Background Technology
[0002] Beauveria bassiana is an entomopathogenic fungus belonging to the class Deuteromycetes. It possesses vegetative organs—hyphae—and reproductive organs—conidia. The hyphae are septate and branched. It can invade and multiply rapidly within more than 700 species of insects and mites belonging to 149 families and 521 genera across 15 orders. Simultaneously, it continuously produces beauveria bassiana and calcium oxalate crystals, which can cause insect poisoning, altering body fluid functions, disrupting metabolism, and ultimately leading to death. The dried body of the silkworm (Bombyx mori Linnaeus), a 4th-5th instar larva of the Bombyx mori family, is the dried body of the silkworm that dies after infection (or artificial inoculation) with Beauveria bassiana. [1] It is one of the commonly used bulk Chinese medicinal materials. Currently, the artificial inoculation of Beauveria bassiana to produce silkworm pupa often results in the poor lethality and virulence of the strain. [2] Different strains of Beauveria bassiana have different contents of metabolites. After the silkworm dies, Beauveria bassiana fails to inhibit the growth of bacteria in the silkworm's body, resulting in black-breasted silkworms and rotten silkworms, leading to a low yield and poor quality of rotten silkworms.
[0003] Beauveria bassiana extract is a metabolic product of Beauveria bassiana during its growth in silkworms, and it plays an important role in determining whether silkworms are infected with Beauveria bassiana. Beauveria bassiana extract possesses insecticidal, antitumor, antibacterial, antiviral, anticonvulsant, antituberculosis, and antimalarial effects. [3] This can be used as a quality evaluation indicator for silkworm pupa. However, the current strains of Beauveria bassiana used to produce silkworm pupa have poor lethality and low beauveria bassiana yield. Therefore, screening Beauveria bassiana strains with high beauveria bassiana yield and high performance beauveria bassiana yield has broad application prospects and great significance.
[0004] References:
[0005] [1] National Pharmacopoeia Commission. Pharmacopoeia of the People's Republic of China [S]. Volume I. Beijing: China Medical Science and Technology Press, 2015: 297-298.
[0006] [2] Jiang Xiujun, Li Lingli, Chai Jianping, et al. Isolation, identification and pathogenicity differences of pathogenic strains of silkworm in different silkworm areas of Yunnan [J]. Southwest China Journal of Agricultural Sciences, 1-12 [2024-07-23].
[0007] [3] Chen Wenwen, Hu Meibian, Peng Wei, et al. Research progress on beauvericin, an effective component in silkworm pupa [J]. China Pharmacy, 2019, 30(24):3452. Summary of the Invention
[0008] In response to at least one defect or improvement need in the prior art, the present invention provides a Beauveria bassiana strain with high beauveria bassiana yield, which aims to solve the problems of low yield and poor quality of artificially produced silkworm pupae.
[0009] To achieve the above objectives, according to one aspect of the present invention, a strain of Beauveria bassiana with high beauverinin production is provided, wherein the Beauveria bassiana strain is deposited by the China Center for Type Culture Collection (CCTCC) with accession number M2022052 and deposit date of January 17, 2022.
[0010] According to another aspect of the present invention, a microbial agent is also provided, the microbial agent containing the above-mentioned Beauveria bassiana strain, and / or, the fermentation product of the Beauveria bassiana strain, and / or, an extract of the fermentation product of the Beauveria bassiana strain.
[0011] Preferably, the microbial preparation contains mycelia and / or conidia of Beauveria bassiana strain.
[0012] According to another aspect of the present invention, a method for preparing the above-mentioned microbial preparation is also provided, the method comprising:
[0013] The Beauveria bassiana was inoculated into a liquid culture medium and cultured until the spores reached the inoculation concentration;
[0014] The spore liquid was transferred into a rice solid culture medium for solid fermentation. The rice solid culture medium was dried and sieved to separate the conidia.
[0015] Preferably, the liquid fermentation culture conditions are 26±1℃ and 120 rpm; the spore inoculation concentration is 10. 8 per mL.
