Application of StWOX5 gene

Abstract

The invention belongs to the field of biological agriculture, and particularly relates to application of an StWOX5 gene. The invention provides an StWOX5 gene, a protein encoded by the StWOX5 gene, and an application of a recombinant vector, an expression cassette, a transgenic cell line or recombinant bacteria containing the StWOX5 gene in improvement of salt tolerance of plants. The StWOX5 gene with a salt-tolerant effect is obtained through function research, the StWOX5 gene is used for constructing an overexpression vector, the overexpression vector is transferred into a potato Atlantic wild type material, an StWOX5 overexpression plant is obtained, it is found through verification that the StWOX5 gene is overexpressed, the salt tolerance of the plant is enhanced, it is determined that the gene plays a positive regulation role in salt stress response, a new way is provided for improving the salt tolerance of the plant, and the StWOX5 overexpression plant has a good application prospect. And a new gene resource is provided for plant salt-tolerant breeding.

Description

Technical Field

[0001] This invention belongs to the field of bio-agriculture, specifically involving StWOX5 The application of genes, especially involving StWOX5 Applications in improving plant salt tolerance. Background Technology

[0002] Salt stress is one of the major abiotic stresses limiting plant growth and development. It disrupts plant metabolism, damages the plant's redox system, and leads to an excess of reactive oxygen species (ROS), which accumulate in the plant, affecting photosynthesis and hindering growth, potentially causing significant agricultural losses. Salt-tolerant breeding is one of the most economical and effective measures to address plant salt stress. However, the discovery of salt-tolerant genes is time-consuming, and the breeding of salt-tolerant varieties is difficult, making it challenging to completely resolve salt stress. Therefore, finding new salt-tolerant genes is the fundamental approach and key technology for solving plant salt stress.

[0003] The WUSCHE-related homeobox (WOX) gene family is a family of plant-specific transcription factors. Their conserved sequences consist of approximately 60 amino acids arranged in a helix-loop-helix-turn-helix pattern, forming a homeodomain (HD). WOX transcription factors exert their biological functions by binding to specific DNA sequences through the HD. Phylogenetic analysis of WOX proteins in different plants has divided the WOX gene family into three clades: the WUS clade, the intermediate clade, and the ancient clade. Members of the WOX gene family are widely involved in plant growth and development, regulation of stem cell division and differentiation, embryonic and organogenesis, and responses to abiotic stress.

[0004] StWOX5 As a member of the WOX family, there have been reports indicating that StWOX5 Involved in plant root development, in potatoes StWOX5 It has the effect of improving the in vitro regeneration ability of potatoes, but StWOX5 Whether a gene responds to salt tolerance has not been reported in the literature, and those skilled in the art cannot predict this without extensive gene function studies and functional verification research. StWOX5 Whether genes are involved in plant salt stress responses is even more unpredictable. StWOX5 Genes play a negative or positive regulatory role in the interaction between plants and salt stress. Summary of the Invention

[0005] To solve the above-mentioned technical problems, the present invention provides aStWOX5 The application of genes aims to study StWOX5 To investigate the role and regulatory mechanism of salt tolerance in enhancing plant salt tolerance, and to identify salt-tolerant genes that play a positive regulatory role in salt stress response, this study aims to provide new approaches for utilizing these genes to improve plant salt tolerance and to provide new gene resources for creating salt-tolerant plant materials to cope with plant salt stress.

[0006] On the one hand, this invention provides the application of any one of the following substances (1), (2), or (3) in improving the salt tolerance of plants: 1) StWOX5 Genes, the ones mentioned StWOX5 The nucleotide sequence of the gene is shown in SEQ ID No:1; 2) StWOX5 protein, wherein the StWOX5 protein is composed of the... StWOX5 Gene encoding obtained; 3) Contains StWOX5 Gene recombinant vectors, expression cassettes, transgenic cell lines, or recombinant bacteria.

[0007] Furthermore, in the application, the amino acid sequence of the StWOX5 protein is shown in SEQ ID No:2.

[0008] Furthermore, in the aforementioned application, the salt tolerance refers to the property of tolerance to NaCl.

[0009] Furthermore, StWOX5 gene Or by StWOX5 The StWOX5 protein encoded by the gene or containing StWOX5 Recombinant vectors of genes or containing StWOX5 Gene expression cassettes or containing StWOX5 Transgenic cells containing genes or StWOX5 Recombinant bacteria with genes are used to improve the salt tolerance of potatoes.

[0010] On the other hand, the present invention provides a method for cultivating transgenic plants with improved salt tolerance, the method comprising the following steps: ... StWOX5 Genes are introduced into recipient plants to obtain transgenic plants; compared with recipient plants, transgenic plants have enhanced salt tolerance.

[0011] Furthermore, in the method for cultivating transgenic plants with enhanced salt tolerance, the... StWOX5 The gene was introduced via a recombinant expression vector, namely pBWA(V)KS-StWOX5-gfp.

[0012] Furthermore, in the method for cultivating transgenic plants with enhanced salt tolerance, the... StWOX5 The nucleotide sequence of the gene, expressed through Agrobacterium-mediated genetic transformation, plays a positive regulatory role in the potato-salt stress interaction. Overexpression of the gene...[[ID=2))StWOX5 The nucleotide sequence of a gene can enhance a plant's salt tolerance.

[0013] Furthermore, in the method for cultivating transgenic plants with enhanced salt tolerance, the plant is a potato.

[0014] Furthermore, in the method for cultivating transgenic plants with enhanced salt tolerance, the salt tolerance refers to the property of tolerance to NaCl.

[0015] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: (1) Compared with traditional breeding techniques, plant disease resistance genetic engineering technology can overcome reproductive isolation and incompatibility between species, achieving targeted improvement of target traits in a shorter period of time, providing crops with more comprehensive, continuous, and broad-spectrum protection. This invention, through gene function research, has discovered... StWOX5 Genes play a positive regulatory role in the salt stress response, that is... StWOX5 Overexpression of gene nucleotide sequences can enhance the salt tolerance of plants. StWOX5 When the nucleotide sequence of a gene is overexpressed in a plant, it can confer a certain degree of salt tolerance.

[0016] (2) This invention provides a method for cultivating transgenic plants with enhanced salt tolerance. This method utilizes genetic engineering technology to overexpress the aforementioned [transgenic plant] in the plant. StWOX5 Genes that enhance plant salt tolerance. It has been verified that the overexpression obtained using the method of this invention... StWOX5 Enhanced salt tolerance in plants. This invention provides a new technical approach to improving plant salt tolerance from a molecular biology perspective, effectively solving the technical problems encountered in this invention. Attached Figure Description

[0017] Figure 1 yes StWOX5 Gene PCR electrophoresis image.

[0018] Figure 2 yes StWOX5 Results of the gene's salt tolerance test.

[0019] