Lactobacillus mucus fermentation strain and application thereof

By using bovine-derived fermented Lactobacillus mucin strains to improve the intestinal health of calves, the problems of diarrhea and intestinal flora imbalance caused by enterotoxigenic Escherichia coli were solved. This enhanced the intestinal barrier function and antioxidant capacity, promoted the colonization of beneficial bacteria, solved the problem of probiotic deficiency in existing technologies, and achieved a green and environmentally friendly health improvement effect.

CN121652991APending Publication Date: 2026-03-13NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 0 Cites 1 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-04
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing technologies lack highly effective probiotics to inhibit enterotoxin-producing Escherichia coli, leading to calf diarrhea and intestinal flora imbalance, which affects animal health and growth performance. Furthermore, antibiotic treatment results in serious antibiotic contamination problems.

Method used

A bovine-derived fermenting *Lactobacillus mucinus* strain is provided, which improves intestinal barrier function and microbial development, inhibits the growth of enterotoxigenic *Escherichia coli*, enhances antioxidant capacity, reduces inflammatory response, and promotes the colonization of beneficial bacteria. It is selected from strains S1, S2, and S3, including the fermenting *Lactobacillus mucinus* strain with microbial accession number CCTCC NO: M 20252262 and its passaged strains and genomically identical strains.

Benefits of technology

It significantly improves intestinal damage, enhances growth performance and intestinal barrier function, reduces inflammatory response, promotes beneficial bacteria colonization, improves animal health, and is safe, harmless, and environmentally friendly.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121652991A_ABST
    Figure CN121652991A_ABST
Patent Text Reader

Abstract

The invention discloses a lactobacillus mucus fermentation strain. The microbial preservation number of the lactobacillus mucus fermentation strain is CCTCC (China Center for Type Culture Collection) NO: M 20252262. The strain can inhibit enterotoxigenic escherichia coli, and can treat or slow down diarrhea, intestinal oxidative damage, intestinal inflammation damage, intestinal morphological damage, intestinal barrier function damage and intestinal flora disorder caused by the enterotoxigenic escherichia coli. The strain is a probiotic with a clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbiology and relates to a fermenting strain of *Lactobacillus mucinus* and its applications. Background Technology

[0002] Enterotoxigenic Escherichia coli (ETEC) is currently a major pathogen causing diarrhea, significantly increasing morbidity and mortality in newborn calves and weaned piglets, causing enormous economic losses to the global livestock industry. ETEC is also one of the leading pathogens of bacterial infectious diarrhea in humans, especially infants. ETEC infection primarily invades the intestines, and the toxins it produces can impair intestinal barrier function, increase intestinal mucosal permeability, and increase intestinal inflammation, ultimately leading to a weakened immune system and secondary diseases. Currently, the main prevention and treatment method for ranchers is still feeding antibiotics, which exacerbates antibiotic pollution in agriculture. Therefore, finding low-cost, high-efficiency, safe, and effective alternative treatments remains of paramount importance.

[0003] Calf health is the cornerstone of sustainable livestock development, and one of the biggest challenges in their early growth stages is diarrheal diseases. The health and development of calves directly determine the production performance, reproductive efficiency, and lifespan of adult cattle, profoundly impacting the genetic improvement and economic benefits of the entire herd. Newborn calves have underdeveloped digestive systems and immature immune systems, making them highly susceptible to E. coli infection, which easily leads to diarrhea and intestinal flora imbalance. This not only causes stunted growth and increased mortality but also results in significant economic losses and antibiotic overuse. Therefore, maintaining calf intestinal health, enhancing intestinal barrier function, improving antioxidant capacity, and especially stabilizing the early intestinal flora are crucial for ensuring calf survival rates, maximizing their genetic potential, and are core elements of achieving sustainable livestock development. Against this backdrop, the application and research of probiotics, as a green means to directly intervene in and regulate the intestinal microecology, is particularly important.

[0004] Gut health plays a crucial role in maintaining overall host health, as the gut is the primary organ for digestion, nutrient absorption, and immune regulation. The integrity of the intestinal barrier not only prevents direct contact between the host and external pathogens but also ensures efficient nutrient absorption. Approximately 70% of immune cells reside in gut-associated lymphoid tissue (GALT). Meanwhile, recent studies have highlighted the critical role of the gut microbiota in maintaining intestinal barrier integrity and regulating mucus immunity, making it a current focus of research. The gut microbiota exists in a dynamic equilibrium, forming a stable symbiotic relationship with the host gut. The gut provides nutrients and a favorable environment for microbial colonization, while a healthy microbiota effectively protects the host from invading pathogens. External stimuli disrupting this balance can impair immune function, making the host more susceptible to secondary diseases and increasing the risk of disease. Increasing evidence suggests that the gut microbiota and its metabolites are key regulators of gut immune homeostasis. Therefore, there is growing interest in investigating the effects of the gut microbiota and SCFAs on intestinal inflammation.

[0005] Probiotics are live microorganisms that can colonize certain areas of the host's gut; experimental studies have shown that probiotics can effectively inhibit the in vitro growth and reproduction of pathogenic bacteria. However, there are a lack of reports on the application of probiotics that effectively antagonize enterotoxigenic Escherichia coli. Summary of the Invention

[0006] This invention discloses a bovine fermented Lactobacillus mucinus strain that can improve intestinal barrier function and microbial development in animals and its applications. Derived from adult high-yielding dairy cows, it exhibits strong inhibitory effects against common pathogenic bacteria (e.g., enterotoxin-producing Escherichia coli). Continuous administration to mice is safe and harmless, and the strain is environmentally friendly. Supplementation with fermented Lactobacillus mucinus significantly improved intestinal damage caused by E. coli in mice, enhanced growth performance, antioxidant capacity (superoxide dismutase, malondialdehyde, lipid peroxides), and intestinal barrier indicators. Simultaneously, it reduced inflammatory responses (IL-6, TNF-α, DAO), improved intestinal barrier function (MUC2, Claudin-1, Occludin), and promoted the colonization of various beneficial bacteria in the host gut to improve the intestinal flora.