[0016] According to another aspect of the present invention, a Beauveria bassiana strain as described in any of the above claims, or the use of the microbial preparation described in any of the above claims in the preparation of Bombyx mori (silkworm pupa) is also provided.
[0017] Preferably, the conidia produced by the fermentation of the Beauveria bassiana strain are used to inoculate 5th instar silkworms to prepare the silkworm pupa.
[0018] Preferably, the concentration of the conidia inoculated is 10. 6 Spores / mL.
[0019] Preferably, after inoculating silkworms, the culture is maintained at a temperature of 26±1℃ and a humidity of over 75% until white mycelium grows on the surface of the silkworm carcasses. After the powdery spores are produced, the silkworms are dried to obtain stiff silkworms.
[0020] In summary, compared with the prior art, the above-described technical solutions conceived by this invention can achieve the following beneficial effects:
[0021] (1) This invention provides a Beauveria bassiana strain with high beauveria bassiana yield, a microbial preparation, and its application in silkworm production. A strain with high beauveria bassiana yield was obtained by collecting naturally occurring silkworms from different times and locations and isolating and screening them. Compared to existing Beauveria bassiana strains, this strain has a beauveria bassiana content as high as 0.021%, which is 2 to 3 times that of ordinary strains (local control). It is a preferred strain with high beauveria bassiana yield suitable for silkworm production.
[0022] (2) This invention provides a high-yield Beauveria bassiana strain with high beauveria bassiana production, a microbial preparation, and its application in the production of silkworm pupae. The Beauveria bassiana strain Bb22 can effectively infect silkworms, and the weight of a single silkworm pupae is 0.80-1.01g, the extract content is 21.63-30.99%, and the beauveria bassiana content is 0.023%-0.034%. The higher beauveria bassiana content and the significant advantages in inhibiting bacterial growth, increasing the yield of silkworm pupae, and enhancing the content of medicinal components make it a promising candidate for application in the production and research of silkworm pupae. Attached Figure Description
[0023] Figure 1 This is a photograph of the morphology of Beauveria bassiana strain Bb22 on a PDA plate provided in this embodiment of the invention.
[0024] Figure 2 These are microscopic images of the sporulation structure and conidia of the Beauveria bassiana strain Bb22 provided in this embodiment of the invention.
[0025] Figure 3 These are actual images of silkworms produced by the Beauveria bassiana strain Bb22 and the control group ordinary Beauveria bassiana strain provided in the embodiments of the present invention;
[0026] Figure 4 This is a liquid chromatogram of beauveria bassiana provided in an embodiment of the present invention;
[0027] Among them, A is the chromatogram of beauveria bassiana reference standard (beauveria bassiana peak time 17.000), B is the chromatogram of silkworm production by the common beauveria bassiana strain in the control group (beauveria bassiana peak time 17.078), and C is the chromatogram of silkworm production by beauveria bassiana strain Bb22 (beauveria bassiana peak time 16.863). Detailed Implementation
[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.
[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.
[0030] The term "Lt" 50 The median lethal time (LD50) is the time required for half of the test animals to die at a specific concentration of a toxic substance. This indicator is very important in acute toxicity tests, used to express test results, especially when test conditions (such as temperature, pH, salinity, etc.) cannot be expressed in terms of concentration and dosage.
[0031] The term "Lt" 95 "This indicates the time required for 95% of the test animals to die at a specific concentration of toxic substance."
[0032] The term "primer" refers to an oligonucleotide that can be used in amplification methods (such as polymerase chain reaction PCR) to amplify a target sequence based on a polynucleotide sequence corresponding to a target gene or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence-specific to that polynucleotide sequence. The exact length of a primer depends on many factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least 10, 15, 20, 25, or more nucleotides, depending on the complexity of the target sequence, but may also contain fewer nucleotides. In this application, the term "primer" refers to a nucleic acid fragment capable of hybridizing with the double strand of a target DNA molecule or with regions of the target DNA molecule located on either side of the nucleotide sequence to be amplified. A "primer pair" refers to a group consisting of a forward primer and a reverse primer.
