Pepper transgenic hairy root induction method
By optimizing the method for inducing hairy roots in peppers, using cotyledon explants and Agrobacterium rhizogenes strain K599, combined with the RUBY gene vector and specific culture conditions, the problems of low hairy root induction efficiency and poor stability were solved, achieving efficient and stable hairy root induction, which is suitable for pepper gene function research and molecular breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-03-13
AI Technical Summary
Existing chili hairy root induction systems suffer from low induction efficiency, poor stability, high false positive rate, poor reproducibility, and limited applicability, making it difficult to meet the needs of chili gene function research and molecular breeding.
Using seed disinfection, cotyledons as explants, Agrobacterium rhizogenes strain K599, and the RUBY gene vector, combined with specific culture media and conditions, including infection concentration and photoperiod, the hairy root induction process was optimized. Identification was simplified by the visualization characteristics of the RUBY gene, and exogenous hormone NAA was added to regulate hairy root morphology.
It improved the transformation efficiency of hairy roots to 49.12%, shortened the induction period to 2-4 weeks, reduced the false positive rate, enhanced the reliability and applicability of the system, and adapted to the needs of different application scenarios.
Smart Images

Figure CN121653166A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a method for inducing hairy roots in transgenic peppers. Background Technology
[0002] chili( Capsicum annuum L. As an annual or perennial herbaceous plant belonging to the genus Capsicum in the Solanaceae family, it is an important vegetable and economic crop widely cultivated globally. Its fruit is rich in vitamin C, capsaicin, carotenoids, and other bioactive substances, possessing edible, medicinal, and industrial value, and occupies an important position in food processing, pharmaceuticals, and the agricultural economy. Furthermore, as a typical dicotyledonous model plant, the chili pepper also has irreplaceable application value in fields such as plant stress resistance mechanism research, secondary metabolism regulation analysis, and fruit development biology exploration.
[0003] Currently, chili pepper variety improvement mainly relies on traditional hybridization breeding and mutation breeding techniques. However, these methods generally suffer from limitations such as long breeding cycles, large workloads, and high difficulty in targeted trait improvement, making it difficult to meet the high-efficiency requirements of modern chili pepper genetic improvement. With the development of molecular biology techniques, gene function analysis, genetic trait regulation, and precision breeding have become important directions for chili pepper genetic improvement. However, the effective implementation of these technologies depends on a stable and efficient genetic transformation system.
[0004] Agrobacterium rhizogenes ( Agrobacterium rhizogenes Hairy root induction systems mediated by dermal hairs have become a key tool for plant gene function research, secondary metabolite synthesis, and rapid validation of gene-editing elements due to their advantages of simple operation, short transformation cycle, and high transformation efficiency. Especially for crops like peppers, which are difficult to regenerate and have imperfect genetic transformation systems, hairy root transformation technology is widely used in metabolite production, root development research, and analysis of root-to-biotic / abiotic interactions.
[0005] However, existing chili hairy root induction systems still face many challenges: First, the lack of specificity in explant selection easily leads to low induction efficiency; second, significant differences in affinity between Agrobacterium strains and chili genotypes affect transformation stability; third, frequent problems such as Agrobacterium contamination, rhizoid mixing, and high false positive rates occur during induction; fourth, current technologies mostly use cotyledons and hypocotyls as explants, but these generally suffer from excessively long induction cycles (over 40 days) and unstable transformation efficiency (below 20%). Furthermore, a stable hairy root transformation and precise identification system integrating exogenous genes has not yet been established in the chili field. These problems severely limit the large-scale application of hairy root technology in chili gene function research and molecular breeding.
[0006] Therefore, developing an efficient, stable, and reproducible method for inducing hairy roots in transgenic chili peppers is of great theoretical significance and practical application value for overcoming existing technological bottlenecks, accelerating the analysis of chili pepper gene functions, promoting metabolic pathway research, and shortening the molecular breeding process. Summary of the Invention
[0007] The technical problem to be solved by the present invention is to provide an efficient, stable and reproducible method for inducing hairy roots in transgenic peppers.