[0007] To address the problems existing in the prior art, the first aspect of the present invention provides a fermenting *Lactobacillus fermentatus* strain, wherein the fermenting *Lactobacillus fermentatus* strain is selected from S1, S2, and S3:

[0008] S1: A fermenting Lactobacillus strain with the microbial accession number CCTCC NO: M 20252262;

[0009] S2: A passaged strain of the fermenting Lactobacillus strain with the microbial accession number CCTCC NO: M 20252262;

[0010] During the passage of the *Lactobacillus fermentata* strain with microbial accession number CCTCC NO: M 20252262, the transcriptional regulatory activity of all genes in the genome, the transcription initiation and termination of all genes in the genome, the amino acid sequences of proteins encoded by all genes in the genome, the clinical pathogenicity or probiotic properties of the strain, the immunogenicity of the strain, and the reproductive capacity of the strain remained unchanged compared to the *Lactobacillus fermentata* strain with microbial accession number CCTCC NO: M 20252262.

[0011] S3: A Lactobacillus fermentans strain with the same genome sequence as the Lactobacillus fermentans strain described in S1 or S2.

[0012] The second aspect of the present invention provides a method for culturing a strain of *Lactobacillus fermentatus*, wherein the method comprises culturing the *Lactobacillus fermentatus* strain described in the first aspect of the present invention in a culture medium to obtain a proliferated strain of *Lactobacillus fermentatus*.

[0013] A third aspect of the present invention provides a probiotic composition, wherein the active ingredient in the probiotic composition is selected from the following A1, A2, A3, A4 and A5;

[0014] A1: The fermenting *Lactobacillus mucinus* strain described in the first aspect of this invention;

[0015] A2: A pure culture of the fermenting *Lactobacillus mucinus* strain described in the first aspect of this invention;

[0016] A3: A clone of the Lactobacillus fermentans strain described in the first aspect of the present invention;

[0017] A4: Metabolites or secretions of the fermenting *Lactobacillus mucinus* strain described in the first aspect of this invention;

[0018] A5: The inactivated strain of *Lactobacillus fermentans* as described in the first aspect of this invention.

[0019] In some embodiments, the probiotic composition may also contain therapeutically active substances, immunologically active substances, inert substances, excipients, or unavoidable impurities.

[0020] The fourth aspect of the present invention provides the use of the fermenting *Lactobacillus mucinus* strain described in the first aspect of the present invention in the preparation of formulations for use alone or in combination with other active substances to improve the health status of subjects;

[0021] The improvement in the health status of the subjects includes the following H1, H2, H3, H4, H5, H6, and H7:

[0022] H1: Inhibits Escherichia coli in the subject's gut;

[0023] H2: To treat, prevent, or alleviate diarrhea and diarrhea-related symptoms in subjects;

[0024] H3: Treatment, prevention, or mitigation of intestinal oxidative damage caused by enterotoxigenic Escherichia coli;

[0025] H4: Treatment, prevention, or mitigation of intestinal inflammatory damage caused by enterotoxigenic Escherichia coli;

[0026] H5: Treatment, prevention or slowing down intestinal morphological damage and intestinal barrier function disruption caused by enterotoxigenic Escherichia coli;

[0027] H6: Treatment, prevention or mitigation of intestinal flora imbalance caused by enterotoxigenic Escherichia coli;

[0028] H7: To treat, prevent, or slow down the increase in expression of one or more genes in the intestinal MMP9, CXCL1, Ccl2, S100A8, and S100A9, and the decrease in IL-10 gene expression caused by enterotoxigenic Escherichia coli.

[0029] In some implementations, the choice is any one of B1, B2, B3, B5 and B5;

[0030] B1: In H1, the Escherichia coli is an enterotoxin-producing Escherichia coli;

[0031] B2: In H2, the diarrhea is caused by enterotoxigenic Escherichia coli;

[0032] B3: In H3, the intestinal oxidative damage includes a decrease in the level of superoxide dismutase, an increase in the level of malondialdehyde, and an increase in the level of lipid peroxides in the subject's intestine.

[0033] B4: In H4, the intestinal inflammatory damage includes increasing the expression levels of any one or more of the following genes in the subject's intestine: TNF-α, IL-17A, IL-6, IL-17RA, TRAF6, p-JAK2, and p-STAT3, or increasing the expression levels of any one or more of the following genes in the subject's serum: DAO, IL-6, and TNF-α.

[0034] B5: In H5, the intestinal morphological damage and intestinal barrier function disruption include villus shedding and necrosis, intestinal crypt structure dilation, reduction of intestinal goblet cells, decreased expression of the MUC2 gene in the intestine, decreased expression of the Claudin-1 gene in the intestine, and decreased expression of the Occludin gene in the intestine.

[0035] In some embodiments, the subjects are selected from mice, rats, pigs, dogs, and humans.

[0036] In some embodiments, the enterotoxigenic Escherichia coli is enterotoxigenic Escherichia coli strain K88.

[0037] In some embodiments, the intestinal tract is selected from the small intestine. Attached Figure Description

[0038] Figure 1 This is a photograph of the Gram staining results of strain a isolated in this invention.

