Lactic acid bacteria gene engineering strain for producing malic acid as well as construction method and application of lactic acid bacteria gene engineering strain

Abstract

The invention provides a lactic acid bacteria genetic engineering strain for producing malic acid as well as a construction method and application thereof, and belongs to the technical field of genetic engineering and microbial fermentation. The lactic acid bacterium gene engineering strain is a lactic acid bacterium gene engineering strain with two lactic dehydrogenase genes and one cluster protein gene being knocked out; the two lactic dehydrogenases are respectively a lactic dehydrogenase LCAZH0554 and a lactic dehydrogenase LCAZH2512, and the clusterin is a clusterin containing genes of LCAZH2364, LCAZH2365, LCAZH2366 and LCAZH2367. The invention further discloses a preparation method of the clusterin. Three target knockout plasmids are sequentially transferred on the basis of an original lactic acid bacterium strain for gene knockout, the lactic acid bacterium gene engineering strain is finally obtained, and the malic acid yield is obviously increased compared with that of the original strain when the lactic acid bacterium gene engineering strain is adopted for fermentation.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and microbial fermentation technology, specifically relating to a genetically engineered strain of lactic acid bacteria that produces malic acid, its construction method, and its application. Background Technology

[0002] While studies have reported that genetically engineered *E. coli* or *Corynebacterium glutamicum* can achieve malic acid yields exceeding 100 grams per liter, these host bacteria are primarily used in industrial-scale fermentation, presenting challenges such as poor food safety, weak acid resistance, and high post-processing costs. In contrast, ① lactic acid bacteria are recognized as Generally Recognized As Safe (GRAS) food-grade bacteria. Malic acid produced using these bacteria has a far higher biosafety level than *E. coli* and similar bacteria, making it easier to obtain food production licenses and allowing for direct application in food systems. ② Lactic acid bacteria themselves possess numerous beneficial effects, including regulating intestinal flora, promoting digestion and absorption, and enhancing immunity. By genetically engineering them to produce malic acid during metabolism, it is possible to combine the probiotic functions of lactic acid bacteria with the health benefits of malic acid (such as promoting metabolism and relieving fatigue), thereby developing functional foods or probiotic products with enhanced or combined health benefits.

[0003] Malic acid is an important four-carbon compound with applications spanning multiple industries, including food, pharmaceuticals, and chemicals. In the food industry, malic acid is the third largest acidulant after citric acid and lactic acid, widely used in beverages, candies, jams, and other products to impart a refreshing sour taste. In the pharmaceutical industry, malic acid, as an important intermediate in the tricarboxylic acid (TCA) cycle, can directly participate in human metabolism, exhibiting multiple benefits such as anti-fatigue, protection of liver, kidney, and heart function, and mitigation of the toxic side effects of anticancer drugs. In the chemical industry, malic acid can be used in the production of daily cosmetics, metal cleaning and finishing, fabric finishing, and chemical plating. However, during the conventional fermentation process of wild-type lactic acid bacteria, the malic acid content in the fermentation broth is detected to be low. There is an urgent need in this field to explore how to increase the malic acid content in the context of lactic acid bacteria, providing a new host platform for the biomanufacturing of food-grade organic acids. Summary of the Invention

[0004] The purpose of this invention is to provide a genetically engineered strain of lactic acid bacteria that produces malic acid, its construction method, and its application, which significantly improves the yield of malic acid produced by the fermentation of original lactic acid bacteria.

[0005] To achieve the above objectives, this invention provides a genetically engineered strain of lactic acid bacteria that produces malic acid, blocking the expression or activity of two lactate dehydrogenases and one cluster protein in the recipient lactic acid bacteria. The two lactate dehydrogenases are lactate dehydrogenase LCAZH_0554 and lactate dehydrogenase LCAZH_2512, respectively. The cluster protein is a cluster protein containing the genes LCAZH_2364, LCAZH_2365, LCAZH_2366 and LCAZH_2367; The amino acid sequence of the lactate dehydrogenase LCAZH_0554 is identical to the amino acid sequence of NCBI accession number: CP001084.2protein_id = ADK19703.1locus_tag = LCAZH_0554; The amino acid sequence of the lactate dehydrogenase LCAZH_2512 is consistent with the amino acid sequence of the gene with NCBI accession number CP001084.2 and protein_id = ADK17844.1 locus_tag = LCAZH_2512; The amino acid sequence of LCAZH_2364 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19571.1 locus_tag = LCAZH_2364; The amino acid sequence of LCAZH_2365 is identical to that of NCBI accession number CP001084.2 protein_id=ADK19572.1 locus_tag=LCAZH_2365; The amino acid sequence of LCAZH_2366 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19573.1 locus_tag = LCAZH_2366; The amino acid sequence of LCAZH_2367 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19574.1 locus_tag = LCAZH_2367.

[0006] Preferably, the encoding gene of lactate dehydrogenase LCAZH_2512 is shown in SEQ ID NO. 1; the encoding gene of lactate dehydrogenase LCAZH_2512 is shown in SEQ ID NO. 2; and the encoding gene of the cluster protein is shown in SEQ ID NO. 3.

[0007] Preferably, the recipient lactic acid bacteria include Lacticaseibacillus casei Zhang.

[0008] The present invention also provides a method for constructing the genetically engineered lactic acid bacteria strain, which involves using three gene editing vectors to knock out the coding genes for the two lactate dehydrogenases and the coding gene for the cluster protein in the recipient lactic acid bacteria, thereby obtaining the genetically engineered lactic acid bacteria strain that produces malic acid.

[0009] Preferably, all three gene editing vectors include a CRISPR / Cas system, wherein the CRISPR / Cas system includes a CRISPR-Cas9 D10A protein and sgRNA; the sgRNA is any one of sgRNA1 to sgRNA3; The sgRNA1 targets the gene encoding the lactate dehydrogenase LCAZH_0554, and the primer sequences of the sgRNA1 are SEQ ID NO. 12 and SEQ ID NO. 13; The sgRNA2 targets the gene encoding the lactate dehydrogenase LCAZH_2512, and the primer sequences for the sgRNA2 are SEQ ID NO. 20 and SEQ ID NO. 21; The sgRNA3 targets the gene encoding the cluster protein, and the primer sequences of the sgRNA3 are SEQ ID NO.28 and SEQ ID NO.29.

[0010] Preferably, the knockout method includes: using pLCNICK plasmid as a backbone vector, constructing knockout plasmids pLCNICK-0554, pLCNICK-2512 and pLCNICK-4 containing the CRISPR-Cas9 D10A protein and the sgRNA, respectively; In recipient bacteria Lacticaseibacillus casei In Zhang, the knockout plasmids pLCNICK-0554, pLCNICK-2512, and pLCNICK-4 were sequentially introduced to knock out the target gene.

[0011] The present invention also provides the application of the genetically engineered lactic acid bacteria strain or the genetically engineered lactic acid bacteria strain constructed by the construction method in the production of malic acid.

[0012] The present invention also provides a method for producing malic acid, wherein the lactic acid bacteria genetically engineered strain or the lactic acid bacteria genetically engineered strain constructed by the construction method is inoculated into a fermentation medium for fermentation to obtain malic acid.

[0013] Preferably, the fermentation is anaerobic fermentation, the fermentation temperature is 35℃~38℃, the fermentation pH value is 6~7, the anaerobic fermentation is anaerobic static culture, and the anaerobic static culture time is greater than or equal to 48 h.

[0014] Preferably, the fermentation medium is formulated with 10.0 g / L peptone, 10.0 g / L beef extract, 5.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 5.0 g / L sodium acetate, 0.1 g / L MgSO4, 0.05 g / L MnSO4, 2.0 g / L K2HPO4, and 1.0 g / L Tween 80, with the balance being water.

