Application of LcbZIP53 gene in regulation and control of sizes of litchi seeds
By silencing or overexpressing the LcbZIP53 gene in litchi, the size of litchi seeds can be regulated, solving the problem of litchi seed size regulation in existing technologies and achieving improved fruit edibility and enhanced industrial benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-20
- Publication Date
- 2026-03-13
AI Technical Summary
Current technologies have failed to effectively control the size of litchi seeds, affecting fruit yield, quality, and market value.
By silencing the LcbZIP53 gene in litchi or overexpressing the LcbZIP53 gene in Arabidopsis thaliana, the size of litchi seeds can be regulated using genetic engineering techniques, resulting in smaller or larger seeds, respectively.
Successfully controlled the size of litchi seeds, improved the edible rate of the fruit, increased industrial benefits, and cultivated stable new litchi varieties with small seeds or no seeds.
Smart Images

Figure CN121653159A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular biology, specifically to the application of the LcbZIP53 gene in regulating litchi seed size. Background Technology
[0002] Seed size is a crucial agronomic trait determining fruit yield, quality, and market value. Lychee, as an important tropical economic crop, is widely cultivated not only in Asia but also holds a significant position in the global fruit market. Its seed size directly affects the proportion of edible portion, commercial appearance, and economic benefits, significantly influencing fruit yield, quality, and market value. Currently, lychee varieties can be categorized into three types based on seed size: normal-seeded, partially aborted-seeded (small-seeded), and seedless. Among these, small-seeded and seedless varieties are highly favored by consumers due to their higher flesh ratio, lower seed content, and superior marketability, making them the mainstream varieties sold in the market.
[0003] Therefore, in order to meet the industry's demand for high edibility, superior quality, and stable yield and efficiency, systematic research should be conducted on the formation of litchi seed size and transformed into production-operable technologies. These technologies can be used to promote the large-scale and stable production of high-edibility fruits, improve the consistency of yield and quality, reduce overall costs, and enhance market competitiveness. Summary of the Invention
[0004] This invention overcomes the shortcomings of existing technologies by providing an application of the LcbZIP53 gene in regulating litchi seed size. Silencing LcbZIP53 in litchi leads to significantly smaller seeds, while overexpression of LcbZIP53 in Arabidopsis thaliana leads to significantly larger seeds than the wild type.
[0005] To achieve the above objectives, the present invention provides the following technical solution: Technical Solution 1: Application of LcbZIP53 gene in regulating litchi seed size, wherein the nucleotide sequence of LcbZIP53 gene is shown in SEQ ID NO.1, and the protein sequence encoded by LcbZIP53 gene is shown in SEQ ID NO.2.
[0006] This invention provides a novel gene, LcbZIP53, that regulates the size of litchi seeds. It specifically regulates the development of litchi endosperm and seed cell size, thereby affecting seed formation.
[0007] Technical Solution 2: Providing the application of recombinant vectors of the LcbZIP53 gene in regulating litchi seed size.
[0008] Furthermore, the recombinant vector is LcbZIP53-pEarlyGate201 or LcbZIP53-pTRV2.
[0009] LcbZIP53-pEarlyGate201 is an overexpression vector, and LcbZIP53-pTRV2 is a gene silencing vector.
[0010] Furthermore, overexpression of the LcbZIP53 gene results in larger litchi seeds; inhibition of the LcbZIP53 gene results in smaller litchi seeds.
[0011] This invention regulates litchi seed size by overexpressing LcbZIP53 in Arabidopsis thaliana or silencing LcbZIP53 in litchi. Specifically, overexpressing LcbZIP53 in Arabidopsis thaliana increases seed size, while silencing LcbZIP53 in litchi decreases seed size.
[0012] Transgenic Arabidopsis seeds exhibit changes in seed length, width, and the length and width of seed epidermal cells. Specifically, the seed length and width are significantly increased, and the length and width of seed cells are also significantly increased.
[0013] Silent LcbZIP53 gene in litchi seeds manifests as changes in seed weight and seed size; specifically, seed weight is significantly reduced and seed size is smaller.