[0039] Figure 2 Photograph of the results of a hemolysis safety test.

[0040] Figure 3 This is a statistical chart showing the expression levels of several genes.

[0041] Figure 4 This is a statistical chart showing the expression levels of several genes.

[0042] Figure 5 This is a statistical chart showing the expression levels of several genes.

[0043] Figure 6 The statistical results show the effects of fermented Lactobacillus mucinus ZNL-16 on antioxidant indicators in mice.

[0044] Figure 7 The statistical results show the effect of fermented Lactobacillus mucinus ZNL-16 on intestinal inflammatory response in mice.

[0045] Figure 8 HE-stained images of the effects of fermented Lactobacillus mucinus ZNL-16 on intestinal injury in mice and statistical analysis of its influence on barrier function gene expression. Scale bars in the figures represent 50 μm.

[0046] Figure 9 These are the results of transcriptomics analysis.

[0047] Figure 10 The results are from the KEGG analysis.

[0048] Figure 11 The results are from the KEGG analysis.

[0049] Figure 12 This is a photograph of the results of fluorescent staining of a small intestinal tissue section. The scale bar in the image represents 100 μm.

[0050] Figure 13 Photograph of the results of WB assay in small intestinal tissue.

[0051] Figure 14 Quantitative statistical results of white blood cell (WB) in small intestinal tissue.

[0052] Figure 15 This is a statistical chart of OTU levels.

[0053] Figure 16 This is a schematic diagram of the microbial diversity index.

[0054] Figure 17 A diagram illustrating differential gut microbiota analysis.

[0055] Figure 18 A diagram illustrating differential gut microbiota analysis. Detailed Implementation

[0056] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.

[0057] Materials and instruments not described in this invention are conventional materials and instruments in the art. Operational details not described in this invention are conventional operations in the art. Software used in this invention is operated according to the software provider's instructions using conventional methods. Reagents and consumables used in this invention, unless otherwise specified, are all from legitimate commercial sources.

[0058] "During the passage of the *Lactobacillus fermentata* strain with accession number CCTCC NO: M 20252262, the transcriptional regulatory activity of all genes in the genome, the transcription initiation and termination of all genes in the genome, the amino acid sequences of proteins encoded by all genes in the genome, the clinical pathogenicity or probiotic properties of the strain, the immunogenicity of the strain, and the reproductive capacity of the strain remained unchanged compared to the *Lactobacillus fermentata* strain with accession number CCTCC NO: M 20252262," including but not limited to the following:

[0059] The statement that "the bacterial reproductive capacity of strain ZNL-16 did not change during passage" primarily refers to the absence of any mutations in the genome sequence, maintaining the original reproductive capacity (no mutation-induced death, etc.), or minor changes in reproductive capacity within the error range of conventional detection techniques or changes undetectable by conventional techniques. According to common knowledge in the field, even two progeny bacterial samples isolated from a single colony of strain ZNL-16 will have systematic errors in their reproductive capacity measurements (different batches or different operators' measurements will also show some differences). Clearly, minor gene mutations inevitably occur during bacterial passage. Synonymous mutations in the coding sequence or minor mutations in non-coding regions of the genome that do not participate in bacterial genetic regulation do not affect bacterial reproductive capacity or biological activity (pathogenicity or probiotic properties). Therefore, this passaged strain falls within the substantive technical contribution scope of the preserved bacterial strain (strain ZNL-16), and is an unavoidable and reasonable variation within the direct technical contribution scope of this invention. This scope ensures that the content protected by the patent, the content actually used, and the content defined in the claims are as closely as possible to avoid significant separation. Similarly, no change in bacterial clinical pathogenicity, probiotic properties, and bacterial immunogenicity also means that the difference does not exceed the systematic error of the detection method, is not statistically significant, or the difference is slightly higher than, approximately equal to, or less than the standard deviation of the measurement method.

[0060] The statement that "the transcriptional regulatory activity of all genes in strain ZNL-16 remained unchanged during passaging" primarily refers to the fact that the expression regulation patterns of all transcriptional regulatory elements under the influence of bacterial endogenous or host-derived genes remained unchanged, the response patterns to external signals remained undetectable, and the host signal transduction pathways and metabolic regulatory patterns involved by the bacteria remained undetectable. Minor mutations that do not participate in regulation (e.g., minor changes in non-coding sequence bases that do not affect the expression regulation patterns of the corresponding genes) fall within the scope of unchanged transcriptional regulatory activity.

[0061] The statement that "the transcription initiation and termination of all genes did not change during the passage of ZNL-16 strain bacteria" mainly refers to the fact that the pattern of gene expression regulation did not change, and there were no detectable significant changes in gene transcription regulation.

[0062] The statement that "the amino acid sequence of all proteins of the ZNL-16 strain did not change during the passage of bacteria" mainly means that the amino acid sequence of all proteins of this strain did not change during the passage of bacteria. Synonymous mutations of genes do not affect gene function. Mutations during bacterial passage are inevitable. Therefore, progeny bacteria whose amino acid sequence of all proteins did not change are still within the scope of the technical contribution of the preserved strain.

[0063] "Lactobacillus fermentans strain with the same genome as the Lactobacillus fermentans strain described in S1 or S2" mainly refers to Lactobacillus fermentans strains that are not derived from the Lactobacillus fermentans strain with microbial accession number CCTCC NO: M 20252262 or its passaged strains, but are independently discovered and isolated by anyone after the date of this patent application. Obviously, anyone who obtains such a strain by chance after the date of this patent application should also be considered to fall within the protection scope of this invention.