[0008] The present invention solves the above-mentioned technical problems by adopting the following technical solutions: A method for inducing hairy roots in genetically modified chili peppers includes the following steps: (1) Seed disinfection: After soaking, treating with ethanol, disinfecting with sodium hypochlorite and washing with sterile water, plump and undamaged chili seeds are dried and ready for use. (2) Seed germination: After sterilization, the seeds are inoculated into the germination medium and cultured in the dark until they show white, then cultured in the light until the cotyledons are fully expanded; (3) Explant acquisition and pre-culture: Take the cotyledons of pepper seedlings with fully expanded cotyledons, cut them into segments, and inoculate them into the pre-culture medium for pre-culture; (4) Culture of Agrobacterium rhizogenes: The vector containing the exogenous gene was transformed into competent Agrobacterium rhizogenes K599 cells. After identification as correct, the cells were cultured in a shaking culture until a certain concentration was reached, and then the concentration was adjusted to OD using an inoculum. 600 =0.2~0.5; (5) Infection and co-culture of explants: The pre-cultured explants were placed in the Agrobacterium infection solution of step (4) for infection; after infection, the bacterial solution was dried and transferred to the co-culture medium for co-culture in the dark. (6) Hairy root induction: The explants after co-culture were transferred to the induction medium and cultured under photoperiod to obtain the hairy roots of the chili transgenic plant.
[0009] As one of the preferred methods of the present invention, the specific operation of seed disinfection in step (1) includes: first soaking in pure water for 2 hours, then soaking in 75% ethanol for 1-3 minutes in a clean bench, then disinfecting with sodium hypochlorite with an effective chlorine concentration of 2.5% for 20 minutes, and finally rinsing with sterile water 5-6 times for 2 minutes each time, and absorbing the moisture with sterile filter paper.
[0010] As one of the preferred embodiments of the present invention, in step (2), the germination medium is: 1 / 2MS medium + 30g / L sucrose + 8g / L agar, pH=5.8; the seed germination culture conditions are: cultured in the dark at 28℃ until the seeds show white, and then cultured under light (16h light / 8h dark).
[0011] As one of the preferred embodiments of the present invention, in step (3), the length of the cotyledon fragment is 0.5 cm, and the leaf face is downward when inoculated; the pre-culture medium is: MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8; the pre-culture conditions are: culture at 28℃ for 24~48 h.
[0012] As one of the preferred embodiments of the present invention, in step (4), the exogenous gene is the RUBY gene, and the vector containing the exogenous gene is the 35S:RUBY vector (commercially available vector, brand: Solarbio, product code: VT020454, product specification: VT020454-1EA).
[0013] As one of the preferred embodiments of the present invention, in step (4), the composition of the infection solution is: MS medium + 30 g / L sucrose + 200 mg / L AS, pH=5.8; the culture conditions for Agrobacterium are 28°C and 200 rpm; when the Agrobacterium is cultured to OD 600 =1, after centrifugation at 4000 rpm to collect the precipitate, the concentration was adjusted to OD using the aforementioned inoculum. 600 =0.2~0.5.
[0014] As one of the preferred embodiments of the present invention, after the Agrobacterium is cultured by shaking and the precipitate is collected by centrifugation, the concentration of the precipitate is adjusted to OD using the infection solution. 600 =0.3.
[0015] As one of the preferred embodiments of the present invention, in step (5), the infection conditions are: 25℃, 100rpm low-speed infection for 15~20min; the co-culture medium is: MS medium + 30g / L sucrose + 200mg / L AS (acetylsyleugenol) + 8g / L agar, pH=5.8; the co-culture conditions are: 25℃ dark culture for 2~3d; the leaf face is facing up when transferring the inoculation.
[0016] As one of the preferred embodiments of the present invention, in step (6), the induction medium is: MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar, pH=5.8; the photocycle culture conditions are: 28℃, 16h light / 8h dark, the induction medium is changed every 2 weeks, and the chili transgenic hairy roots are obtained after 2 to 4 weeks of culture.
[0017] As one of the preferred embodiments of the present invention, in step (6), after obtaining the chili transgenic hairy roots, the following steps are also included: The obtained chili transgenic hairy roots were transferred to an induction medium containing 0.1 mg / L NAA and cultured for another 2 weeks to obtain a highly branched lateral root system; or transferred to an induction medium without NAA and cultured for another 2 weeks to obtain a taproot-extending hairy root.
[0018] The advantages of this invention compared to the prior art are: (1) High conversion efficiency and good stability This invention uses pepper cotyledons as the optimal explant through experimental screening, combined with Agrobacterium rhizogenes strain K599, and determines the optimal bacterial concentration (OD). 600 =0.3 is optimal), and the final transgenic hairy root transformation efficiency reached 49.12%, which is more than twice the level of existing technologies. At the same time, the induction period was shortened to 2-4 weeks, overcoming the problems of long induction period (more than 40 days) and large efficiency fluctuations of traditional methods, making it suitable for large-scale application.