[0014] Technical Solution 3: A method for increasing the size of litchi seeds is provided, comprising overexpressing the LcbZIP53 gene to increase the size of the litchi seeds, wherein the nucleotide sequence of the LcbZIP53 gene is shown in SEQ ID No. 1.
[0015] Furthermore, the overexpression of the LcbZIP53 gene includes overexpression of LcbZIP53 in Arabidopsis thaliana to achieve seed enlargement.
[0016] In this invention, LcbZIP53 overexpressing plants in Arabidopsis thaliana are obtained through the following steps: The litchi LcbZIP53 gene as shown in SEQ ID NO.1 was cloned, and the litchi LcbZIP53 gene was introduced into the vector pEarlyGate201 to construct the recombinant expression vector LcbZIP53-pEarlyGate201. The recombinant expression vector was transformed into Agrobacterium GV3101, and Agrobacterium infection solution with the vector was prepared. Arabidopsis was then infected, and after cultivation, transgenic Arabidopsis lines overexpressing the LcbZIP53 gene were obtained.
[0017] Technical Solution 4: A method for reducing the size of litchi seeds is provided, comprising inhibiting the expression of the LcbZIP53 gene or the activity of its encoded protein to reduce the size of the litchi seeds, wherein the nucleotide sequence of the LcbZIP53 gene is shown in SEQ ID No. 1, and the protein sequence encoded by the LcbZIP53 gene is shown in SEQ ID No. 2.
[0018] Furthermore, the inhibition of LcbZIP53 gene expression includes silencing the LcbZIP53 gene in litchi to achieve smaller litchi seeds.
[0019] In this invention, silencing LcbZIP53 in litchi is obtained through the following steps: The LcbZIP53 gene was constructed into the pTRV2 vector, the sequence of which is shown in SEQ ID NO.1, to obtain the recombinant vector LcbZIP53-pTRV2. Agrobacterium tumefaciens containing the vector was prepared and injected into litchi fruit to silence LcbZIP53 in litchi.
[0020] Technical Solution 5: Providing the application of the LcbZIP53 gene or its encoded protein in the edibility of litchi fruit, wherein the LcbZIP53 gene is used to improve the size trait of litchi seeds, the nucleotide sequence of the LcbZIP53 gene is shown in SEQ ID NO.1, and the protein sequence encoded by the LcbZIP53 gene is shown in SEQ ID NO.2.
[0021] Furthermore, by transforming litchi plants with an overexpression vector containing the LcbZIP53 gene, transgenic litchi with enlarged seeds can be obtained; or by introducing a silencing vector containing the LcbZIP53 gene into litchi plants, litchi with smaller seeds can be obtained.
[0022] The beneficial effects of this invention are: This invention reveals for the first time the function of the litchi LcbZIP53 gene in regulating litchi seed size. The results show that silencing the LcbZIP53 gene in litchi using VIGS technology can reduce the size of litchi seeds. Conversely, overexpression of the LcbZIP53 gene in the model plant Arabidopsis thaliana can increase the size of Arabidopsis thaliana seeds. This indicates that LcbZIP53 is a key gene that positively regulates seed size, and inhibiting its function can achieve seed miniaturization.
[0023] The LcbZIP53 gene provided by this invention offers valuable genetic resources and a novel technical approach for molecular breeding of litchi and other fruit trees. By using genetic engineering methods, such as gene silencing and gene editing, the expression of the LcbZIP53 gene can be specifically inhibited, which can be directly used to cultivate stable small-seeded or seedless litchi varieties, thereby effectively improving the edible rate of the fruit and enhancing the benefits of the industry.
[0024] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and do not limit this application. Attached Figure Description
[0025] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.
[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0027] Figure 1 This is a schematic diagram of the LcbZIP53-pEarlyGate201 overexpression vector in an embodiment of the present invention; Figure 2 This is a schematic diagram of the LcbZIP53-pTRV2 gene silencing vector in an embodiment of the present invention; Figure 3 To verify the overexpression function of the LcbZIP53 gene in Arabidopsis thaliana in this embodiment of the invention, overexpression of the gene in Arabidopsis thaliana leads to seed enlargement; Seed length is seed length, Seed width is seed width, Cell length is cell length, and Cell width is cell width. Figure 4 This invention provides a verification of the silencing function of the LcbZIP53 gene in litchi, wherein silencing the gene in litchi results in smaller seeds; seed weight is the weight of the seed, and seed size is the size of the seed. Detailed Implementation
[0028] Preferred embodiments of the invention will now be described in more detail. While preferred embodiments of the invention have been shown, it should be understood that the invention can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that the invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
[0029] Through experimental methods in this field, we obtained Figures 1-4 The results shown indicate that those skilled in the art can perform the corresponding experiments based on the experiment names; only a brief explanation is provided here.