[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a genetically engineered strain of lactic acid bacteria that produces malic acid. Lacticaseibacillus casei Zhang was the starting strain; gene knockout was used to block... Lacticaseibacillus casei By expressing or activating lactate dehydrogenases LCAZH_0554 and LCAZH_2512, and proteins containing the gene clusters LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 in strain Zhang, a genetically engineered lactic acid bacteria strain capable of producing malic acid was obtained. This genetically engineered lactic acid bacteria strain exhibited a significantly increased malic acid yield after static fermentation compared to the original lactic acid bacteria strain. Currently, there are no reports in the prior art regarding the production of malic acid using gene knockout metabolism in lactic acid bacteria as described in this invention. Therefore, this invention provides a new approach for the engineering modification of lactic acid bacteria and the production of malic acid. Attached Figure Description

[0016] Figure 1 Knockout in Example 1 Lacticaseibacillus casei Map of plasmid pLCNICK-0554 of the Zhang lactate dehydrogenase LCAZH_0554 gene.

[0017] Figure 2 Knockout in Example 1 Lacticaseibacillus casei Map of plasmid pLCNICK-2512 of the Zhang lactate dehydrogenase LCAZH_2512 gene.

[0018] Figure 3 Knockout in Example 1 Lacticaseibacillus casei Zhang's plasmid pLCNICK-4 map of four gene cluster proteins: LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367.

[0019] Figure 4 This is an electrophoresis image verifying the knockout of the lactate dehydrogenase LCAZH_0554 gene in Example 1. The marker is a 5000bp DNA marker, and lane 1 represents the wild type. Lacticaseibacillus caseiZhang's colonies, lanes 2-11 indicate transformants with successfully knocked-out genes.

[0020] Figure 5 This is an electrophoresis image verifying the LCAZH_2512 gene knockout of lactate dehydrogenase in Example 1. The marker is a 5000bp DNA marker, and lane 1 represents the wild type. Lacticaseibacillus casei Zhang's colonies, lanes 2-10 indicate transformants with successfully knocked-out genes.

[0021] Figure 6 This is an electrophoresis image verifying the knockout of the four gene cluster proteins LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 in Example 1. The marker is a 5000bp DNA marker, and lane 1 represents the wild type. Lacticaseibacillus casei Zhang's colonies, lanes 2-10 indicate transformants with successfully knocked-out genes.

[0022] Figure 7 The chromatogram of malic acid production by fermentation of genetically engineered lactic acid bacteria in Example 2 is shown. Figure 8 The curve of malic acid production by fermentation of genetically engineered lactic acid bacteria in Example 2 is shown as a yield-time curve.

[0023] Figure 9 The original in Example 2 Lacticaseibacillus casei Results of malic acid concentration in fermentation broth of strain Zhang and genetically engineered lactic acid bacteria at different time points. Detailed Implementation

[0024] This invention provides a genetically engineered strain of lactic acid bacteria that produces malic acid, blocking the expression or activity of two lactate dehydrogenases and one cluster protein in recipient lactic acid bacteria. The two lactate dehydrogenases are lactate dehydrogenase LCAZH_0554 and lactate dehydrogenase LCAZH_2512, respectively. The cluster protein is a cluster protein containing the genes LCAZH_2364, LCAZH_2365, LCAZH_2366 and LCAZH_2367; The amino acid sequence of the lactate dehydrogenase LCAZH_0554 is identical to the amino acid sequence of NCBI accession number: CP001084.2protein_id = ADK19703.1locus_tag = LCAZH_0554; The amino acid sequence of the lactate dehydrogenase LCAZH_2512 is consistent with the amino acid sequence of the gene with NCBI accession number CP001084.2 and protein_id = ADK17844.1 locus_tag = LCAZH_2512; The amino acid sequence of LCAZH_2364 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19571.1 locus_tag = LCAZH_2364; The amino acid sequence of LCAZH_2365 is identical to that of NCBI accession number CP001084.2 protein_id=ADK19572.1 locus_tag=LCAZH_2365; The amino acid sequence of LCAZH_2366 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19573.1 locus_tag = LCAZH_2366; The amino acid sequence of LCAZH_2367 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19574.1 locus_tag = LCAZH_2367.

[0025] In the present invention, the coding gene sequence of the lactate dehydrogenase LCAZH_0554 is as shown in SEQ ID NO. 1: ctaagcttcttgagccttcttcagattttctttcaaaatagctgcagaatcggctaaacgcttatgatcttctgggttcaaatccagctcaatgatgcgttccaagccattagcgccgaggattaccggtacaccgatggaaacacctgacaagccgtattcgccttccaaatggacggacattgcgaatgctgcgcgatcatcattcaagaaggcgctggttaaacgggttaatgaggcggcaatgccgtagaaagtggcaccttttttctcaatgatgccataagcagccgttttgacgcgctcgctaatatcaggcagatctttatcctggcgatctttaggaatccaatcaagaatcggtttgccgccaatgttggtgtagtcccaaactggaaattcagaatcgccgtgttcacccatgatgtagccgtgcacaatccgggcgtccacgttataacgcaggccgatctcagaccgtaagcgagctgaatcaagcgccgtccctgatcccagcacctgattacgtggcaagccggattcttgcaagactaattcggcaaggacatcgactggattggatgcgactagaataaacccattgaacccgcttgccataatgttatgtgtgatttctttcatgatctttgcgttgatggccaaaagttgtaggcgtgtctgacctggcttttgggcaattccggctgtgatgacgataatatcggcatatttgcaatcttcatagctggccgcataaatattcttctgtgacgtgtaaggtagggcatcagaaagatcttcgacgtcaccttgcacgcgtttttcgttaacatcaataataccaagactctggccgacgccggtggtgagacagttgaacgcataacttgatccaatcgcgccatcaccaattaaaataatattgccgttgttccgcat(SEQ ID NO. 1).

[0026] The gene sequence encoding the lactate dehydrogenase LCAZH_2512 is shown in SEQ ID NO.As shown in Figure 2: gtggcaagtattacggataaggatcaccaaaaagttattctcgttggtgacggcgccgttggttcaagttatgcctacgcaatggttttgcaaggtatcgctcaggaaatcggaatcgttgacattttcaaggacaagacaaagggtgacgcgattgacttgagcaacgcgctcccattcacaagtcctaagaagatttattcagctgaatacagcgatgctaaggatgctgatctggttgttatcacagctggcgctcctcagaagcctggcgaaactcgtttggacttggttaacaagaacttgaagatcttgaagtccattgttgacccaatcgttgattccggctttaacggtattttcttagttgctgccaacccagttgacattttgacctatgcaacttggaaactttctggcttcccgaagaaccgggttgttggttccggtacttcactggacaccgcccgcttccgtcagtccattgctgaaatggttaatgttgacgctcgttcggtccacgcttacatcatgggcgaacatggtgacactgaattccctgtatggtcccacgctaacattggtggcgttaccatcgctgaatgggttaaggctcatccagaaatcaaggaagacaagcttgttaagatgtttgaagacgttcgtgacgccgcttatgaaatcatcaaactcaagggtgcgaccttctatggtatcgcaactgcccttgcccggatttcaaaggcaatccttaacgacgaaaatgcggttctgccactttccgtttacatggatggtcaatatggcttgaacgacatctacatcggtaccccagctgtgatcaaccgtaatggtatccagaacatcctggaaatcccattgaccgatcacgaagaagaatccatgcagaaatctgcttctcaattgaagaaggttctgaccgatgctttcgctaagaatgacatcgaaactcgtcagtaa(SEQ ID NO.2).