[0019] (2) The identification is simple, non-destructive, and highly reliable. This invention utilizes the visualization characteristics of the RUBY gene to quickly and intuitively screen transgenic positive hairy roots without the need for complex DNA extraction and PCR detection. This avoids damage to hairy roots caused by traditional identification methods and significantly reduces the false positive rate. In addition, the antibacterial effect of Timentin and the screening function of Hygromycin B in the induction medium form a double guarantee, further improving the reliability of the entire system.
[0020] (3) The technical process is standardized and highly repeatable. This invention clarifies the key details of the entire process, including seed disinfection, culture medium formulation, infection conditions (25℃, 100rpm), and co-culture parameters. Different laboratories can easily reproduce the experimental results by following the process, thus solving the problems of vague conditions and poor repeatability in existing technologies.
[0021] (4) The morphology of the hairy roots can be adjusted as needed, making them more adaptable. This invention allows for the flexible cultivation of two different morphologies of hairy roots by varying the addition of the exogenous hormone NAA. Without NAA, a primary root-elongating hairy root is obtained, which is beneficial for biomass accumulation. Adding 0.1 mg / L NAA results in a highly branched lateral root system, which is more suitable for the synthesis of specific secondary metabolites. These two morphologies can meet the needs of different application scenarios such as gene function research and large-scale production of metabolites, significantly improving the adaptability and practical value of the technology.
[0022] (5) Wide range of applications and strong practicality This invention uses the RUBY visualized gene as an example to establish a standardized process for inducing hairy roots in transgenic chili peppers. In practical applications, it can be replaced with any target exogenous gene according to gene function research, specific metabolite synthesis, or breeding needs, while the system can still operate stably and efficiently. This not only overcomes the limitation of existing technologies in applicable scenarios but also provides an efficient tool for chili pepper gene function analysis and metabolic pathway research. At the same time, it provides theoretical support for the application of various exogenous genes in the future, accelerates the process of molecular breeding of chili peppers, and has both important academic significance and industrial application potential. Attached Figure Description
[0023] Figure 1 The figures show the growth status of chili hairy roots induced by different explants in Experiment Example 1 (Figure A shows hairy roots induced by cotyledons as explants, and Figure B shows hairy roots induced by hypocotyls as explants; it can be seen that the hairy roots of cotyledon explants have better growth status and a higher proportion of positive roots).
[0024] Figure 2 This is a diagram showing the growth status of chili hairy roots induced by different Agrobacterium tumefaciens concentrations in Experiment Example 2 (Figure A shows the OD). 600 =0.2 concentration group, Figure B is OD 600 =0.3 concentration group, C figure is OD 600 =0.5 concentration group; visible OD 600 The 0.3% concentration group showed the highest hairy root induction and the most robust growth. Figure 3 This is a comparison of the morphology of hairy roots of transgenic pepper regulated by the exogenous hormone NAA in Experiment Example 3 (Figure A shows the initial state of hairy roots before culture in "medium without NAA"; Figure C shows the primary root elongation type hairy roots after culture in "medium without NAA": the primary root is significantly elongated and there are few lateral roots; Figure B shows the initial state of hairy roots before culture in "medium containing 0.1 mg / L NAA"; Figure D shows the highly branched lateral root type hairy roots after culture in "medium containing 0.1 mg / L NAA": there are many lateral roots and dense branches; it intuitively demonstrates the directional regulatory effect of NAA on hairy root morphology). Detailed Implementation
[0025] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments. Furthermore, the culture media and reagents used in the following embodiments and experimental examples, unless otherwise specified, are all conventional culture media and reagents in the art; the experimental conditions and methods used, unless otherwise specified, are all conventional conditions and methods in the art and will not be described again.
[0026] Example 1 This embodiment of a method for inducing hairy roots in transgenic chili peppers includes the following steps: (1) Seed disinfection Soak plump, undamaged chili seeds in pure water for 2 hours. Then, disinfect them in a clean bench by soaking them in 75% ethanol for 2 minutes and then discarding the ethanol. Add sodium hypochlorite with an effective chlorine concentration of 2.5% for 20 minutes and then discard the sodium hypochlorite. Rinse the seeds with sterile water 5 times for 2 minutes each time. Finally, place the seeds on sterile filter paper to absorb the moisture.
[0027] (2) Seed germination After sterilization and drying, the seeds were evenly inoculated onto germination medium (1 / 2 MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8) and cultured in the dark at 28°C until the cotyledons showed signs of sprouting. Then, the seeds were transferred to light (16 h light / 8 h dark) and cultured until the cotyledons were fully expanded.