[0030] Example 1: Constructing a carrier (1) Gene cloning Using cDNA from 'Feizixiao' lychee seeds as amplification templates, PCR amplification was performed using Takara's Primestar high-fidelity enzyme.
[0031] Table 1 PCR reaction system
[0032] The amplification conditions were as follows: 98℃ for 2 min; 98℃ for 10 s; 55℃ for 15 s; 72℃ for 1 min; Step 2-Step 4 34 cycles; 72℃ for 5 min; and constant temperature storage at 16℃.
[0033] The primers used for gene amplification are: pEarlyGate201-LcbZIP53-F:tttggagaggacacgctcgagATGTCATCAATTCAGAAACAGAC pEarlyGate201-LcbZIP53-R:agcaggactctagggactagtCTAAAACTGGAGCAAGTCAG pTRV2-LcbZIP53-F:gaaggcctccatggggatccATGTCATCAATTCAGAAACAGAC pTRV2-LcbZIP53-R:cttcgggacatgcccgggCATTGTTGGCAGATTCCATC Take 50 μL of PCR product, add 5 μL of 3 M NaOAc and 250 μL of anhydrous ethanol, and mix thoroughly. Centrifuge at 10,000×g for 30 min at 4℃, carefully discard the supernatant, and gently wash the precipitate with 70% ethanol (centrifuge at 10,000×g for 5 min at 4℃), then discard the supernatant again. Air dry at room temperature until the precipitate is colorless and transparent but not too dry, and dissolve it in 50 μL of sterile water (you can gently pipette or vortex briefly). Use NanoDrop 2000 to determine the concentration / purity, and store the sample at -20℃.
[0034] (2) Double enzyme digestion The skeletal vectors used were pEarlyGate201 and pTRV2, respectively; The vector was digested using a double enzyme digestion method: The restriction sites used in pEarlyGate201 are 5'XhoI:CTCGAG and 3'SpeI:ACTAGT; The restriction sites used for pTRV2 are 5'BamHI:GGATCC and 3'SmaI:CCCGGG.
[0035] The enzyme digestion system was as follows: 1 μL each of the two restriction enzymes; 1 ng of vector plasmid; 5 μL of rCutsmart buffer; sterile water to a final volume of 50 μL; digestion overnight at 37°C.
[0036] Recovery of enzyme digestion products; 50 μL of enzyme digestion product; 5 μL of 3 M NaOAC; 250 μL of anhydrous ethanol; mix well, centrifuge at 10000 g for 30 min at 4℃; discard the supernatant, gently wash the precipitate with 70% ethanol, discard the supernatant; air dry at room temperature until the precipitate is colorless and transparent, add 50 μL of sterile water to dissolve the precipitate, measure the concentration with NanoDrop 2000, and store at -20℃.
[0037] (3) Recombinant vector Recombinant vectors were constructed using an in-fusion method. The reaction mixture consisted of: 5 μL of 2×CE mix; 0.03 pmol of the target gene fragment; 0.06 pmol of the digested vector fragment; sterile water to a final volume of 10 μL; and gentle mixing. The mixture was incubated at 50°C for 15 min and then stored on ice.
[0038] (4) Transformation Transformation of *E. coli* was performed as follows: 30 μL of DH5α competent cells; 5 μL of the ligation product of the target gene and vector; gently mix, incubate on ice for 15 min, heat shock in a metal bath at 42°C for 45 s, incubate on ice for 3 min, add 200 μL of antibiotic-free LB liquid medium, and incubate at 37°C with a shaker at 200 rpm for 0.5 h. Then, evenly spread the mixture onto plates containing 50 mg / L Kana LB solid medium and incubate overnight in an inverted incubator at 37°C. Colony PCR was used to screen bacteria and sequence the colonies, and plasmids were extracted for transformation of *Agrobacterium*.