[0064] Example 1: Isolation, screening, identification, and preservation of *Lactobacillus fermentans* ZNL-16

[0065] I. Isolation and Screening of Bacteria

[0066] Fecal samples were collected from high-yielding dairy cows at an intensive dairy farm in Harbin. Under aseptic conditions, the feces were mixed with sterile MRS solution in EP tubes at a ratio of 1g feces to 10ml MRS, and vortexed until homogeneous. After incubation at 37℃ for 12 hours, 50μl of the mixture was transferred to an MRS agar plate and spread using a sterile spreader. The plate was then incubated upside down at 37℃ for 48 hours. Six round, slightly raised, milky-white independent colonies were selected and inoculated onto new MRS agar plates using the three-zone streak method for purification. After three generations of purification, the colonies on the MRS agar plates were uniform in size and morphology. Single colonies were transferred to MRS broth for expansion culture and incubated at 37℃ for 24 hours to obtain bacterial suspension a, which was then frozen and stored. The bacteria derived from the purified colonies were designated as strain a.

[0067] II. Taxonomic Identification of Bacteria

[0068] The isolated strain a was subjected to routine Gram staining and microscopic examination, and the results are shown in the figure. Figure 1 .Depend on Figure 1 The visible bacteria are bluish-purple, short rod-shaped, and resemble lactobacilli. Strain a is a Gram-positive bacterium.

[0069] Coat an MRS agar plate with bacterial solution a, then pick a single colony and culture it overnight in MRS broth medium. The bacterial suspension is used to extract genomic DNA with a DNA extraction kit. The genomic DNA is amplified by PCR using 16S rDNA universal primers, and then the amplified product is sequenced by the Sanger method to obtain the gene sequence of 16S rDNA. Input it into NCBI for BLAST alignment, showing that the similarity of the isolated strain with the 16S rDNA of Limosilactobacillus fermentum strain PE2 (GenBank number: KU315056.1) is as high as 98.40%. The isolated strain a is identified as Limosilactobacillus fermentum, and the strain a is officially named Limosilactobacillus fermentum ZNL-16 strain, abbreviated as ZNL-16 strain.

[0070] III. Probiotic experiments of Limosilactobacillus fermentum ZNL-16 strain

[0071] In vitro antibacterial experiment: Escherichia coli (enterotoxigenic Escherichia coli strain K88) is used as a pathogenic indicator bacterium to detect the antibacterial ability of the isolated strain. Pipette 100 μL of the pathogenic indicator bacterium cultured overnight and inoculate it into LB agar liquid. The diameter of the antibacterial zone is measured by the Oxford cup method to evaluate the antibacterial ability of the isolated strain (aperture 5 mm). It is found that the diameter of the antibacterial zone of ZNL-16 strain against Escherichia coli > 15.00 mm, and the antibacterial effect is good.

[0072] IV. Hemolytic activity experiment

[0073] Use an inoculation loop to streak the fresh suspension of Limosilactobacillus fermentum ZNL-16 strain cultured overnight on a blood agar plate for a three-zone streaking experiment, and culture it at 37 °C for 48 h to observe whether there is hemolysis on the plate. The results are shown in Figure 2 . It can be seen that the result is weak α-hemolysis. Therefore, the ZNL-16 strain meets the basic safety requirements.

[0074] V. Preservation of microbial materials

[0075] Submit the isolated Limosilactobacillus fermentum ZNL-16 strain to a preservation institution recognized by the patent procedure for preservation. The preservation unit is the China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the microbial preservation number is CCTCC NO: M 20252262; the name of the culture is Limosilactobacillus fermentum ZNL-16; the Chinese taxonomic name is: Limosilactobacillus fermentum; the English taxonomic name is: Limosilactobacillus fermentum; the preservation time is October 20, 2025; the identification survival time is October 27, 2025.

[0076] Example 2: ZNL-16 strain's prevention of Escherichia coli diarrhea in mice

[0077] I. Modeling Diarrhea in Mice

[0078] A *E. coli*-induced diarrhea model was established using mice as experimental animals. Twenty-four mice (half male and half female) were randomly divided into three groups (n=8): control group (CON): mice were administered 200 μl of physiological saline by gavage once daily; model group (MON): mice were administered 200 μl of physiological saline by gavage once daily; and *Lactobacillus fermentum* group (LF): mice were administered 1 × 10⁻⁶ bacteria by gavage once daily. 9 Fresh bacterial culture of *Lactobacillus fermentum* strain ZNL-16 (CFU) was administered via gavage at a volume of 200 μl per administration. On day 15, mice in both the model group and the *Lactobacillus fermentum* group were intraperitoneally injected with 2 × 10⁻⁶ CFU. 8 200 μl of CFU / ml Escherichia coli (enterotoxin-producing Escherichia coli strain K88) was administered to mice, and their health status was closely observed and recorded. Results: Compared with the blank control group, the model group exhibited loose stools, lethargy, sluggishness, and disheveled fur. The model group experienced rapid weight loss, which was significantly alleviated by fermentation with Lactobacillus mucinus ZNL-16.

[0079] Three days after the virus challenge, the euthanized mice were tested for inflammatory markers, antioxidant capacity, and intestinal barrier function, and transcriptomics were performed. The transcriptomics results were then used for further validation.