[0028] (3) Explant acquisition and pre-culture Once the two cotyledons of the chili pepper have fully expanded, place the chili pepper seedlings in a sterile petri dish and cut the cotyledons into 0.5 cm long segments with a sterile blade. Inoculate the segments with the leaf faces down onto the pre-culture medium (MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8) and pre-culture at 28℃ for 36 h.
[0029] (4) Culture of Agrobacterium rhizogenes The 35S:RUBY vector containing the exogenous gene RUBY (brand: Solarbio, product code: VT020454, product specification: VT020454-1EA) was transformed into Agrobacterium rhizogenes K599 competent cells, and single colonies were identified by colony PCR.
[0030] The identification primers for the colony PCR were RUBY-F and RUBY-R, with the following sequences: 35sRUBY-F: GACACGCTGAAAACTAGTATGGATCATG; 35sRUBY-R: CTTCATATTCACTATCACTGGAGGCTTG.
[0031] The reaction system for colony PCR was as follows: 10 μL Mix enzyme, 7 μL ddH2O, 1 μL colony template, 1 μL upstream primer 35s RUBY-F, and 1 μL downstream primer 35s RUBY-R. The reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 2 min, for a total of 30 cycles; 72℃ final extension for 10 min; and incubation at 20℃. The identification criterion was the amplification of a specific band of the RUBY gene, which was considered a correct identification.
[0032] After successful identification, single colonies were selected and cultured at 28°C and 200 rpm until OD200. 600 =1; then the bacterial precipitate was collected by centrifugation at 4000 rpm, and the bacterial concentration was adjusted to OD using infection medium (MS medium + 30 g / L sucrose + 200 mg / L AS, pH=5.8). 600 =0.3, reserved.
[0033] (5) Infection and co-culture of explants The pre-cultured cotyledon fragments were transferred to the Agrobacterium infection solution prepared above and inoculated at a low speed of 100 rpm for 18 min at 25℃. After infection, the explants were placed on sterile filter paper to absorb the bacterial solution and transferred to co-culture medium (MS medium + 30 g / L sucrose + 200 mg / L AS + 8 g / L agar, pH=5.8). The leaf surface was facing up when transferring the inoculation, and the plants were cultured at 25℃ in the dark for 2.5 days.
[0034] (6) Hairy root induction After co-culture, the explants were transferred to induction medium (MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar, pH=5.8) and cultured at 28℃ under 16 h light / 8 h dark conditions. The induction medium was changed every 2 weeks, and the chili transgenic hairy roots were obtained after 3 weeks of culture.
[0035] Example 2 This embodiment of a method for inducing hairy roots in transgenic chili peppers includes the following steps: (1) Seed disinfection Soak plump, undamaged chili seeds in pure water for 2 hours. Then, disinfect them in a clean bench by soaking them in 75% ethanol for 1 minute and then discarding the ethanol. Add sodium hypochlorite with an effective chlorine concentration of 2.5% for 20 minutes and then discard the sodium hypochlorite. Rinse the seeds with sterile water 5 times for 2 minutes each time. Finally, place the seeds on sterile filter paper to absorb the moisture.
[0036] (2) Seed germination After sterilization and drying, the seeds were evenly inoculated onto germination medium (1 / 2 MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8) and cultured in the dark at 28°C until the cotyledons showed signs of sprouting. Then, the seeds were transferred to light (16 h light / 8 h dark) and cultured until the cotyledons were fully expanded.
[0037] (3) Explant acquisition and pre-culture Once the two cotyledons of the chili pepper have fully expanded, place the chili pepper seedlings in a sterile petri dish and cut the cotyledons into 0.5 cm long segments with a sterile blade. Inoculate the segments with the leaf faces down onto the pre-culture medium (MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8) and pre-culture at 28℃ for 24 h.
[0038] (4) Culture of Agrobacterium rhizogenes The 35S:RUBY vector containing the exogenous gene RUBY (brand: Solarbio, product code: VT020454, product specification: VT020454-1EA) was transformed into Agrobacterium rhizogenes K599 competent cells, and single colonies were identified by colony PCR.
[0039] The identification primers for the colony PCR were RUBY-F and RUBY-R, with the following sequences: 35sRUBY-F: GACACGCTGAAAACTAGTATGGATCATG; 35sRUBY-R: CTTCATATTCACTATCACTGGAGGCTTG.
[0040] The reaction system for colony PCR was as follows: 10 μL Mix enzyme, 7 μL ddH2O, 1 μL colony template, 1 μL upstream primer 35s RUBY-F, and 1 μL downstream primer 35s RUBY-R. The reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 2 min, for a total of 30 cycles; 72℃ final extension for 10 min; and incubation at 20℃. The identification criterion was the amplification of a specific band of the RUBY gene, which was considered a correct identification.