[0033] This invention obtained a strain of *Beauveria bassiana* with high beauveria bassiana production by collecting naturally occurring silkworms from different times and locations. Compared to existing *Beauveria bassiana* strains, this strain produces significantly more beauveria bassiana, demonstrating significant advantages in inhibiting bacterial growth, increasing silkworm yield, and enhancing the content of medicinal components in silkworms. The beauveria bassiana content produced ranges from 0.023% to 0.034%, which is 2 to 3 times higher than that of ordinary strains (local control).
[0034] The Beauveria bassiana strain Bb22 of this invention was deposited on January 10, 2022, at the China Center for Type Culture Collection (CCTCC), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number M2022052.
[0035] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.
[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.
[0037] Example 1: Collection, isolation and purification of Beauveria bassiana
[0038] 1. Collection of bacterial strain samples
[0039] In order to screen for Beauveria bassiana strains with high beauveria bassiana production, the inventors collected 28 naturally frozen silkworms from silkworm-producing areas such as Huidong, Xichang, and Nanchong in Sichuan Province between 2017 and 2019. After collection, the frozen silkworms were stored at 4℃ and numbered Bb1-Bb28.
[0040] 2. Strains Isolation, Culture, and Purification
[0041] Under aseptic conditions, natural silkworm spore powder was picked and streaked on potato dextrose agar (PDA) plates (with chloramphenicol and Triton). After incubation at 26°C for 5 days, white single colony mycelia were picked (the colonies are thin, flat, powdery, white, with a raised center, ring-shaped patterns near the outer edge of the colony, and pale yellow on the back of the colony).
[0042] 3. Strain purification
[0043] Dilute with sterile water and spread on potato dextrose agar (PDA) plates until no other bacteria are present on the plates. The purified single colonies are isolated and transferred to potato dextrose agar (PDA) slant culture medium. Once the potato dextrose agar (PDA) slant culture medium is fully covered with single colonies, it is used as the mother culture and stored at 4°C for later use.
[0044] Example 2: Sporulation by Beauveria bassiana fermentation culture
[0045] 1. Prepare a liquid culture medium and carry out liquid fermentation;
[0046] S21. Preparation of liquid culture medium: The raw material ratio includes 40g of white sugar, 10g of yeast extract, 10g of peptone, and 1000mL of water. Mix the above raw materials evenly and dispense 100mL into 1L Erlenmeyer flasks. Seal each flask with gauze, kraft paper, and rubber bands. Sterilize under high pressure steam at 121℃ for 20min. Let it cool before use.
[0047] S22. Liquid fermentation with spore powder inoculation: Under aseptic conditions, scrape spore powder from the surface of the Beauveria bassiana mother culture and inoculate it into an Erlenmeyer flask containing 100 mL of liquid culture medium. Place the flask in a constant temperature incubator at 26±1℃ and a shaking speed of 120 rpm for about 5 days to achieve a spore concentration of 102. 8 spores / mL; after the liquid fermentation stage is completed, the resulting spore liquid is used for future reference.
[0048] 2. Solid-state fermentation of Beauveria bassiana to extract Beauveria bassiana spore powder
[0049] S21. Preparation of solid culture medium: Mix water and rice at a volume ratio of 10 mL / 100 g, sterilize under high pressure steam at 121℃ for 20 min, and cool to obtain rice solid culture medium.
[0050] S22. Under aseptic conditions, take 15 mL of spore liquid and transfer it into 100 g of sterilized rice solid culture medium with a water content of 10%. Place the solid culture bag in an incubator at a temperature of 26±1℃ and culture for about 5 days to carry out solid fermentation (the bacteria produce conidia on the surface of the rice). Pour out the rice solid culture medium, dry it, and use a 100-mesh vibrating device to separate and obtain Beauveria bassiana conidia.