[0080] II. RT-qPCR Analysis

[0081] Total RNA was extracted from the small intestinal tissue of mice in each group using the SteadyPure Quick RNA Extraction Kit AG21023 (purchased from ACCURATE BIOTECHNOLOGY (HUNAN) CO.,LTD). cDNA was obtained using a reverse transcription kit (purchased from ACCURATE BIOTECHNOLOGY (HUNAN) CO.,LTD). Quantitative PCR was performed on 15 genes using β-actin as an internal control. SYBR Green PCR premix was run in the Light Cycler 480 (Roche, Germany), and Ct values ​​were recorded to calculate relative expression levels. The forward and reverse primers are shown below, where F represents the forward primer, R represents the reverse primer, and the names following F- and R- represent the gene names.

[0082] F-Claudin-1 (SEQ ID NO.1): AAAGCACCGGGCAGATACAG

[0083] R-Claudin-1(SEQ ID NO.2):TCATGCCAATGGTGGACACA

[0084] F-Occludin(SEQ ID NO.3):TCCACCTCCTTACAGACCTGA

[0085] R-Occludin(SEQ ID NO.4):AAGAGTACGCTGGCTGAGAG

[0086] F-MUC2(SEQ ID NO.5):TCCTGACCAAGAGCGAACAC

[0087] R-MUC2(SEQ ID NO.6):ACAGCACGACAGTCTTCAGG

[0088] F-IL-6(SEQ ID NO.7):CCCCAATTTCCAATGCTCTCC

[0089] R-IL-6 (SEQ ID NO.8): AGGCATAACGCACTAGGTTT

[0090] F-IL-17RA(SEQ ID NO.9):CATCCCTCAAAGCTCAGCGTG

[0091] R-IL-17RA (SEQ ID NO.10): CGGTGGAGAGTCCAGGGTGACG

[0092] F-TRAF6(SEQ ID NO.11):TAAGGGATGCAGGGCACAAG

[0093] R-TRAF6(SEQ ID NO.12):GGCACTTTACCGTCAGGGAA

[0094] F-JAK2(SEQ ID NO.13):GGGAATGGCCTGCCTTACAA

[0095] R-JAK2(SEQ ID NO.14):CAGCTTGCCCAAGAGAATGG

[0096] F-STAT3(SEQ ID NO.15):TGCTTGGGCATCAATCCTGT

[0097] R-STAT3(SEQ ID NO.16):TTGGTGGTGGACGAGAACTG

[0098] F-IL-10(SEQ ID NO.17):TGCCAAGCCTTATCGGAAATGATCC

[0099] R-IL-10(SEQ ID NO.18):AGCCGCATCCTGAGGGTCTTC

[0100] F-TNF-α(SEQ ID NO.19):GTGCCAGCCGATGGGTTGTAC

[0101] R-TNF-α(SEQ ID NO.20):TGACGGCAGAGAGGAGTTGAC

[0102] F-MMP9(SEQ ID NO.21):AAAACCTCCAACCTCACGGA

[0103] R-MMP9(SEQ ID NO.22):CACAGCGTGGTGTTCGAATG

[0104] F-CXCL1(SEQ ID NO.23):CACCCGCTCGCTTCTCTG

[0105] R-CXCL1(SEQ ID NO.24):TCTTGAGGTGAATCCCAGCC

[0106] F-Ccl2(SEQ ID NO.25):AGGTCCCTGTCATGCTTCTG

[0107] R-Ccl2(SEQ ID NO.26):AAGGCATCACAGTCCGAGTC

[0108] F-S100A8(SEQ ID NO.27):ACAAGGAAATCACCATGCCCT

[0109] R-S100A8(SEQ ID NO.28):TTTGTGAGATGCCACACCCA

[0110] F-S100A9(SEQ ID NO.29):ACCACCATCATCGACACCTTC

[0111] R-S100A9(SEQ ID NO.30):AAAGGTTGCCAACTGTGCTTC

[0112] F-β-actin (SEQ ID NO. 31): GATATCGCTGCGCTGGTCG

[0113] R-β-actin (SEQ ID NO. 32): CATTCCCACCATCACACCCT

[0114] The qPCR results of the aforementioned 15 genes are respectively referred to as follows: Figure 3 , Figure 4 , Figure 5 .

[0115] III. Biochemical Analysis

[0116] Small intestinal tissues were obtained from three groups of mice, and 10% tissue homogenates were prepared using sterile physiological saline as the solution. The supernatant was collected by centrifugation. The levels of superoxide dismutase (SOD), malondialdehyde (MDA), and lipid peroxides (LPO) in the supernatant were detected according to the instructions of the kits, using a superoxide dismutase kit (purchased from Nanjing Jiancheng Bioengineering Institute), a malondialdehyde kit (purchased from Nanjing Jiancheng Bioengineering Institute), and a lipid peroxide kit (purchased from Beijing Solarbio Biotechnology Co., Ltd.).

[0117] See results Figure 6 Therefore, compared with the control group, the model group showed a significant increase in intestinal LPO and SOD, and a significant decrease in MDA. Treatment with fermenting Lactobacillus mucinus could largely restore this condition, bringing it closer to that of the control group. This indicates that strain ZNL-16 can treat or alleviate oxidative damage in the small intestinal tissue caused by Escherichia coli.

[0118] IV. Enzyme-linked immunosorbent assay (ELISA)

[0119] The levels of DAO (diamine oxidase) assay kit, TNF-α assay kit, and IL-6 assay kit (ELISA kits, all purchased from Jiangsu Enzyme Immunoassay Co., Ltd.) in the serum of the aforementioned three groups of mice were tested according to the instructions of the kits.

[0120] See the statistical results. Figure 7 This indicates that the levels of DAO, IL-6, and TNF-α were significantly increased in the model group, and fermentation with *Lactobacillus mucinus* ZNL-16 reduced the secretion and release of these three inflammatory factors. The protein concentrations of IL-6 and TNF-α were compared with... Figure 4 , Figure 5 The RNA abundance variation patterns shown are the same.