[0041] After successful identification, single colonies were selected and cultured at 28°C and 200 rpm until OD200. 600 =1; then the bacterial precipitate was collected by centrifugation at 4000 rpm, and the bacterial concentration was adjusted to OD using infection medium (MS medium + 30 g / L sucrose + 200 mg / L AS, pH=5.8). 600 =0.2, reserved.
[0042] (5) Infection and co-culture of explants The pre-cultured cotyledon fragments were transferred to the Agrobacterium infection solution prepared above and inoculated at a low speed of 100 rpm for 15 min at 25℃. After infection, the explants were placed on sterile filter paper to absorb the bacterial solution and transferred to co-culture medium (MS medium + 30 g / L sucrose + 200 mg / L AS + 8 g / L agar, pH=5.8). The leaf surface was facing up when transferring the inoculation, and the plants were cultured at 25℃ in the dark for 2 days.
[0043] (6) Hairy root induction After co-culture, the explants were transferred to induction medium (MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar, pH=5.8) and cultured at 28℃ under 16 h light / 8 h dark conditions. The induction medium was changed every 2 weeks. After 2 weeks of culture, the hairy roots of the chili pepper were obtained.
[0044] Example 3 This embodiment of a method for inducing hairy roots in transgenic chili peppers includes the following steps: (1) Seed disinfection Soak plump, undamaged chili seeds in pure water for 2 hours. Then, disinfect them in a clean bench by soaking them in 75% ethanol for 3 minutes, then discarding the ethanol. Add sodium hypochlorite with an effective chlorine concentration of 2.5% for 20 minutes, discard the sodium hypochlorite, and rinse them with sterile water 6 times for 2 minutes each time. Finally, place the seeds on sterile filter paper to absorb the moisture.
[0045] (2) Seed germination After sterilization and drying, the seeds were evenly inoculated onto germination medium (1 / 2 MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8) and cultured in the dark at 28°C until the cotyledons showed signs of sprouting. Then, the seeds were transferred to light (16 h light / 8 h dark) and cultured until the cotyledons were fully expanded.
[0046] (3) Explant acquisition and pre-culture Once the two cotyledons of the chili pepper have fully expanded, place the chili pepper seedlings in a sterile petri dish and cut the cotyledons into 0.5 cm long segments with a sterile blade. Inoculate the segments with the leaf faces down onto the pre-culture medium (MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8) and pre-culture at 28℃ for 48 h.
[0047] (4) Culture of Agrobacterium rhizogenes The 35S:RUBY vector containing the exogenous gene RUBY (brand: Solarbio, product code: VT020454, product specification: VT020454-1EA) was transformed into Agrobacterium rhizogenes K599 competent cells, and single colonies were identified by colony PCR.
[0048] The identification primers for the colony PCR were RUBY-F and RUBY-R, with the following sequences: 35sRUBY-F: GACACGCTGAAAACTAGTATGGATCATG; 35sRUBY-R: CTTCATATTCACTATCACTGGAGGCTTG.
[0049] The reaction system for colony PCR was as follows: 10 μL Mix enzyme, 7 μL ddH2O, 1 μL colony template, 1 μL upstream primer 35s RUBY-F, and 1 μL downstream primer 35s RUBY-R. The reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 2 min, for a total of 30 cycles; 72℃ final extension for 10 min; and incubation at 20℃. The identification criterion was the amplification of a specific band of the RUBY gene, which was considered a correct identification.
[0050] After successful identification, single colonies were selected and cultured at 28°C and 200 rpm until OD200. 600 =1; then the bacterial precipitate was collected by centrifugation at 4000 rpm, and the bacterial concentration was adjusted to OD using infection medium (MS medium + 30 g / L sucrose + 200 mg / L AS, pH=5.8). 600 =0.5, reserved.
[0051] (5) Infection and co-culture of explants The pre-cultured cotyledon fragments were transferred to the Agrobacterium infection solution prepared above and inoculated at a low speed of 25℃ and 100 rpm for 20 min. After infection, the explants were placed on sterile filter paper to absorb the bacterial solution and transferred to co-culture medium (MS medium + 30 g / L sucrose + 200 mg / L AS + 8 g / L agar, pH=5.8). The leaf surface was facing up when transferring the inoculation and cultured at 25℃ in the dark for 3 days.