[0039] The plasmid extraction method is as follows: Centrifuge at 13,000×g for 1 min and collect 1-5 mL of bacterial cells. Discard the culture medium and gently tap on absorbent paper to remove any remaining liquid; add 250 μL of Buffer P1 / RNase A mixture and vortex at high speed to resuspend the bacteria; ensure that RNase A has been added to Buffer P1 before use; thorough resuspending of bacteria is crucial for yield, and no bacterial clumps should be visible after resuspending; add 250 μL of Buffer P2 to the resuspended solution and invert 8-10 times to mix; add 350 μL of Buffer NP3 and immediately invert 8-10 times to completely neutralize the solution; centrifuge at 13,000×g for 2 min; place HiPure DNA Mini Column IV in the collection tube, transfer the supernatant to the column, and centrifuge at 13,000×g for 30-60 seconds; discard the filtrate, put the column back into the collection tube, and add 500 μL of Buffer PW1 to the column. Centrifuge at 13,000×g for 30–60 seconds; discard the filtrate and reattach the column to the collection tube. Add 600 μL of Buffer PW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 13,000×g for 30–60 seconds; discard the filtrate and reattach the column to the collection tube. Add 300 μL of Buffer PW2 (diluted with anhydrous ethanol) to the column; centrifuge at 13,000×g for 3 min; discard the filtrate and reattach the column to the collection tube. Centrifuge at 13,000g for 3 min to dry the column. Place the column in a sterile 1.5 mL centrifuge tube and add 50 μL of Elution Buffer to the center of the membrane. Incubate for 1 min, then centrifuge at 13,000×g for 1 min to elute the DNA. Discard the column and store the plasmid at -20°C.
[0040] Get as Figure 1 The LcbZIP53-pEarlyGate201 overexpression vector shown yielded the following results: Figure 2 The LcbZIP53-pTRV2 silencing vector shown.
[0041] Example 2: Agrobacterium-mediated transformation 1) Take 2 μL of the constructed vector from Example 1 and add it to 30 μL of GV3101 competent cells. Mix well and let stand on ice for 5 min. 2) Quick-freeze in liquid nitrogen for 5 minutes; 3) 37℃ for 5 minutes; 4) Let it rest on the ice for 5 minutes; 5) Add 1 ml of antibiotic-free YEP liquid medium and incubate at 28°C in a shaker for 1 h; 6) Centrifuge at 8000 rpm for 1 min at 28℃, spread onto K / Rif LB medium plates, and incubate statically at 28℃ for 2 days; 7) Select single-clone colonies for screening, then shake and preserve the bacteria; Agrobacterium was obtained carrying the vectors LcbZIP53-pEarlyGate201 and LcbZIP53-pTRV2 from Example 1.
[0042] Example 3: Preparation of Infection Solution 1) Take the Agrobacterium tumefaciens culture prepared in Example 2 into 10 mL of YEP medium (with kanamycin and rifampin added), and incubate overnight at 28°C in a shaker. 2) Take 2 mL of the overnight culture and add it to 60 mL of freshly prepared sterile YEP medium (with kanamycin and rifampin). Add acetylsuccine to enhance bacterial activity and culture until the OD 600 is between 0.8 and 1.0. 3) Centrifuge at 28℃, 5000 rpm, 5 min, collect the bacterial cells, wash once with sterile water, and collect the bacterial cells again. 4) Add sterile water to OD600 = 0.8, add sucrose (final concentration 5%), and 0.05% silweet L-77; An infection solution of Agrobacterium with vectors LcbZIP53-pEarlyGate201 and LcbZIP53-pTRV2 from Example 2 was obtained.
[0043] Example 4: Infection of Arabidopsis thaliana plant material Functional validation of LcbZIP53 gene overexpression in Arabidopsis thaliana 1) Water thoroughly the night before infection to promote the opening of Arabidopsis thaliana stomata. If it is the first time infecting Arabidopsis thaliana, remove the pods and open flowers to improve infection efficiency; if it is Arabidopsis thaliana that has been infected before, there is no need to remove the pods and open flowers.