[0121] V. HE staining

[0122] Small intestinal tissue was fixed in 4% paraformaldehyde aqueous solution, embedded in paraffin, and the sample was cut into 4 μm sections and stained with conventional hematoxylin and eosin (H&E) and PAS. The samples were observed under an optical microscope (BX-FM; Olympus Corp., Tokyo, Japan) at a magnification of 200×.

[0123] See microscope images Figure 8 The results show that the CON group had a normal small intestinal structure, intact villi, and no signs of damage. In contrast, HE staining in the MON group revealed extensive sloughing and necrosis of the villi epithelium, hemorrhage, and inflammatory infiltration, accompanied by some crypt dilation. PAS staining also showed a significant reduction in goblet cells in the small intestine. The LF group showed significant remission, with intact intestinal villi structure, tightly packed intestinal epithelial absorptive cells, disappearance of edema, and a significant recovery in the number of goblet cells.

[0124] This invention performs RNA detection on intestinal tissue. RNA is extracted using a tissue RNA extraction kit, and the extracted RNA is reverse transcribed into cDNA for RT-qPCR detection. MUC2, Claudin-1, and Occludin are detected. Statistical results are available in [link to relevant documentation]. Figure 3 As can be seen, the levels of tight junction genes (MUC2, Claudin-1 and Occludin) in the model group showed a decreasing trend, and the application of fermenting Lactobacillus mucinus ZNL-16 increased the recovery of intestinal barrier function indicators to varying degrees.

[0125] VI. Transcriptomics Analysis

[0126] Total RNA was extracted from the small intestinal tissues of three groups of mice. Fragmentation buffer was added to break the RNA into short fragments. Double-stranded cDNA was synthesized using these short fragments as templates and purified using DNA purification magnetic beads. End repair, A-tailing, and sequencing adapter ligation were performed. Fragment size selection was conducted using DNA purification magnetic beads, and finally, PCR enrichment was performed to obtain the final cDNA library. After library approval, different libraries were pooled according to the target sequencing data volume, and sequencing was performed using the Illumina platform. After filtering the sequencing data, differentially expressed genes (DEGs) were identified using DEseq2. An FDR < 0.05 was selected as the criterion for defining significant pathway enrichment. Functional enrichment analysis was performed using significant DEGs annotated with ClusterProfiler and potential genes based on Gene Ontology (GO) and KEGG pathway categories.

[0127] To further investigate the mechanism by which *L. fermentum* ZNL-16 alleviates ETEC (enterotoxigenic *Escherichia coli*) damage, this invention utilizes transcriptomics to explore gene enrichment. Comparisons between different groups using volcano and VENN plots revealed 71 differentially expressed genes between the MON and CON groups, and 307 differentially expressed genes between the MON and LF groups, including 34 genes with shared differential expression. Figure 9 This invention utilizes differential gene enrichment analysis to explore the potential biological functions of L. fermentum ZNL-16 through the KEGG pathway. The invention identifies multiple pathway-related pathways, including Cytokine-cytokine receptor interaction, the IL-17 signaling pathway, and the TNF signaling pathway, with the IL-17 pathway showing the highest enrichment. Figure 10 (11). JAK-STAT is located downstream of the IL-17 pathway and is regulated by it. It was correlated with and had a high proportion in the comparisons between the MON and CON groups and between the MON and LF groups. Therefore, this invention focuses on the JAK-STAT pathway, a recognized targeted therapeutic pathway associated with inflammatory bowel disease, which can regulate pathways such as NF-κB and TNF. This suggests that IL-17 / JAK / STAT may be key to L. fermentum ZNL-16 alleviating ETEC-induced intestinal damage in mice.

[0128] VII. Immunofluorescence staining

[0129] Small intestinal tissue was fixed in 4% paraformaldehyde aqueous solution and embedded in paraffin. The samples were cut into 4 μm sections, and the paraffin sections were dewaxed and subjected to citrate antigen retrieval. After blocking, the primary antibody against IL-17A was FITC-labeled rabbit anti-IL-17A monoclonal antibody IgG (purchased from Affinity), and the primary antibody against IL-6 was FITC-labeled rabbit anti-IL-6 monoclonal antibody IgG (purchased from Servicebio). Both primary antibodies were applied overnight. The samples were treated with DAPI staining reagent. Immunofluorescence images of each sample were observed under a confocal hyperspectral microscope.

[0130] See results Figure 12 This indicates that *E. coli* can increase the levels of the inflammatory molecules IL-17A and IL-6 in the small intestine, while strain ZNL1 can decrease the levels of these inflammatory molecules, which is beneficial for repairing intestinal inflammatory damage caused by *E. coli*. Changes in IL-6 protein levels are also related to... Figure 4 The changes in IL-6 gene expression abundance are consistent with those shown.

[0131] 8. WB testing

[0132] Total protein was extracted from the small intestine using a conventional method with RIPA lysis buffer and protease inhibitors. Total protein concentration was determined using a BCA kit (Abbkine, Wuhan, China). Protein content was analyzed using SDS-PAGE and NC membrane blotting, followed by blocking and sequential incubation with primary antibody (1:1000) and secondary antibody (1:10000). Protein bands were visualized using ECL reagent, images were captured using a gel imaging system, and quantification was performed using ImageJ software.