[0051] Example 3: Virulence determination of different strains in silkworms
[0052] To further confirm the virulence of different strains after reinoculation into silkworms and the yield of stunted silkworms, the inventors conducted relevant experiments using healthy silkworms in their fifth instar, specifically the Fangxiu × Baichun variety. The specific methods are as follows:
[0053] 1. 0.0200 g of conidia from different strains were weighed and added to 500 mL of 0.05% Tween 80 aqueous solution. The mixture was stirred until homogeneous to obtain a spore suspension. The concentration of the spore suspension was calculated using a hemocytometer. 6 A spore suspension of 1 spore per mL was used to inoculate healthy 5th instar silkworms (Fangxiu × Baichun variety) using the immersion method. 50 silkworms were inoculated at a time. A blank control was prepared by immersing silkworms in an aqueous solution containing 0.05% Tween-80. Each treatment was repeated three times. After immersion, the silkworms were kept at a temperature of 26±1℃ and a humidity of over 75% during rearing.
[0054] 2. Calculate the Lt for each strain on silkworms. 50 、Lt95
[0055] Silkworm mortality was assessed from day 3 to day 8 after inoculation, with daily records kept. Silkworms that did not react when gently touched with tweezers were counted as dead. The dead silkworm carcasses were cultured at 26±1℃ and above 75% humidity until white mycelium appeared on their surface. After producing powdery spores, they were dried and used as medicinal material. A blank control was placed in a separate room, and all experimental procedures were performed using separate tweezers. Data were processed using the DPS data processing system V9.01 software to calculate Lt. 50 、Lt 95 .
[0056] 3. Calculate the yield of silkworm larvae.
[0057] Silkworms that do not die on day 8 will die during the process of spinning silk and forming cocoons, forming stiff pupae and reducing the yield of stiff silkworms. Therefore, calculating the yield of stiff silkworms on day 8 is related to obtaining a high yield of stiff silkworms. The yield of stiff silkworms by day 8 (when the cocoons are formed) for different strains is calculated, as shown in Table 1.
[0058] Silkworm sterility yield = Number of sterile silkworms / Total number of inoculated silkworms × 100
[0059] The number of white-breasted silkworms was counted based on samples whose bodies were completely white after death, excluding black-breasted silkworms and pustular silkworms.
[0060] 4. Quality determination of silkworms that have become stiff
[0061] On day 6 (peak mortality period), different strains of silkworm pupae were collected. Thirty silkworms were randomly selected, and each silkworm pupae was weighed. The average weight of each silkworm pupae was calculated. The content of beauveria bassiana was determined according to the method in the literature (Chen Hui, He Jinxiao, Liu Jialing, et al. Study on a safe and rapid high performance liquid chromatography method for determining the content of beauveria bassiana in silkworm pupae [J]. Shizhen Guoyi Guoyao, 2018, 29(4):823-825). The results are shown in Table 1.
[0062] Table 1. Virulence assay results of strains from different sources
[0063]
[0064]
[0065] Correlation analysis was performed based on the results in Table 1, showing the relationship between the yield of silkworm larvae on day 8 and Lt. 95 A highly significant negative correlation was observed, meaning that the shorter the time to 95% silkworm mortality, the higher the yield of stunted silkworms on day 8. The effect of Bb22 strain on the Lt... 50 、Lt 95Under suitable conditions, silkworms died uniformly within 2 days, with a high yield of sterile silkworms on the 8th day. The average weight of sterile silkworms on the 6th day reflects the influence of the strain on silkworm growth: the average weight of sterile silkworms inoculated with strain Bb28 was the lowest (0.59g), indicating that this strain inhibited silkworm growth; the average weight of sterile silkworms inoculated with strain Bb6 was the highest (0.71g), but Lt 95 Silkworms die more slowly after 7 days, resulting in a low yield of dead silkworms on the 8th day. The average weight of dead silkworms inoculated with strain Bb22 was relatively high at 0.69g. Based on the beauveria bassiana content of the dead silkworms on the 6th day, 3 strains contained no beauveria bassiana, 15 strains had beauveria bassiana content ≤0.010%, and 9 strains had beauveria bassiana content between 0.010% and 0.020%. Strain Bb22 had the highest beauveria bassiana content (0.021%). In conclusion, strain Bb22 is the preferred strain for high beauveria bassiana yield in silkworm production.