[0044] 2) Immerse the unopened inflorescences of Arabidopsis thaliana in the Agrobacterium tumefaciens infection solution containing LcbZIP53-pEarlyGate201 prepared in Example 3 for 30 seconds, gently shaking the inflorescences to ensure full contact with the infection solution. After immersion, remove the inflorescences and gently squeeze them to promote infection. After absorbing excess infection solution with filter paper, place the inflorescences flat in a humidifier, cover with plastic wrap to maintain humidity, keep away from light, and let stand overnight.
[0045] 3) The next day, the infected Arabidopsis thaliana was removed and placed under normal culture conditions (22℃, 16 hours light / 8 hours dark cycle) for culture.
[0046] 4) On the seventh day after the first infection, a second infection is carried out to finally obtain transgenic Arabidopsis thaliana, namely OE-1 and OE-2.
[0047] Specifically, the size of transgenic Arabidopsis seeds was observed and measured, and the results were as follows: Figure 3 As shown. Figure 3 A is the seed of wild-type Arabidopsis thaliana. Figure 3 BC are transgenic Arabidopsis seeds. Phenotypically, the transgenic seeds are larger than wild-type Arabidopsis seeds.
[0048] Figure 3 Figures DF and EF show scanning electron microscope images of epidermal cells from a single Arabidopsis seed. Figure D shows a wild-type Arabidopsis seed, while Figures EF show transgenic Arabidopsis seeds. Figure 3 df is to put Figure 3 The area highlighted in white in DF is magnified by the same magnification of the seed epidermal cells. It can be seen that the transgenic seeds are larger than wild-type Arabidopsis seeds because their cell volume is increased, indicating that the LcbZIP53 gene affects seed development by regulating cell size.
[0049] Figure 3 GJ compared the seed length and width, as well as the seed epidermal cell length and width, of wild-type Arabidopsis thaliana (WT) and transgenic Arabidopsis thaliana. The results showed that, compared with wild-type Arabidopsis thaliana, transgenic Arabidopsis thaliana overexpressing LcbZIP53 had significantly longer and wider seeds, and the length and width of seed cells were also significantly larger, proving that overexpression of the LcbZIP53 gene has the function of promoting seed enlargement.
[0050] Example 5: Lychee VIGS-mediated gene silencing Validation of the silencing function of the LcbZIP53 gene in litchi 1) Mix the Agrobacterium tumefaciens solution of blank vector control pTRV2-Empty and the helper vector pTRV1 at a volume ratio of 1:1; Agrobacterium tumefaciens containing the gene silencing vector pTRV2-LcbZIP53 and the helper vector pTRV1 were mixed at a volume ratio of 1:1.
[0051] 2) Select three large-kernel lychee varieties (wild lychee) with similar growth, and inject the fruits 21 days after flowering with pTRV2-Empty and pTRV2-LcbZIP53 bacterial solutions respectively. For each combination, inject more than 30 fruits on each tree.
[0052] 3) Six weeks after treatment, the correlation between fruit and seed size traits was measured and statistically analyzed.
[0053] Specifically, the size and weight of litchi seeds in the treatment group (pTRV2-LcbZIP53) and the control group (pTRV2-Empty) were statistically analyzed and compared. The results are as follows: Figure 4 As shown.
[0054] Figure 4 A represents the control group pTRV2-Empty. Figure 4 B represents the treatment group pTRV2-LcbZIP53. Compared with the control group injected with the empty vector, the seeds of litchi fruits injected with pTRV2-LcbZIP53 were significantly smaller.
[0055] Figure 4 CD compares the seed weight and size of the LcbZIP53 gene in the control group and the silenced litchi. It shows that compared with the control, the seed weight of the silenced litchi was significantly reduced and the seeds were smaller, proving that silencing the LcbZIP53 gene can effectively reduce litchi seed size.
[0056] This invention, through cross-species functional verification, fully demonstrates the universality and conservation of the LcbZIP53 gene function. Overexpression of LcbZIP53 in the model plant Arabidopsis thaliana resulted in significantly larger seeds, indicating that the protein encoded by this gene is a key factor in the positive regulation of seed size that is functionally conserved in the plant kingdom. This gene can utilize and integrate conserved seed development regulatory networks across different plant species to exert its biological function. Therefore, those skilled in the art can reasonably predict that overexpression of the LcbZIP53 gene in litchi can also promote seed size and thus increase fruit edibility by activating its endogenous conserved pathways. This prediction has been corroborated from the opposite perspective by the litchi VIGS silencing experiment (loss of function) of this invention.