[0133] Specifically, for IL-6, the primary antibody is mouse anti-mouse IL-6 monoclonal antibody IgG (purchased from BYabscience); for IL-17RA, the primary antibody is mouse anti-mouse IL-17RA monoclonal antibody IgG (purchased from BYabscience); for p-JAK2, the primary antibody is mouse anti-mouse p-JAK2 monoclonal antibody IgG (purchased from BYabscience); for JAK2, the primary antibody is mouse anti-mouse JAK2 monoclonal antibody IgG (purchased from BYabscience); and for p-STAT3, the primary antibody is mouse anti-mouse p-STAT3 monoclonal antibody IgG (purchased from Protein). For STAT3, the primary antibody is mouse anti-mouse STAT3 monoclonal antibody IgG (purchased from BYabscience); for TRAF6, the primary antibody is mouse anti-mouse TRAF6 monoclonal antibody IgG (purchased from BYabscience); for β-actin (internal control), the primary antibody is rabbit anti-mouse β-actin polyclonal antibody IgG (purchased from Bioss); the secondary antibody for β-actin is HPR-labeled goat-derived anti-rabbit IgG (purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.); and the secondary antibody for other markers is anti-mouse IgG antibody (purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.).

[0134] For the Western blot results of the aforementioned 8 proteins, please refer to [link to Western blot results]. Figure 13 Quantitative analysis results for IL-6, IL-17RA, TRAF6, p-JAK2, and p-STAT3 can be found in [link to relevant documentation]. Figure 14 ETEC increased the expression levels of IL-6, IL-17RA, TRAF6, p-JAK2, and p-STAT3, while ZNL-16 decreased the extent of these increases. This result is also consistent with... Figure 4 The pattern of RNA abundance changes shown corresponds to this.

[0135] Therefore, based on transcriptome analysis, IL-17 and JAK-STAT signaling may be potential targets for the therapeutic effect of L. fermentum ZNL-16, and this invention has conducted experimental verification. IF staining results showed that IL-17A and IL-6 were overexpressed in the MON group, and LF treatment significantly reduced the expression of IL-17A and IL-6. Figure 12 Western blot results further confirmed that L. fermentum ZNL-16 can downregulate the expression of IL-17RA and IL-6. Furthermore, compared to the CON group, the MON group showed significantly increased expression of TRAF6, p-JAK2, and p-STAT3 proteins, which were reduced by L. fermentum ZNL-16. Figure 13 , 14 The corresponding RNAs showed the same trend, and downstream genes of JAK2-STAT3, including MMP9, CXCL1, Ccl2, S100A8, and S100A9, were all significantly upregulated in the MON group. L. fermentum ZNL-16 suppressed this trend with significant differences (p < 0.05 and p < 0.01). Figure 4 5). This validates the transcriptome results, suggesting that ETEC may activate the body's inflammatory response and cause intestinal damage by activating the IL-17 / JAK2 / STAT3 pathway, and that L. fermentum ZNL-16 may alleviate the damaged state by inhibiting the activation of this pathway.

[0136] IX. Impacts of ZNL-16 on biological communities

[0137] Total DNA from the gut microbiota of mice in each group was extracted using a DNA extraction kit (Omega Bio-tek, Norcross, GA, USA) according to EZNA's instructions. PCR amplification of the V3-V4 region of 16S rRNA was performed using upstream primer 338 F and downstream primer 806 R. The purified amplicon was pooled in equimolar amounts and paired-end sequencing was performed on an Illumina PE 300 platform (Illumina, San Diego, CA, USA) according to Majorbio Bio-Pharm Technology Co.'s standard protocol. Subsequently, operational taxonomic units (OTUs) were clustered from the quality-controlled assembled sequences at a 97% similarity threshold using UPARSE v7.1 software, and chimeras were removed. Community composition for each sample was then determined at different taxonomic levels. Microbial diversity in mouse feces was analyzed based on sequencing reads and OTU levels. Results are shown below. Figure 15 , Figure 1616S rRNA amplicon sequencing analysis of fecal samples revealed a significant increase in gut microbiota diversity index after supplementation with fermented Lactobacillus mucinus ZNL-16. Figure 16 A) The ETEC group was the model group, and the LF group was the *Lactobacillus fermentans* ZNL-16 group. ETEC decreased the levels of *Bacteroidota* and *Bacillota*, while increasing the levels of *Verrucomicrobiota* and *Pseudomonadota*. At the genus level, ETEC decreased the abundance structures of *norank_f_Muribaculaceae*, *Limosilactobacillus*, *Ligilactobacillus*, *Lactobacillus*, *norank_o_Clostridia_UCG-014*, *Lachnospiraceae_NK4A136_group*, and *Candidatus_Arthromitus*, while increasing the abundances of *Bacteroides*, *Akkermansia*, *Escherichia-Shigella*, and *Thomasclavelia*. The LF group altered the abundance structure of the ETEC group at both the phylum and genus levels, becoming closer to the CON group. LEfSe multilevel species differential discriminant analysis was performed, and LDA values ​​were used to measure the magnitude of species influence on the differential effect. o_Clostridiales, f_Clostridiaceae, g_Candidatus_Arthromitus, g_Akkermansia, c_Verrucomicrobiia, f_Akkermansiaceae, p_Verrucomicrobiota, and f_Lactobacillaceae were identified as marker species between different groups. Subsequent significance analysis of these marker species revealed norank_f_Muribaculaceae, Akkermansia, Limosilactobacillus, Alistipes, and norank_o_Clostridia_UCG-014 as the top 5 species with significant differences in abundance. The results of the differential gut microbiota analysis can be found in [link to relevant documentation]. Figure 17-18 .