[0052] (6) Hairy root induction After co-culture, the explants were transferred to induction medium (MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar, pH=5.8) and cultured at 28℃ under 16 h light / 8 h dark conditions. The induction medium was changed every 2 weeks, and the chili transgenic hairy roots were obtained after 4 weeks of culture.
[0053] Example 4 The method for inducing hairy roots in transgenic chili peppers in this embodiment is basically the same as that in Example 1, except that it also includes the following hairy root morphology regulation steps: The obtained chili transgenic hairy roots were cut off and transferred to an induction medium containing 0.1 mg / L NAA (MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar + 0.1 mg / L NAA, pH=5.8) and cultured for 2 weeks to obtain a highly branched lateral root system.
[0054] Example 5 The method for inducing hairy roots in transgenic chili peppers in this embodiment is basically the same as that in Example 1, except that it also includes the following hairy root morphology regulation steps: The obtained chili transgenic hairy roots were cut off and transferred to an induction medium without NAA (MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar, pH=5.8) and cultured for another 2 weeks to obtain primary root extension type hairy roots.
[0055] Experimental Example 1 This experiment tested the effects of different explants on the induction of hairy roots in pepper plants, verifying the superiority of cotyledons as explants.
[0056] I. Experimental Methods 1. Seed disinfection and germination Follow the same steps (1) to (2) as in Example 1, and cultivate until the cotyledons are fully expanded.
[0057] 2. Explant treatment Set up two groups.
[0058] Experimental group: cotyledons were taken, cut into 0.5cm segments, and pre-cultured at 28℃ for 36h; Control group: Hypocotyls of seedlings from the same batch were cut into 0.5cm segments and pre-cultured at 28℃ for 36h (other conditions were the same as the experimental group).
[0059] 3. Agrobacterium culture The 35S:RUBY vector containing the exogenous gene RUBY was transformed into Agrobacterium rhizogenes K599 competent cells, and single colonies were identified by colony PCR (same as Example 1).
[0060] After successful identification, single colonies were selected and cultured at 28°C and 200 rpm until OD200. 600 =1; then the bacterial precipitate was collected by centrifugation at 4000 rpm, and the bacterial concentration was adjusted to OD using infection medium (MS medium + 30 g / L sucrose + 200 mg / L AS, pH=5.8). 600 =0.5, reserved.
[0061] 4. Infection and co-culture of explants The pre-cultured cotyledon / hypocotyl fragments were transferred to the Agrobacterium infection solution prepared above and infected at a low speed of 100 rpm for 18 min at 25℃. After infection, the explants were placed on sterile filter paper to absorb the bacterial solution and transferred to co-culture medium (MS medium + 30 g / L sucrose + 200 mg / L AS + 8 g / L agar, pH=5.8). The leaf surface was facing up when transferring the inoculation, and the plants were cultured in the dark at 25℃ for 2.5 days.
[0062] 5. Hairy root induction Same as step (6) in Example 1. After 3 weeks of culture, the hairy root induction rate (number of explants producing hairy roots / number of explants × 100%), positive rate (number of hairy roots with positive RUBY gene visualization / number of hairy roots × 100%) and transformation efficiency (number of positive hairy roots / number of explants × 100%) of the two groups were counted.
[0063] II. Experimental Results The results are as follows Figure 1 As shown in Table 1.
[0064] Table 1. Effects of different explants on hairy root induction rate
[0065] Note: The number of explants in the two groups in the table is the actual number prepared and used for testing in the experiment. It was not deliberately standardized. Other conditions were strictly consistent during the experiment. The data truly reflect the differences in the induction effects of different explants.
[0066] The results show that cotyledons are significantly superior to hypocotyls in inducing positive hairy roots. Although the hairy root induction rates of both are similar (cotyledons 45.3%, hypocotyls 45.6%), the positive hairy root rate of cotyledons (62.3%) is 1.7 times that of hypocotyls (36.1%). This key difference leads to a much higher final transformation efficiency of cotyledons (28.4%) than that of hypocotyls (16.6%). Therefore, using cotyledons as explants is a more efficient choice.
[0067] Experiment Example 2 This experiment tested the effect of different Agrobacterium infection concentrations on the induction of hairy roots in peppers and screened for the optimal bacterial concentration.
[0068] I. Experimental Methods 1. Seed disinfection, germination and explant treatment Same as steps (1) to (3) in Example 1.
[0069] 2. Agrobacterium culture and concentration gradient setting As in step (4) of Example 1, the 35S:RUBY vector containing the RUBY gene was transformed into competent Agrobacterium rhizogenes K599 cells. After confirmation by colony PCR, the cells were cultured to OD. 600 =1, then adjust the concentration gradient group using the infiltration solution to the following different concentration groups: Experimental group 1: OD 600 =0.2; Experimental group 2: OD 600 =0.3; Experimental group 3: OD 600 =0.5.