[0027] The coding gene sequence of LCAZH_2364 is shown in SEQ ID NO. 3: ctacatgccctgccatccctttaaaaaccccgcaataatttggtcagtgtgtgaccaagcatctatcgcaatcaatcctaaaatcagcattgtcaggaatttacgccaggtaatcccttcaatcatttgttgcaaatcatcattctttattcgatgcat (SEQ ID NO. 3).

[0028] The coding gene sequence of LCAZH_2365 is as SEQ ID NO .4 shown: tcaagtaataaagtgcggtccgccaacctgactcagctcttcatgaatatcattctccatgaaatctttcagttgttgccaccactggtcagcttctggggataatttcatcccctgcaacccaattaaccggacaaagcgagaatacaggcgcgctaatgcgtag tcaatggctctattttgaagcacattttcttttttcaaaatgtgtagcgcatcatcaatgacctcttgtgcatcggtattcatgacactgacggttgcagttttttgaaagctttcgttgagccctgtcataataaaaatagactttatttcgctgaatcatgttcat(SEQ ID NO.4).

[0029] The coding gene sequence of LCAZH_2366 is shown in SEQ ID NO. 5: tcaatgcctcgctttttcatatccggcatcagcttcccgcaacaacgtgagtcctgccgccaaaagcagtagtggcagcgcaaagtcaccttggttgacccagcccatggcggcagccagcgtaaaaagaaagacaccactgatgcctatcagtaaaagataatgaattgctttattcaacgtcatcgccaa (SEQ ID NO. 5).

[0030] The coding gene sequence of LCAZH_2367 is shown as SEQ ID NO. 6: ctagtgtccccaaacaataggaatggcgattaagccggctgccagtgcttgtgcacgataatgtgctgcatcaatatcggcagcaggtacatcttttttgatgtaattgaagacggccaccagctcttctggtacggcgtgatgaatcaaatagtatttagaaatgtcgtgggacaactgagtgacagccgtcacataagccttatcgtcatcaccttcatcaacctttttggcgttggtttcgataagcgcccgtaatgccggctctgctttgatcgttgggttagcgtatgccttgcttagcatcgacattaaagtttcacgtttatctgtcat(SEQ ID NO. 6).

[0031]

[0032] The gene sequences encoding the cluster protein containing the four genes LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 are available in the NCBI database. Lacticaseibacillus casei The complete genome of strain Zhang (accession number: CP001084.2) is from position 2323853 to position 2325666.

[0033] In this invention, the recipient lactic acid bacteria used to construct the genetically engineered lactic acid bacteria strain is preferably... Lacticaseibacillus casei Zhang. As an optional implementation method, with Lacticaseibacillus casei Zhang was used as the original lactic acid bacteria starting strain to knock out three gene fragments, namely two lactate dehydrogenases and one cluster protein.

[0034] This invention also provides a method for constructing the aforementioned engineered lactic acid bacteria strain, which involves using three gene-editing vectors to knock out the coding genes for the two lactate dehydrogenases and the coding gene for the cluster protein in the recipient lactic acid bacteria, thereby obtaining the engineered lactic acid bacteria strain that produces malic acid. All three gene-editing vectors include a CRISPR / Cas system, which includes the CRISPR-Cas9 D10A protein and sgRNA. As an optional implementation, the gene-editing vector is a pLCNICK plasmid, which contains the core functional elements of the CRISPR / Cas9 genome editing system: the CRISPR-Cas9 D10A protein and sgRNA. As an optional implementation, the sgRNA is any one of sgRNA1 to sgRNA3; sgRNA1 to sgRNA3 knock out different target genes respectively; sgRNA1 targets the coding gene of lactate dehydrogenase LCAZH_0554, and the primer sequences of sgRNA1 are SEQ ID NO. 12 and SEQ ID NO. 13; sgRNA2 targets the coding gene of lactate dehydrogenase LCAZH_2512, and the primer sequences of sgRNA2 are SEQ ID NO. 20 and SEQ ID NO. 21; sgRNA3 targets the coding gene of the cluster protein, and the primer sequences of sgRNA3 are SEQ ID NO. 28 and SEQ ID NO. 29.

[0035] In the construction method of this invention, the pLCNICK plasmid is used to construct the following gene knockout plasmids: pLCNICK-0554 (knocking out the lactate dehydrogenase LCAZH_0554 gene), pLCNICK-2512 (knocking out the lactate dehydrogenase LCAZH_2512 gene), and pLCNICK-4 (knocking out the gene cluster protein containing the LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 genes); preferably, lactic acid bacteria are used. Lacticaseibacillus casei Zhang strain, as the recipient lactic acid bacteria (original starting strain), was sequentially introduced into the knockout plasmid pLCNICK-0554, knockout plasmid pLCNICK-2512, and knockout plasmid pLCNICK-4 to knock out three gene fragments (including two lactate dehydrogenase gene fragments and one gene fragment containing four gene cluster proteins).

[0036] In this invention, when constructing the knockout plasmid pLCNICK-0554, a seamless cloning method was used to introduce the sgRNA of the lactate dehydrogenase LCAZH_0554 gene into the pLCNICK plasmid; according to the NCBI database... Lacticaseibacillus casei Based on the lactate dehydrogenase gene sequence (SEQ ID NO. 1) of strain Zhang (accession number: CP001084.2) with protein_id=ADK19703.1 locus_tag=LCAZH_0554, knockout primers 0554UU (SEQ ID NO. 8), 0554UD (SEQ ID NO. 9), 0554DU (SEQ ID NO. 10), and 0554DD (SEQ ID NO. 11) were designed to knock out the LCAZH_0554 gene. 0554UU (SEQ ID NO. 8) was used as the upper primer for amplifying the upper homologous arm, 0554UD (SEQ ID NO. 9) as the lower primer for amplifying the upper homologous arm, 0554DU (SEQ ID NO. 10) as the upper primer for amplifying the lower homologous arm, and 0554DD (SEQ ID NO. 11) as the upper primer for amplifying the lower homologous arm. .11) is the primer for amplifying the lower homologous arm; the amplification template for the knockout primers 0554UU (SEQ ID NO. 8), 0554UD (SEQ ID NO. 9), 0554DU (SEQ ID NO. 10) and 0554DD (SEQ ID NO. 11) of the gene is... Lacticaseibacillus caseiZhang genomic DNA; knockout primers 0554sgRNAU (SEQ ID NO. 12) and 0554sgRNAD (SEQ ID NO. 13) for the lactate dehydrogenase LCAZH_0554 gene were designed based on the pLCNICK plasmid gene sequence; 0554sgRNAU (SEQ ID NO. 12) is the upper primer for amplifying sgRNA, and 0554sgRNAD (SEQ ID NO. 13) is the lower primer for amplifying sgRNA; the amplification template for the knockout primers 0554sgRNAU (SEQ ID NO. 12) and 0554sgRNAD (SEQ ID NO. 13) is the pLCNICK plasmid; the lower primer 0554sgRNAD (SEQ ID NO. 13) contains 20 single-stranded oligonucleotides. The N20 sequence of the knockout primers is used as a guide sequence to pair complementaryly with the lactate dehydrogenase (LCAZH_0554) gene, guiding the CRISPR-Cas9D10A protein to cleave the double-stranded LCAZH_0554 gene. The amplified fragment from the knockout primers is then seamlessly cloned into the pLCNICK plasmid to obtain a plasmid containing upper and lower homologous arms and sgRNA. The seamless cloning method includes PCR using TaKaRa's PrimeSTAR® HS DNA Polymerase system. Lacticaseibacillus casei2 μL of Zhang genomic DNA or pLCNICK plasmid (template), 1.5 μL of forward primer, 1.5 μL of reverse primer, 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture (2.5 mM), 0.5 μL of Prime STARHS DNA Polymerase (2.5 U / μL), and 30.5 μL of ddH2O. The forward primers include the upper homologous arm primer 0554UU (SEQ ID NO. 8), the lower homologous arm primer 0554DU (SEQ ID NO. 10), and the sgRNA upper primer 0554sgRNAU (SEQ ID NO. 12); the reverse primers include the upper homologous arm lower primer 0554UD (SEQ ID NO. 9), the lower homologous arm lower primer 0554DD (SEQ ID NO. 11), and the sgRNA lower primer 0554sgRNAD (SEQ ID NO. 13). The pLCNICK plasmid was double-digested with XbaI and ApaI restriction endonucleases. The restriction endonuclease digestion reaction system (50 μL) consisted of 2 μL pLCNICK plasmid (DNA template), 5 μL 10× buffer, 1 μL each of restriction endonucleases (XbaI and ApaI), and ddH2O to a final volume of 50 μL. The digestion reaction system was incubated at 37°C for 1–2 h, followed by inactivation at 65°C for 20 min, yielding the pLCNICK linearized plasmid. The upper and lower homologous arms and sgRNA fragment obtained from the PCR amplification were then seamlessly cloned with the pLCNICK linearized plasmid to construct the knockout plasmid pLCNICK-0554, which knocks out the lactate dehydrogenase LCAZH_0554 gene. As an optional implementation, the seamless cloning was performed using the Vazyme Clon Express® Ultra One Step Cloning Kit.