[0066] Example 4: Culture and Identification of Bb22 Strain
[0067] 1. Morphological characteristics of strain Bb22
[0068] The isolated and purified Bb22 was transferred to PDA plates and incubated at 26°C for 14 days. The morphological characteristics of the colonies were observed and recorded, and the sporulation structure and conidial morphology of the strain were observed using an optical microscope. Figure 1 The image shown is a morphological photograph of strain Bb22 on a PDA plate, with the left side being the front and the right side the back. From... Figure 1 The results show that Bb22 colonies are thin, flat, and powdery, with a white surface, a raised center, and ring-like markings near the outer edge. The reverse side of the colony is pale yellow. Figure 2 The image shown is a microscopic image of the sporulation structure and conidia of strain Bb22. Figure 2 It can be seen under a microscope that the conidiophores and the main or lateral branches often form right angles, forming bottle-shaped conidiogenic cells that gradually taper upwards from the ventral end. The conidia are spherical and attached to the zigzag structure formed by the extension of the conidiogenic cells, with an average size of (2.0-3.0) μm × (2.0-3.0) μm.
[0069] 2. Molecular identification of strain Bb22
[0070] (1) DNA extraction
[0071] DNA of strain Bb22 of this invention was extracted using the TSINGKE Plant DNA Extraction Kit (General Type). For specific extraction steps, please refer to the kit's instruction manual.
[0072] (2) ITS Qualification
[0073] Using the DNA extracted in step (1) as a template and water as a blank control, PCR amplification was performed according to the ITS primers. The ITS sequence obtained by sequencing the PCR product is shown in SEQ ID NO.1.
[0074] The ITS primer information is as follows:
[0075] ITS1-F: 5'-TCCGTAGGTGAACCTGCGG-3'
[0076] ITS4-R: 5'-TCCTCCGCTTATTGATATGC-3'
[0077] (3) PCR reaction system: 10 μL of 2×Taq Mix, 0.5 μL each of forward and reverse primers, 6 μL of ddH2O, and 3 μL of template DNA.
[0078] (4) PCR reaction procedure: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 30 s, 55℃ annealing for 1 min, 72℃ extension for 45 s, for a total of 32 cycles, 72℃ extension for 10 min, and finally stored in a refrigerator at 4℃.
[0079] (5) The PCR product was sequenced to obtain the strain-specific ribosomal DNA-ITS sequence, as shown in SEQ ID No.1. The sequencing was completed by the Chengdu branch of Beijing Qingke Biotechnology Co., Ltd.
[0080] The sequencing results were assembled using ContigExpress software, and inaccurate parts at both ends were removed. The assembled sequence was then compared with the NCBI database (blast.ncbi.nlm.nih.gov), and the results showed that strain Bb22 was identified as Beauveria bassiana.
[0081] Example 5: Comparison of the quality differences of silkworm pupae prepared by strain Bb22 provided by the present invention and ordinary strains.
[0082] Silkworms prepared by the Bb22 strain provided by this invention in three different silkworm rearing seasons (spring, summer, and autumn) were selected as the experimental group, while silkworms prepared by ordinary strains (local strains) were selected as the control group for comparison of silkworm production and quality.