[0070] 3. Infection, co-culture, and hairy root induction Following the same steps (5) to (6) in Example 1, the pre-cultured cotyledon fragments were placed in bacterial solutions of different concentrations and infected at 25°C and 100 rpm for 18 min. After the bacterial solution was dried, the fragments were co-cultured at 25°C in the dark for 2.5 days. Subsequently, the fragments were transferred to induction medium and cultured at 28°C for 16 h light / 8 h dark for 3 weeks. The hairy root induction rate (number of explants producing hairy roots / number of explants × 100%), positive rate (number of hairy roots with RUBY gene visualization positive / number of hairy roots × 100%) and transformation efficiency (number of positive hairy roots / number of explants × 100%) of each group were calculated.
[0071] II. Experimental Results The results are as follows Figure 2 As shown in Table 2.
[0072] Table 2. Effect of different bacterial concentrations on hairy root induction rate
[0073] Note: The number of explants in each group in the table is the actual number prepared and used for testing in the experiment. It was not deliberately standardized. Other conditions were strictly consistent during the experiment. The data truly reflect the differences in the induction effect of different bacterial concentrations.
[0074] The results above show that OD 600 =0.3 showed significantly better overall efficiency in hairy root induction than OD. 600 =0.5 and OD 600=0.2. Specifically, this is reflected in: OD 600 The hairy root induction rate (66.6%) at 0.3 is much higher than that at OD. 600 =0.5 (37.8%) and OD 600 =0.2 (27.2%); although OD 600 =0.3 and OD 600 =0.5 positive rates are similar, but OD 600 The higher hairy root induction rate of 0.3 resulted in a final transformation efficiency of 49.12%, approximately OD0.3. 600 =1.8 times that of 0.5 (27.02%), OD 600 =3.23 times 0.2 (15.2%). Therefore, OD 600 =0.3 is the optimal culture condition for inducing positive hairy roots.
[0075] Experimental Example 3 This experiment was used to test the effect of exogenous hormones on the growth of hairy roots of pepper, to verify the effectiveness of regulating hairy root morphology through NAA, and to clarify the applicable scenarios for different hairy root morphologies.
[0076] I. Experimental Methods 1. Seed disinfection, germination, explant treatment and hairy root induction Following the same steps (1) to (6) as in Example 1, the basic induction of chili transgenic hairy roots was completed, and positive hairy roots were obtained after 3 weeks of culture.
[0077] 2. Treatment for regulating the morphology of hairy roots Set up two groups.
[0078] Experimental group 1: Positive hairy roots were cut off and transferred to induction medium containing 0.1 mg / L NAA (MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar + 0.1 mg / L NAA, pH=5.8), and cultured at 28℃ for 16 h light / 8 h dark for 2 weeks; Experimental group 2: Positive hairy roots were cut off and transferred to an induction medium without NAA (MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar, pH=5.8) and cultured under the same conditions for 2 weeks.
[0079] 3. Indicator Statistics After cultivation, photos were taken to record the results, and the length of the taproot and the number of lateral roots in both groups were observed.
[0080] II. Experimental Results The results are as follows Figure 3 As shown.
[0081] The results above indicate that hormone-free treatment is beneficial for obtaining a primary root with rapid extension capacity, while NAA treatment can efficiently induce the formation of a highly branched lateral root system. Given that the morphology of hairy roots is closely related to their physiological functions and secondary metabolite synthesis capacity, this finding has clear application implications: the former may be more conducive to biomass accumulation, while the latter, due to its large number of root tips, has greater advantages in specific metabolite production and genetic transformation research.
[0082] In summary, this invention constructs an efficient, stable, and reproducible chili transgenic hairy root induction system: cotyledons are selected as the optimal explants, and the OD (Original Derivative) is determined. 600 =0.3 is the optimal concentration for Agrobacterium infection (transformation efficiency reaches 49.12%); simultaneously, NAA regulation can directionally obtain either taproot-elongated type (facilitating biomass accumulation) or highly branched lateral root type (adapted to metabolite synthesis) hairy roots. This method solves the problems of low induction efficiency and limited application scenarios in existing technologies, establishes a standardized process, and provides a practical tool for pepper gene research, molecular breeding, and metabolite development, possessing both theoretical and applied value.