[0037] In this invention, when constructing the knockout plasmid pLCNICK-2512, a seamless cloning method was used to introduce the sgRNA that knocks out the lactate dehydrogenase LCAZH_2512 gene into the pLCNICK plasmid. (Based on data from the NCBI database...) Lacticaseibacillus casei Zhang(Accession number: CP001084.2) The gene sequence of lactate dehydrogenase protein_id = ADK17844.1 locus_tag = LCAZH_2512 in the strain genome (SEQ ID NO. 2) was used to design knockout primers 2512UU (SEQ ID NO. 16), 2512UD (SEQ ID NO. 17), 2512DU (SEQ ID NO. 18), and 2512DD (SEQ ID NO. 19). Specifically, 2512UU (SEQ ID NO. 16) and 2512UD (SEQ ID NO. 17) are the upper and lower primers for amplifying the upper homologous arm, respectively; 2512DU (SEQ ID NO. 18) and 2512DD (SEQ ID NO. 19) are the upper and lower primers for amplifying the lower homologous arm, respectively; the knockout primer 2512UU (SEQ ID NO. 16) is used to amplify the lower homologous arm, respectively. The amplification templates for 2512UD (SEQ ID NO. 16), 2512DU (SEQ ID NO. 18), and 2512DD (SEQ ID NO. 19) are: Lacticaseibacillus casei Zhang's genomic DNA; knockout primers 2512sgRNAU (SEQ ID NO. 20) and 2512sgRNAD (SEQ ID NO. 21) for the lactate dehydrogenase LCAZH_2512 gene were designed based on the pLCNICK plasmid gene sequence; 2512sgRNAU (SEQ ID NO. 20) and 2512sgRNAD (SEQ ID NO. 21) are the upper and lower primers for amplifying sgRNA, respectively; the amplification template for the knockout primers 2512sgRNAU (SEQ ID NO. 20) and 2512sgRNAD (SEQ ID NO. 21) is the pLCNICK plasmid; the lower primer of 2512sgRNAD (SEQ ID NO. 21) contains 20 single-stranded oligonucleotides. The N20 sequence of the 1bp gene; the N20 sequence is a guide sequence that can pair complementaryly with the bases of the lactate dehydrogenase LCAZH_2512 gene, guiding the CRISPR-Cas9 D10A protein to cleave the double strand of the lactate dehydrogenase LCAZH_2512 gene; the above knockout primer amplification fragment is seamlessly cloned using seamless cloning technology to obtain a plasmid containing the corresponding homologous arm and sgRNA; the seamless cloning method includes PCR using the TaKaRa PrimeSTAR® HSDNA Polymerase system, the PCR system being... Lacticaseibacillus casei2 μL of Zhang genomic DNA or pLCNICK plasmid (template), 1.5 μL of forward primer, 1.5 μL of reverse primer, 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture (2.5 mM), 0.5 μL of Prime STAR HS DNA Polymerase (2.5 U / μL), and 30.5 μL of ddH2O; the forward primers include upper homologous arm primer 2512UU (SEQ ID NO. 16), lower homologous arm primer 2512DU (SEQ ID NO. 18), and sgRNA upper primer 2512sgRNAU (SEQ ID NO. 20); the reverse primers include upper homologous arm lower primer 2512UD (SEQ ID NO. 17), lower homologous arm lower primer 2512DD (SEQ ID NO. 19), and sgRNA lower primer 2512sgRNAD (SEQ ID NO. 19). .21); The pLCNICK plasmid was double-digested with XbaI and ApaI restriction endonucleases; the restriction endonuclease digestion reaction system (50 μL): 2 μL pLCNICK plasmid (DNA template), 5 μL 10× buffer, 1 μL each of restriction endonucleases (XbaI and ApaI), and ddH2O to a final volume of 50 μL; the digestion reaction system was placed in a 37℃ water bath for 1-2 h, and then inactivated at 65℃ for 20 min; the pLCNICK linearized plasmid was obtained; the upper and lower homologous arms and sgRNA fragment obtained by PCR amplification were seamlessly cloned with the pLCNICK linearized plasmid to construct the knockout plasmid pLCNICK-2512. As an optional implementation method, the seamless cloning was performed using the Vazyme ClonExpress® Ultra One Step Cloning Kit.