[0138] Studies have shown that *Muribaculaceae* can metabolize glycocomplexes in the host mucus layer, generating SCFAs (such as acetic acid, propionic acid, and butyric acid), which help maintain intestinal barrier integrity, reduce inflammation, and promote mucus secretion. *Alistipes* increases the expression of tight junction proteins ZO-1 and claudin-1, and enhances the level of the anti-inflammatory cytokine IL-10. *Limosilactobacillus* has anti-inflammatory, antibacterial, and immunomodulatory effects. *Blautia* showed significantly increased abundance in patients with intestinal cancer, presumably related to the pathological state of the disease. In conclusion, fermentation of *Lactobacillus mucinus* ZNL-16 promotes the enrichment of beneficial bacteria.

[0139] As is known from common technical knowledge, this invention can be implemented through other embodiments that do not depart from its spirit or essential characteristics. Therefore, the disclosed embodiments described above are merely illustrative in all respects and are not the only ones. All modifications within the scope of this invention or its equivalents are included in this invention.

Claims

1. A fermenting *Lactobacillus mucinus* strain, wherein the fermenting *Lactobacillus mucinus* strain is selected from S1, S2, and S3: S1: A fermenting Lactobacillus strain with the microbial accession number CCTCC NO: M 20252262; S2: A passaged strain of the fermenting Lactobacillus strain with the microbial accession number CCTCC NO: M 20252262; During the passage of the *Lactobacillus fermentata* strain with microbial accession number CCTCC NO: M 20252262, the transcriptional regulatory activity of all genes in the genome, the transcription initiation and termination of all genes in the genome, the amino acid sequences of proteins encoded by all genes in the genome, the clinical pathogenicity or probiotic properties of the strain, the immunogenicity of the strain, and the reproductive capacity of the strain remained unchanged compared to the *Lactobacillus fermentata* strain with microbial accession number CCTCC NO: M 20252262. S3: A Lactobacillus fermentans strain with the same genome sequence as the Lactobacillus fermentans strain described in S1 or S2.

2. A method for culturing a strain of *Lactobacillus fermentatus*, wherein the method comprises culturing the strain of *Lactobacillus fermentatus* according to claim 1 in a culture medium to obtain a proliferated strain of *Lactobacillus fermentatus*.

3. A probiotic composition, wherein the active ingredient in the probiotic composition is selected from the following A1, A2, A3, A4 and A5; A1: The fermenting *Lactobacillus mucinus* strain according to claim 1; A2: A pure culture of the fermenting *Lactobacillus mucinus* strain according to claim 1; A3: A clone of the *Lactobacillus fermentans* strain described in claim 1; A4: Metabolites or secretions of the fermenting *Lactobacillus mucinus* strain according to claim 1; A5: The inactivated strain of *Lactobacillus fermentans* as described in claim 1.

4. The probiotic composition according to claim 3, characterized in that, The probiotic composition also contains therapeutically active substances, immunologically active substances, inert substances, excipients, or unavoidable impurities.

5. The use of the fermenting *Lactobacillus mucinus* strain of claim 1 in the preparation of formulations for use alone or in combination with other active substances to improve the health status of subjects; The improvement in the health status of the subjects includes the following H1, H2, H3, H4, H5, H6, and H7: H1: Inhibits Escherichia coli in the subject's gut; H2: To treat, prevent, or alleviate diarrhea and diarrhea-related symptoms in subjects; H3: Treatment, prevention, or mitigation of intestinal oxidative damage caused by enterotoxigenic Escherichia coli; H4: Treatment, prevention, or mitigation of intestinal inflammatory damage caused by enterotoxigenic Escherichia coli; H5: Treatment, prevention or slowing down intestinal morphological damage and intestinal barrier function disruption caused by enterotoxigenic Escherichia coli; H6: Treatment, prevention or mitigation of intestinal flora imbalance caused by enterotoxigenic Escherichia coli; H7: To treat, prevent, or slow down the increase in expression of one or more genes in the intestinal MMP9, CXCL1, Ccl2, S100A8, and S100A9, and the decrease in IL-10 gene expression caused by enterotoxigenic Escherichia coli.

6. The application as described in claim 5, characterized in that, Choose from any one of B1, B2, B3, B5 and B5 below; B1: In H1, the Escherichia coli is an enterotoxin-producing Escherichia coli; B2: In H2, the diarrhea is caused by enterotoxigenic Escherichia coli; B3: In H3, the intestinal oxidative damage includes a decrease in the level of superoxide dismutase, an increase in the level of malondialdehyde, and an increase in the level of lipid peroxides in the subject's intestine. B4: In H4, the intestinal inflammatory damage includes increasing the expression levels of any one or more of the following genes in the subject's intestine: TNF-α, IL-17A, IL-6, IL-17RA, TRAF6, p-JAK2, and p-STAT3, or increasing the expression levels of any one or more of the following genes in the subject's serum: DAO, IL-6, and TNF-α. B5: In H5, the intestinal morphological damage and intestinal barrier function disruption include villus shedding and necrosis, intestinal crypt structure dilation, reduction of intestinal goblet cells, decreased expression of the MUC2 gene in the intestine, decreased expression of the Claudin-1 gene in the intestine, and decreased expression of the Occludin gene in the intestine.

7. The application as described in claims 5 and 6, characterized in that, The subjects were selected from mice, rats, pigs, dogs, and humans.

8. The application as described in claims 5 and 6, characterized in that, The enterotoxin-producing Escherichia coli is enterotoxin-producing Escherichia coli strain K88.

9. The application as described in claims 5 and 6, characterized in that, The intestine is selected from the small intestine.

Citation Information

Cited By

  • A strain of fermenting *Lactobacillus mucinus* and its application

    CN122303111A