[0057] The nucleotide sequence of LcbZIP53 mentioned above is shown in SEQ ID NO.1, which is as follows: ATGTCATCAATTCAGAAACAGACCAGTTCTGGCTCGGACAGCGACCCGCGATACGCTAATGTGGACGAGAGGAAGAGGAAGAGAATGATATCGAATCGCGAATCGGCCAGGCGGTCTAGGATGAGGAAGCAGATGGAGGATCTGGTTAATGAGATCAGTCAATTGGAGAGCGCTAATACTATGCTCAGGCAAAACATCGATGCCGCGAAGCAA CGCTACATCGAGATGGAATCTGCCAACAATGTTCTCAGGGCCCAAGCTATGGAGCTGACCGATCGTCTAAGGTCCCTGAACTCTGTCCTGCAGATCTGGGGCGAAGTAAGCGGCCTCAGCGTGGAGATTCCTGAAATTCCTGATCCTCTGATGAAGCCTTGGCAGCTTCCTTGTCCTGTGCAGCCAATCATGGCGTCTGCTGACTTGCTCCAGTTTTAG The sequence of the protein encoded by LcbZIP53 is shown in SEQ ID NO.2, which is as follows: MSSIQKQTSSGDSDPRYANVDERKRKRMISNRESARRSRMRKQKQMEDLVNEISQLESANTMLRQNIDAAKQRYIEMESANNVLRAQAMELTDRLRSLNSVLQIWGEVSGLSVEIPEIPDPLMKPWQLPCPVQPIMASADLLQF The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. The application of the LcbZIP53 gene in regulating litchi seed size, characterized by, The nucleotide sequence of the LcbZIP53 gene is shown in SEQ ID NO.1, and the protein sequence encoded by the LcbZIP53 gene is shown in SEQ ID NO.
2.
2. The application of the recombinant vector containing the LcbZIP53 gene as described in claim 1 in regulating litchi seed size.
3. The application according to claim 2, characterized in that, The recombinant vector is LcbZIP53-pEarlyGate201 or LcbZIP53-pTRV2.
4. The application as described in any one of claims 1-3, characterized in that, Overexpression of the LcbZIP53 gene results in larger litchi seeds; inhibition of the LcbZIP53 gene results in smaller litchi seeds.
5. A method for increasing the size of litchi seeds, characterized in that, include: Overexpression of the LcbZIP53 gene was used to enlarge the litchi seeds. The nucleotide sequence of the LcbZIP53 gene is shown in SEQ ID No.
1.
6. The method according to claim 5, characterized in that, The overexpression of the LcbZIP53 gene involves overexpressing LcbZIP53 in Arabidopsis thaliana to achieve seed enlargement.
7. A method for reducing the size of lychee seeds, characterized in that, include: The expression of the LcbZIP53 gene or the activity of its encoded protein is inhibited to reduce the size of the litchi seeds. The nucleotide sequence of the LcbZIP53 gene is shown in SEQ ID No. 1, and the protein sequence encoded by the LcbZIP53 gene is shown in SEQ ID No.
2.
8. The method according to claim 7, characterized in that, The inhibition of LcbZIP53 gene expression involves silencing the LcbZIP53 gene in litchi, resulting in smaller litchi seeds.
9. The application of the LcbZIP53 gene or its encoded protein in the edible rate of litchi fruit, characterized in that, The LcbZIP53 gene is used to improve the size trait of litchi seeds. The nucleotide sequence of the LcbZIP53 gene is shown in SEQ ID NO.1, and the protein sequence encoded by the LcbZIP53 gene is shown in SEQ ID NO.
2.
10. The application according to claim 9, characterized in that, Transforming litchi plants with an overexpression vector containing the LcbZIP53 gene yields transgenic litchi with larger seeds, while introducing a silencing vector containing the LcbZIP53 gene into litchi plants yields litchi with smaller seeds.