[0038] In this invention, when constructing the knockout plasmid pLCNICK-4, a seamless cloning method was used to introduce the sgRNA of the gene fragment containing the gene cluster protein that knocks out the LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 genes into the pLCNICK plasmid. (Based on data from the NCBI database...) Lacticaseibacillus casei ZhangKnockout primers 4UU (SEQ ID NO. 24), 4UD (SEQ ID NO. 25), 4DU (SEQ ID NO. 26), and 4DD (SEQ ID NO. 27) were designed based on the gene sequences (SEQ ID NO. 7) of strain LCAZH_2364 (protein_id = ADK19571.1 locus_tag = LCAZH_2364), LCAZH_2365 (protein_id = ADK19572.1 locus_tag = LCAZH_2365), LCAZH_2366 (protein_id = ADK19573.1 locus_tag = LCAZH_2366), and LCAZH_2367 (protein_id = ADK19574.1 locus_tag = LCAZH_2367) in the genome of strain CP001084.2. 4UU (SEQ ID NO. 24) is the upper primer for amplifying the upper homologous arm, 4UD (SEQ ID NO. 25) is the lower primer for amplifying the upper homologous arm, 4DU (SEQ ID NO. 26) is the upper primer for amplifying the lower homologous arm, and 4DD (SEQ ID NO. 27) is the lower primer for amplifying the lower homologous arm; the amplification template for the knockout primers 4UU (SEQ ID NO. 24), 4UD (SEQ ID NO. 25), 4DU (SEQ ID NO. 26), and 4DD (SEQ ID NO. 27) is... Lacticaseibacillus caseiZhang genomic DNA; knockout primers 4sgRNAU (SEQ ID NO. 28) and 4sgRNAD (SEQ ID NO. 29) were designed based on the pLCNICK plasmid gene sequence to knock out the protein-coding genes (SEQ ID NO. 7) containing the LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 gene clusters; 4sgRNAU (SEQ ID NO. 28) and 4sgRNAD (SEQ ID NO. 29) are the upper and lower primers for amplifying sgRNA, respectively; the amplification template for the upper and lower primers of 4sgRNAU (SEQ ID NO. 28) and 4sgRNAD (SEQ ID NO. 29) is the pLCNICK plasmid; the lower primer of 4sgRNAD (SEQ ID NO. 29) contains 20 single-stranded oligonucleotides. The N20 sequence is a guide sequence that can pair complementaryly with the bases of the gene sequences encoding the LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 gene cluster proteins, guiding CRISPR-Cas9 D10A protein to cleave the double-stranded gene sequences encoding the LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 gene cluster proteins. The amplified fragment from the knockout primers is then seamlessly cloned using seamless cloning technology to obtain a plasmid containing the corresponding homologous arms and sgRNA. The homologous recombination method includes PCR using the TaKaRa PrimeSTAR® HSDNA Polymerase system. Lacticaseibacillus casei2 μL of Zhang genomic DNA or pLCNICK plasmid (template), 1.5 μL of forward primer, 1.5 μL of reverse primer, 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture (2.5 mM), 0.5 μL of Prime STAR HS DNA Polymerase (2.5 U / μL), and 30.5 μL of ddH2O; the forward primers include the upper homologous arm primer 4UU (SEQ ID NO. 24), the lower homologous arm primer 4DU (SEQ ID NO. 26), and the sgRNA upper primer 4sgRNAU (SEQ ID NO. 28); the reverse primers include the upper homologous arm primer 4UD (SEQ ID NO. 25), the lower homologous arm primer 4DD (SEQ ID NO. 27), and the sgRNA lower primer 4sgRNAD (SEQ ID NO. 28). .29); The pLCNICK plasmid was double-digested with XbaI and ApaI restriction endonucleases; the restriction endonuclease digestion reaction system (50 μL): 2 μL pLCNICK plasmid (DNA template), 5 μL 10× buffer, 1 μL each of restriction endonucleases (XbaI and ApaI), and ddH2O to a final volume of 50 μL; the digestion reaction system was placed in a 37℃ water bath for 1-2 h, and then inactivated at 65℃ for 20 min; the pLCNICK linearized plasmid was obtained; the upper and lower homologous arms and sgRNA fragment obtained by PCR amplification were seamlessly cloned with the pLCNICK linearized plasmid to construct the knockout plasmid pLCNICK-4. As an optional implementation method, the seamless cloning was performed using the Vazyme Clon Express® Ultra One Step Cloning Kit.

[0039] In this invention, the starting strain is derived from the original lactic acid bacteria. Lacticaseibacillus casei Zhang's competent cells were sequentially electroporated with the constructed gene knockout plasmids pLCNICK-0554, pLCNICK-2512, and pLCNICK-4 to knock out genes. As an optional implementation method, in the original strain... Lacticaseibacillus caseiBased on the Zhang gene, the lactate dehydrogenase (LCAZH_0554) gene was first knocked out by electroporation with the knockout plasmid pLCNICK-0554. Positive transformants were screened to obtain a genetically engineered lactic acid bacteria strain with only the LCAZH_0554 gene knocked out. Then, based on this strain, the LCAZH_2512 gene was knocked out by electroporation with the knockout plasmid pLCNICK-2512. Positive transformants were screened to obtain a genetically engineered lactic acid bacteria strain with both the LCAZH_0554 and LCAZH_2512 genes knocked out. Finally, the LCAZH_0554 gene was knocked out. Based on the engineered lactic acid bacteria strain containing the lactate dehydrogenase LCAZH_2512 gene, the gene fragments containing the LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 gene cluster proteins were further electroporated into the knockout plasmid pLCNICK-4. Positive transformants were screened, and finally, a lactic acid bacteria engineered strain with three gene fragments—two lactate dehydrogenase genes (LCAZH_0554 and LCAZH_2512) and four LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 gene cluster proteins—were obtained.

[0040] The present invention also provides the application of the genetically engineered lactic acid bacteria strain or the genetically engineered lactic acid bacteria strain constructed by the construction method in the production of malic acid.

[0041] This invention also provides a method for producing malic acid, wherein the genetically engineered lactic acid bacteria strain or the genetically engineered lactic acid bacteria strain constructed by the construction method is inoculated into a fermentation medium for fermentation to obtain malic acid. In this invention, the fermentation is preferably anaerobic fermentation, more preferably anaerobic static culture; the fermentation temperature is preferably 35℃~38℃, more preferably 36℃ or 37℃, and most preferably 37℃; the fermentation pH is 6~7, more preferably 6.5; the anaerobic static culture time is preferably greater than or equal to 48 h; the fermentation medium preferably contains only 10.0 g / L peptone, 10.0 g / L beef extract, 5.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 5.0 g / L sodium acetate, 0.1 g / L MgSO4, 0.05 g / L MnSO4, 2.0 g / L K2HPO4, and 1.0 g / L Tween 80, with the remainder being water.

[0042] As an optional implementation method, the genetically engineered lactic acid bacteria strain is activated and inoculated into a fermentation medium, and then subjected to anaerobic static culture at 37°C and pH=6.5 for 48 h to produce malic acid. The fermentation medium is formulated as follows: peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, triammonium citrate 2.0 g / L, sodium acetate 5.0 g / L, MgSO4 0.1 g / L, MnSO4 0.05 g / L, K2HPO4 2.0 g / L, and Tween 80 1.0 g / L, with the remainder being water.

[0043] In this invention, the genetically engineered lactic acid bacteria strain was used to knock out gene fragments of two lactate dehydrogenases (LCAZH_0554 and LCAZH_2512) and four gene cluster proteins (LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367), redirecting carbon flow from the lactic acid synthesis pathway to the malic acid synthesis pathway, thereby significantly increasing the yield of malic acid produced by the original lactic acid bacteria fermentation.

[0044] In the following embodiments of the present invention, lactic acid bacteria Lacticaseibacillus casei Zhang is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 1697. It has been disclosed in the following prior art: Lactic acid bacteria with accession number CGMCC No. 1697. Lacticaseibacillus casei Zhang Reference: Zhang W, Yu D, Sun Z, Wu R, Chen 10.1128 / JB.00802-10. Epub 2010 Jul30. PMID: 20675486; PMCID: PMC2944517.

[0045] In the following examples, the commercially available pLCNICK plasmid was purchased from addgene (Catalog #: 84653), and the host cell was Escherichia coli Stbl3 competent cells.

[0046] Unless otherwise specified, the test methods used in the following examples are conventional test methods; the materials and reagents used are commercially available unless otherwise specified.

[0047] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.

[0048] Example 1 Construction of engineered lactic acid bacteria that produce malic acid Lactic acid bacteria Lacticaseibacillus casei Zhang was isolated and screened from fermented mare's milk from herders in the Xilingol Grassland of Inner Mongolia Autonomous Region by Inner Mongolia Agricultural University. It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 1697.

[0049] lactic acid bacteria Lacticaseibacillus casei Zhang was activated in an activation medium, and the lactic acid bacteria were... Lacticaseibacillus casei The formula for Zhang's activation medium is as follows: peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, triammonium citrate 2.0 g / L, sodium acetate 5.0 g / L, MgSO4 0.1 g / L, MnSO4 0.05 g / L, K2HPO4 2.0 g / L, and Tween 80 1.0 g / L.

[0050] Lactic acid bacteria Lacticaseibacillus casei After activation, Zhang was subjected to anaerobic static culture at a temperature of 37℃ and a pH of 6.5.