[0083] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for inducing transgenic hairy roots in chili peppers, characterized in that, Includes the following steps: (1) Seed disinfection: After soaking, treating with ethanol, disinfecting with sodium hypochlorite and washing with sterile water, plump and undamaged chili seeds are dried and ready for use. (2) Seed germination: After sterilization, the seeds are inoculated into the germination medium and cultured in the dark until they show white, then cultured in the light until the cotyledons are fully expanded; (3) Explant acquisition and pre-culture: Take the cotyledons of pepper seedlings with fully expanded cotyledons, cut them into segments, and inoculate them into the pre-culture medium for pre-culture; (4) Culture of Agrobacterium rhizogenes: The vector containing the exogenous gene was transformed into competent Agrobacterium rhizogenes K599 cells. After identification as correct, the cells were cultured in a shaking culture until a certain concentration was reached, and then the concentration was adjusted to OD using an inoculum. 600 =0.2~0.5; (5) Infection and co-culture of explants: The pre-cultured explants were placed in the Agrobacterium infection solution of step (4) for infection; after infection, the bacterial solution was dried and transferred to the co-culture medium for co-culture in the dark. (6) Hairy root induction: The explants after co-culture were transferred to the induction medium and cultured under photoperiod to obtain the hairy roots of the chili transgenic plant.
2. The method for inducing transgenic hairy roots in chili peppers according to claim 1, characterized in that, In step (1), the specific operation of seed disinfection includes: first soaking in pure water for 2 hours, then soaking in 75% ethanol for 1-3 minutes in a clean bench, then disinfecting with sodium hypochlorite with an effective chlorine concentration of 2.5% for 20 minutes, and finally rinsing with sterile water 5-6 times for 2 minutes each time, and absorbing the moisture with sterile filter paper.
3. The method for inducing transgenic hairy roots in chili peppers according to claim 1, characterized in that, In step (2), the germination medium is: 1 / 2 MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8; the germination conditions for seeds are: cultured in the dark at 28℃ until the seeds show white color, and then cultured under light.
4. The method for inducing transgenic hairy roots in chili peppers according to claim 1, characterized in that, In step (3), the length of the cotyledon fragment is 0.5 cm, and the leaf face is down when inoculated; the pre-culture medium is: MS medium + 30 g / L sucrose + 8 g / L agar, pH=5.8; the pre-culture conditions are: 28℃ for 24~48 h.
5. The method for inducing hairy roots in transgenic chili peppers according to claim 1, characterized in that, In step (4), the exogenous gene is the RUBY gene, and the vector containing the exogenous gene is the 35S:RUBY vector.
6. The method for inducing hairy roots in transgenic chili peppers according to claim 1, characterized in that, In step (4), the infection solution consisted of MS medium + 30 g / L sucrose + 200 mg / L AS, pH = 5.8; the Agrobacterium tumefaciens culture conditions were 28°C and 200 rpm; when the Agrobacterium tumefaciens culture reached OD... 600 =1, after centrifugation at 4000 rpm to collect the precipitate, the concentration was adjusted to OD using the aforementioned inoculum. 600 =0.2~0.
5.
7. The method for inducing transgenic hairy roots in chili peppers according to claim 6, characterized in that, After the Agrobacterium was cultured by shaking and the precipitate was collected by centrifugation, the concentration of the precipitate was adjusted to OD using the infection solution. 600 =0.
3.
8. The method for inducing hairy roots in transgenic chili peppers according to claim 1, characterized in that, In step (5), the infection conditions are: 25℃, 100rpm low speed infection for 15~20min; the co-culture medium is: MS medium + 30g / L sucrose + 200mg / L AS + 8g / L agar, pH=5.8; the co-culture conditions are: 25℃ dark culture for 2~3d; the leaf face is facing up when transferring the inoculation.
9. The method for inducing transgenic hairy roots in chili peppers according to claim 1, characterized in that, In step (6), the induction medium is: MS medium + 30 g / L sucrose + 200 mg / L Timentin + 200 mg / L HygB + 8 g / L agar, pH=5.8; the photoperiod culture conditions are: 28℃, 16 h light / 8 h dark, the induction medium is changed every 2 weeks, and the chili transgenic hairy roots are obtained after 2 to 4 weeks of culture.
10. The method for inducing transgenic hairy roots in chili peppers according to claim 1, characterized in that, In step (6), after obtaining the transgenic hairy roots of chili peppers, the following steps are also included: The obtained chili transgenic hairy roots were transferred to an induction medium containing 0.1 mg / L NAA and cultured for another 2 weeks to obtain a highly branched lateral root system; or transferred to an induction medium without NAA and cultured for another 2 weeks to obtain a taproot-extending hairy root.