[0083] Silkworm farmers in Luliang, Yunnan Province, simultaneously inoculated the experimental and control groups with silkworms (Yunkang No. 1 variety). They then prepared 10 solutions of the *Beauveria bassiana* strain and a common strain of this invention using sterile water containing 0.05% Tween-80. 6 The spore suspension was evenly sprayed onto 5th instar silkworms. From day 5 to 7 after inoculation, a large number of silkworms died from stunted growth, but the overall yield of stunted silkworms was over 95%. See the produced stunted silkworms... Figure 3 .Depend on Figure 3 The images shown are of silkworms produced in the spring of 2020 (left: control of "common strain"; right: Bb22). As can be seen, compared to the common strain, the Bb22 strain of this invention has white mycelium and its appearance more closely matches the traditional characteristics of white silkworms, indicating superior quality. Subsequently, Bb22 was used to inoculate and produce silkworms for both summer and autumn silkworms. The quality of three batches of silkworms produced using Bb22 in different seasons was determined: 30 silkworms were randomly selected from the artificially produced silkworm samples, weighed individually, and the average weight was calculated. (According to the Chinese Pharmacopoeia) [1] The total ash, acid-insoluble ash, and extractives were determined using the method described under the "Silkworm Stiffness" section. The beauvericin content was determined by high-performance liquid chromatography (HPLC) according to the literature (Chen Hui, He Jinxiao, Liu Jialing, et al. A safe and rapid high-performance liquid chromatography method for determining the beauvericin content in silkworm stiffness [J]. Shizhen Guoyi Guoyao, 2018, 29(4):823-825). The determined HPLC chromatogram is shown below. Figure 4 As shown. Each sample was measured three times, and the average value was taken.
[0084] Table 2. Quality determination of silkworm samples inoculated with high-yielding strain Bb22 and common strain (%, n=3)
[0085]
[0086]
[0087] Note: *Unit is g
[0088] As shown in Table 2, the white silkworms infected with the Bb22 strain of this invention were of stable quality, heavy size, and excellent quality in different silkworm rearing seasons of spring, summer and autumn. All indicators met the pharmacopoeia standards. The beauveria bassiana content of the three batches of samples ranged from 0.023% to 0.034%, which was 2 to 3 times higher than that of the common strain (local control).
[0089] Based on the experimental results of the above embodiments, the *Beauveria bassiana* strain Bb22 provided by this invention can infect and fully cover the surface of silkworms more quickly than ordinary strains, resulting in a higher content of beauveria bassiana extract in the obtained silkworm medicinal material. It exhibits significant advantages in inhibiting bacterial growth, increasing the yield of silkworms, and enhancing the content of medicinal components, and has broad application prospects in the production and research of silkworms. It is a strain with potential application value in silkworm production.
[0090] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
[0091] SEQ ID No.1
[0092] ACTAACCTCGGGCTTCACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAATACAGCTCGCACCGGGACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGGCCGGAGGAAA。
Claims
1. A Beauveria bassiana strain with high beauveria bassiana yield, characterized in that, The Beauveria bassiana species was deposited by the China Center for Type Culture Collection (CCTCC) with accession number M2022052 on January 17, 2022.
2. A microbial preparation, characterized in that, The microbial preparation contains the Beauveria bassiana strain according to claim 1, and / or, the fermentation product of the Beauveria bassiana strain, and / or, an extract of the fermentation product of the Beauveria bassiana strain.
3. The microbial preparation according to claim 2, characterized in that, The microbial preparation contains mycelia and / or conidia of the Beauveria bassiana strain.
4. A method for preparing the microbial preparation according to claim 2, characterized in that, The method includes: The Beauveria bassiana was inoculated into a liquid culture medium and cultured until the spores reached the inoculation concentration; The spore liquid was transferred into a rice solid culture medium for solid fermentation. The rice solid culture medium was dried and sieved to separate the conidia.
5. The method for preparing the microbial preparation as described in claim 4, characterized in that, The liquid fermentation culture conditions were 26±1℃ and 120 rpm; the spore inoculation concentration was 10. 8 per mL.
6. The use of a Beauveria bassiana strain as described in any one of claims 1-2, or a microbial preparation as described in any one of claims 3-4, in the preparation of silkworm pupa.
7. The application as described in claim 6, characterized in that, The conidia produced by the fermentation of Beauveria bassiana strain were inoculated into 5th instar silkworms to prepare stiff silkworms.
8. The application as described in claim 7, characterized in that, The concentration of the conidia inoculated was 10. 6 Spores / mL.
9. The application as described in claim 7, characterized in that, After inoculating silkworms, maintain a temperature of 26±1℃ and a humidity of over 75% for cultivation until white mycelium grows on the surface of the silkworm carcass. After producing powdery spores, dry the carcass to obtain a stiff silkworm.