[0051] The commercially available pLCNICK plasmid was purchased from Addgene (Catalog #: 84653), and its host is *E. coli* Stbl3. The activation medium for *E. coli* Stbl3 containing the pLCNICK plasmid was formulated as follows: 10 g / L peptone, 5 g / L yeast extract, and 5 g / L sodium chloride. Kanamycin was added to the medium at a final concentration of 50 µg / mL. After activation, the *E. coli* Stbl3 containing the pLCNICK plasmid was aerobically cultured for 18 h at 30 ℃, pH 7.0, and 250 rpm.

[0052] 1. Lacticaseibacillus casei Gene knockout plasmids were constructed for two lactate dehydrogenases (LCAZH_0554 and LCAZH_2512) and four gene cluster proteins (LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367) in the genome of strain Zhang. According to the NCBI database Lacticaseibacillus casei Knockout primers 0554UU (SEQ ID NO. 8), 0554UD (SEQ ID NO. 9), 0554DU (SEQ ID NO. 10), and 0554DD (SEQ ID NO. 11) were designed based on the coding gene sequence of lactate dehydrogenase protein_id=ADK19703.1 locus_tag=LCAZH_0554 in the genome of strain Zhang (accession number: CP001084.2). Primers 0554YZU (SEQ ID NO. 14) and 0554YZD (SEQ ID NO. 15) were validated. sgRNA primers 0554sgRNAU (SEQ ID NO. 12) and 0554sgRNAD (SEQ ID NO. 13) were designed based on the pLCNICK plasmid, as detailed in Table 1.

[0053] Knockout primers 2512UU (SEQ ID NO. 16), 2512UD (SEQ ID NO. 17), 2512DU (SEQ ID NO. 18), and 2512DD (SEQ ID NO. 19) were designed based on the coding gene sequence of lactate dehydrogenase protein_id=ADK17844.1 locus_tag=LCAZH_2512 (SEQ ID NO. 19). Primers 2512YZU (SEQ ID NO. 22) and 2512YZD (SEQ ID NO. 23) were validated. sgRNA primers 2512sgRNAU (SEQ ID NO. 20) and 2512sgRNAD (SEQ ID NO. 21) were designed based on the pLCNICK plasmid. See Table 1 for details.

[0054] Knockout primers 4UU (SEQ ID NO. 24), 4UD (SEQ ID NO. 25), 4DU (SEQ ID NO. 26), and 4DD (SEQ ID NO. 27) were designed based on the gene sequences encoding LCAZH_2364 (protein_id=ADK19571.1 locus_tag=LCAZH_2364), LCAZH_2365 (protein_id=ADK19572.1 locus_tag=LCAZH_2365), LCAZH_2366 (protein_id=ADK19573.1 locus_tag=LCAZH_2366), and LCAZH_2367 (protein_id=ADK19574.1 locus_tag=LCAZH_2367) (SEQ ID NO. 7). Primers 4YZU (SEQ ID NO. 30) and 4YZD (SEQ ID NO. 27) were validated. .31); Design sgRNA primers 4sgRNAU (SEQ ID NO. 28) and 4sgRNAD (SEQ ID NO. 29) based on pLCNICK plasmid, see Table 1 for details.

[0055] The various primers designed above were biosynthesized by Tianjin Qingke Biotechnology Co., Ltd.

[0056] extract Lacticaseibacillus casei Zhang's genomic DNA, the Lacticaseibacillus casei Zhang's genomic DNA was extracted according to the Gram-positive bacteria extraction method in the bacterial genome extraction kit (TIANGEN, catalog number: DP302).

[0057] by Lacticaseibacillus casei Zhang genomic DNA and pLCNICK plasmid were used as templates. PCR was performed using TaKaRa's PrimeSTAR® HS DNA Polymerase system. template( Lacticaseibacillus casei 2 μL of Zhang genomic DNA or pLCNICK plasmid (template concentration <200 ng), 1.5 μL of forward primer (15 pmol), 1.5 μL of reverse primer (15 pmol), 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture (2.5 mM), 0.5 μL of Prime STAR HS DNA Polymerase (2.5 U / μL), and 0.5 μL of ddH2O.

[0058] The aforementioned forward and reverse primers refer to the upper and lower primers for the upper and lower homologous arms of the target gene, and the upper and lower primers for sgRNA, respectively. The sequences of each primer are detailed in Table 1. Taking LCAZH 0554 (target gene) as an example: Lacticaseibacillus casei Using Zhang's genomic DNA as a template, the upper and lower homologous arms of the LCAZH 0554 encoding gene to be knocked out were amplified using primers 0554UU (SEQ ID NO. 8) and 0554UD (SEQ ID NO. 9) for the upper homologous arm, and primers 0554DU (SEQ ID NO. 10) and 0554DD (SEQ ID NO. 11) for the lower homologous arm. Using the pLCNICK plasmid as a template, sgRNA1 was amplified using primers 0554sgRNAU (SEQ ID NO. 12) and 0554sgRNAD (SEQ ID NO. 13) for the upper and lower homologous arms. After amplification, the upper and lower homologous arms, sgRNA1, and the pLCNICK linearized plasmid were seamlessly cloned to obtain the knockout plasmid pLCNICK-0554 containing the homologous arms and sgRNA. Similarly, knockout plasmids pLCNICK-2512 and pLCNICK-4 were obtained, containing four gene cluster proteins: LCAZH2512, LCAZH2364, LCAZH2365, LCAZH2366, and LCAZH2367.

[0059] Table 1. Sequences of gene knockout primers and validation primers.

[0060] Note: The bolded part is the N20 sequence, which is 20 bp in length and can pair complementaryly with the gene sequence to be knocked out.

[0061] The PCR reaction procedures for knockout primers, sgRNA amplification, or positive bacteria verification were as follows: 98℃ (1 min for plasmids or genome, 10 min for colonies or bacterial suspensions); 98℃ for 10 s, 55℃ for 5 s, 72℃ (time calculated at 1 kb / min), for a total of 30 cycles; final extension at 72℃ for 1 min.

[0062] The PCR fragments were recovered from the gel according to the instructions in the OMEGA EZNA® Cycle Pure Kit (V-spin).

[0063] The pLCNICK plasmid was extracted according to the extraction method of the plasmid miniprep kit (TIANGEN, DP103).

[0064] The pLCNICK plasmid was double-digested with XbaI (NEB, # R0145S) and ApaI (NEB, # R0114S) restriction endonucleases.

[0065] The restriction endonuclease digestion reaction system (50 μL) is as follows: DNA template (pLCNICK plasmid) 2 μL, 10× buffer 5 μL, restriction endonuclease (XbaI and ApaI) 1 μL each, and ddH2O to make up to 50 μL.

[0066] The enzyme digestion reaction system was placed in a 37℃ water bath for 1-2 hours for digestion, and then inactivated at 65℃ for 20 minutes after digestion.

[0067] The target product was recovered and purified according to the instructions of the OMEGA EZNA® Cycle Pure Kit (V-spin).

[0068] Following the instructions in the Vazyme Clon Express® Ultra One Step Cloning Kit, the purified and recovered upstream and downstream homologous arms, sgRNA, and pLCNICK digested plasmid fragments were seamlessly cloned to construct a knockout plasmid. The completed plasmid map is shown below. Figures 1 - 3 As shown.

[0069] (2). Lacticaseibacillus casei Gene knockout of two lactate dehydrogenases and four gene cluster proteins (LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367) in the Zhang genome.

[0070] Towards Lacticaseibacillus casei Gene knockout was performed on gene knockout plasmids constructed by electroporation in Zhang competent cells. In the original strain ( Lacticaseibacillus casei Based on Zhang, three gene knockouts were performed sequentially to finally obtain engineered bacteria with three gene fragments knocked out: LCAZH 0554, LCAZH 2512, and LCAZH 2364~2367.

[0071] Lacticaseibacillus casei Zhang competent cells were prepared as follows: cells that had been activated and cultured overnight were... Lacticaseibacillus caseiZhang bacterial culture was inoculated at a 1% inoculum into a medium containing 10.0 g / L peptone, 10.0 g / L beef extract, 5.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 5.0 g / L sodium acetate, 0.1 g / L MgSO4, 0.05 g / L MnSO4, 2.0 g / L K2HPO4, 1.0 g / L Tween 80, 10 g / L glycine, and 137 g / L sorbitol. The culture was then statically anaerobic at 37°C until OD500. 600 Reach a concentration of 0.5-0.6. Cool the bacterial culture in an ice bath for 10 min, gently shaking continuously to ensure complete cooling. Aliquot the culture into 50 mL centrifuge tubes, centrifuge at 4000 rpm for 10 min at 4°C, discard the supernatant, and invert the centrifuge tubes for 1 min to remove the culture medium. Add 20 mL of ice-cold wash buffer (containing 342 g / L sucrose and 0.7 g / L MgCl2(H2O)6), gently pipette to resuspend the cells, centrifuge at 4000 rpm for 10 min at 4°C, and discard the supernatant. Repeat this step twice. Add 5 mL of ice-cold wash buffer into a centrifuge tube, gently pipette to resuspend the cells, aliquot into 1.5 mL centrifuge tubes, centrifuge at 4000 rpm for 10 min at 4°C, and discard the supernatant. Add 40-80 μL of ice-cold wash buffer to obtain the culture medium. Lacticaseibacillus casei Zhang competent cells.

[0072] Lacticaseibacillus casei The electroporation procedure for Zhang competent cells is as follows: Take 40 μL of competent cells, add 5 μL (800~1000 ng) of gene knockout plasmid, mix gently, and place on ice. Wash the electroporation cuvette several times with anhydrous ethanol, air dry in a clean bench, rinse three times with rinsing buffer, and then pre-cool on ice for 10 min. Slowly add the competent lactic acid bacteria cells with the plasmid to the electroporation cuvette. The electroporation conditions are: 2000 V, 25 µF, 400 Ω.

[0073] Immediately after electroporation, the samples were incubated at 37°C for 2–3 h in 800 μL of resuscitation medium containing 10.0 g / L peptone, 10.0 g / L beef extract, 5.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 5.0 g / L sodium acetate, 0.1 g / L MgSO4, 0.05 g / L MnSO4, 2.0 g / L K2HPO4, 1.0 g / L Tween 80, 137 g / L sorbitol, 20.3 g / L MgCl2(H2O)6, and 1.1 g / L CaCl2.

[0074] Take an appropriate amount of the revived bacterial culture and spread it on a selection medium containing 10.0 g / L peptone, 10.0 g / L beef extract, 5.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 5.0 g / L sodium acetate, 0.1 g / L MgSO4, 0.05 g / L MnSO4, 2.0 g / L K2HPO4, 1.0 g / L Tween 80, 20 g / L agar, and 5 µg / mL erythromycin. Incubate anaerobicly inverted incubation for 48–72 h. After single bacteria have grown on the plates, screen for positive transformants.

[0075] (3) Verification of lactic acid bacteria gene knockout engineered bacteria.

[0076] Towards Lacticaseibacillus casei Zhang competent cells were used to select single colonies from erythromycin agar plates for the electroconversion gene knockout plasmid pLCNICK-0554. The positive single colonies of the lactate dehydrogenase gene knocked out protein_id=ADK19703.1 locus_tag=LCAZH_0554 were screened using the validation primers 0554YZU (SEQ ID NO. 14) and 0554YZD (SEQ ID NO. 15).

[0077] Positive colony PCR verification was performed using the TaKaRa PrimeSTAR® HS DNA Polymerase system described above.

[0078] The validation results showed that the transformant with successful knockout of the lactate dehydrogenase protein_id=ADK19703.1 locus_tag=LCAZH_0554 gene had an electrophoretic band size of 2000 bp, while the control group without knockout had an electrophoretic band size of 3000 bp. Figure 4 ).

[0079] Electroporation was performed on the gene knockout plasmid pLCNICK-2512 of the strain that knocked out the lactate dehydrogenase protein_id=ADK19703.1 locus_tag=LCAZH_0554 gene. Single colonies were picked from the plate and positive single colonies of the lactate dehydrogenase protein_id=ADK17844.1 locus_tag=LCAZH_2512 gene were screened using validation primers 2512YZU (SEQ ID NO. 22) and 2512YZD (SEQ ID NO. 23).

[0080] Positive colony PCR verification was performed using the TaKaRa PrimeSTAR® HS DNA Polymerase system described above.

[0081] The validation results showed that the transformant with successful knockout of the lactate dehydrogenase gene (protein_id=ADK17844.1 locus_tag=LCAZH_2512) had an electrophoretic band size of 2000 bp, while the control group without knockout had an electrophoretic band size of 3000 bp. Figure 5 ).

[0082] Electrotransformation gene knockout plasmid pLCNICK-4 was used to select single colonies from the plate from strains that successfully knocked out two lactate dehydrogenases. The positive single colonies that knocked out the LCAZH_2364, LCAZH_2365, LCAZH_2366 and LCAZH_2367 gene cluster proteins were screened using the validation primers 4YZU (SEQ ID NO. 30) and 4YZD (SEQ ID NO. 31).

[0083] Positive colony PCR verification was performed using the TaKaRa PrimeSTAR® HS DNA Polymerase system described above.

[0084] The verification results show: Transformants who successfully knocked out the LCAZH_2364, LCAZH_2365, LCAZH_2366, and LCAZH_2367 gene cluster proteins showed an electrophoretic band size of 2000 bp, while the control group without knockout showed a band size of 3000 bp. Figure 6 ).

[0085] Example 2 Malic acid production using genetically engineered lactic acid bacteria fermentation After activation, the engineered lactic acid bacteria strains were subjected to anaerobic static culture at 37℃ and pH=6.5 for 48 h.

[0086] The fermentation medium contained 10.0 g / L peptone, 10.0 g / L beef extract, 5.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 5.0 g / L sodium acetate, 0.1 g / L MgSO4, 0.05 g / L MnSO4, 2.0 g / L K2HPO4, and 1.0 g / L Tween 80.

[0087] Method for extracting malic acid from fermentation broth: collection Lacticaseibacillus casei Fermentation broths of Zhang and engineered lactic acid bacteria strains at different time points were placed in an ice bath at 4 ℃ for 10 min and then centrifuged at high speed (13000 g, 4 ℃, 10 min). 10 µL of the supernatant was collected, 1.99 mL of 50% methanol-water was added, and the mixture was shaken well and centrifuged again. Finally, the supernatant (0.22 µm) was filtered, and the filtrate was transferred to sample vials and stored at -80 ℃ until use.

[0088] Malic acid standard was purchased from Sigma-Aldrich, USA. It was dissolved and diluted with 50% methanol-water to prepare a stock solution with an initial concentration of 10 mg / mL, and stored at -80°C. Before use, the stock solution was thawed in a 4°C freezer.

[0089] 2.1 Dilution of malic acid standard: The stock solution was continuously vortexed for 1 min and then serially diluted with blank culture medium, with the gradient ranging from 100 ng / mL to 20 μg / mL.

[0090] 2.2 Extraction of malic acid from matrix-spiked samples: Spiked samples with different matrix concentrations were centrifuged at high speed (13000 g, 4 ℃, 10 min). 10 µL of the supernatant was aspirated, 1.99 mL of 50% methanol-water was added, and the mixture was shaken well and centrifuged again. Finally, the supernatant (0.22 µm) was filtered, transferred to sample vials, and stored at -80 ℃ until use.

[0091] 2.3 High Performance Liquid Chromatography (ExionLC AD) Parameters: Chromatographic column: Waters ACQUITY UPLC HSS T3 C18 column (2.1×100 mm, 1.8 μm); autosampler temperature: 4 ℃; column oven temperature: 40 ℃; mobile phase A: ultrapure water (containing 0.1% formic acid); mobile phase B: methanol (containing 0.1% formic acid); mobile phase gradient: 0.0–10.0 min, 5.0% mobile phase B; 1.0–6.5 min, 5.0–100.0% mobile phase B; 6.5–9.5 min, 100.0–100.0% mobile phase B; 9.5–11.0 min, 100.0%–5.0% mobile phase B; 11.0–12.0 min, 5.0% mobile phase B; flow rate: 0.4 mL / min; injection volume: 1 µL.

[0092] 2.4 Triple quadrupole mass spectrometry (Qtrap 6500+) parameters: Curtain gas: 25 psi; Ion source gas 1: 50 psi; Ion source gas 2: 50 psi; Ion source temperature: 550 ℃; Ion source positive ion mode voltage: 5500V; Ion source negative ion mode voltage: -4500 V; Collision gas: nitrogen; Mass spectrometry scanning mode: MRM (Multiple reaction monitoring) scan.

[0093] Table 2 shows the malic acid MRM detection channel, retention time, and optimal detection voltage.

[0094] Table 2. Detection channels, retention times, and optimal detection voltages for malic acid MRM.

[0095] Chromatogram and retention time of malic acid in fermentation broth of genetically engineered bacteria as follows: Figure 7 As shown.

[0096] Calculation of malic acid concentration in fermentation broth: A standard curve is plotted using the peak area of ​​the malic acid-spiked sample and the amount of malic acid added (e.g., Figure 8 As shown), Lacticaseibacillus casei The peak areas of fermentation broth samples from Zhang and the engineered strain at different time points were substituted into the standard curve to calculate the malic acid concentration. The results are as follows: Figure 9 As shown.

[0097] Malic acid concentration in fermentation broth = concentration calculated from standard curve × dilution factor (200 times).

[0098] The malic acid concentrations in the 24-hour and 48-hour fermentation broths of the engineered lactic acid bacteria were significantly higher than those of the original bacteria. The malic acid concentration in the 48-hour fermentation broth of the original bacteria was 0.50 g / L, while the malic acid concentration in the 48-hour fermentation broth of the engineered lactic acid bacteria reached 2.05 g / L.

[0099] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A genetically engineered strain of lactic acid bacteria that produces malic acid, characterized in that, Blocking the expression or activity of two lactate dehydrogenases and one cluster protein in receptor lactic acid bacteria. The two lactate dehydrogenases are lactate dehydrogenase LCAZH_0554 and lactate dehydrogenase LCAZH_2512, respectively. The cluster protein is a cluster protein containing the genes LCAZH_2364, LCAZH_2365, LCAZH_2366 and LCAZH_2367; The amino acid sequence of the lactate dehydrogenase LCAZH_0554 is identical to the amino acid sequence of NCBI accession number: CP001084.2 protein_id=ADK19703.1 locus_tag=LCAZH_0554; The amino acid sequence of the lactate dehydrogenase LCAZH_2512 is consistent with the amino acid sequence of the gene with NCBI accession number CP001084.2 and protein_id = ADK17844.1 locus_tag = LCAZH_2512; The amino acid sequence of LCAZH_2364 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19571.1 locus_tag = LCAZH_2364; The amino acid sequence of LCAZH_2365 is identical to the amino acid sequence of LCAZH_2365 accessed on NCBI with accession number CP001084.2 protein_id=ADK19572.1 locus_tag=. The amino acid sequence of LCAZH_2366 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19573.1 locus_tag = LCAZH_2366; The amino acid sequence of LCAZH_2367 is identical to that of NCBI accession number CP001084.2 protein_id =ADK19574.1 locus_tag = LCAZH_2367.

2. The genetically engineered lactic acid bacteria strain according to claim 1, characterized in that, The encoding gene of the lactate dehydrogenase LCAZH_2512 is shown in SEQ ID NO. 1; the encoding gene of the lactate dehydrogenase LCAZH_2512 is shown in SEQ ID NO. 2; and the encoding gene of the cluster protein is shown in SEQ ID NO.

3.

3. The genetically engineered lactic acid bacteria strain according to claim 1 or 2, characterized in that, The recipient lactic acid bacteria include Lacticaseibacillus casei Zhang.

4. The method for constructing the genetically engineered lactic acid bacteria strain according to any one of claims 1 to 3, characterized in that, The coding genes for the two lactate dehydrogenases and the coding gene for the cluster protein in the recipient lactic acid bacteria were knocked out using three gene editing vectors to obtain the genetically engineered lactic acid bacteria strain that produces malic acid.

5. The construction method according to claim 4, characterized in that, All three gene editing vectors include a CRISPR / Cas system, which includes a CRISPR-Cas9 D10A protein and sgRNA; the sgRNA is any one of sgRNA1 to sgRNA3. The sgRNA1 targets the gene encoding the lactate dehydrogenase LCAZH_0554, and the primer sequences of the sgRNA1 are SEQ ID NO. 12 and SEQ ID NO. 13; The sgRNA2 targets the gene encoding the lactate dehydrogenase LCAZH_2512, and the primer sequences for the sgRNA2 are SEQ ID NO. 20 and SEQ ID NO. 21; The sgRNA3 targets the gene encoding the cluster protein, and the primer sequences of the sgRNA3 are SEQ ID NO. 28 and SEQ ID NO.

29.

6. The construction method according to claim 5, characterized in that, The knockout method includes: using pLCNICK plasmid as a backbone vector, constructing knockout plasmids pLCNICK-0554, pLCNICK-2512 and pLCNICK-4 containing the CRISPR-Cas9 D10A protein and the sgRNA, respectively. In recipient bacteria Lacticaseibacillus casei In Zhang, the knockout plasmids pLCNICK-0554, pLCNICK-2512, and pLCNICK-4 were sequentially introduced to knock out the target gene.

7. The application of the genetically engineered lactic acid bacteria strain according to any one of claims 1 to 3 or the genetically engineered lactic acid bacteria strain constructed by any one of claims 4 to 6 in the production of malic acid.

8. A method for producing malic acid, characterized in that, The lactic acid bacteria genetically engineered strains described in any of claims 1 to 3 or the lactic acid bacteria genetically engineered strains constructed by any of the construction methods described in claims 4 to 6 are inoculated into a fermentation medium for fermentation to obtain malic acid.

9. The method according to claim 8, characterized in that, The fermentation is anaerobic fermentation, the fermentation temperature is 35℃~38℃, the fermentation pH value is 6~7, the anaerobic fermentation is anaerobic static culture, and the anaerobic static culture time is greater than or equal to 48 h.

10. The method according to claim 8, characterized in that, The fermentation medium was formulated with 10.0 g / L peptone, 10.0 g / L beef extract, 5.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 5.0 g / L sodium acetate, 0.1 g / L MgSO4, 0.05 g / L MnSO4, 2.0 g / L K2HPO4, and 1.0 g / L Tween 80, with the remainder being water.

Images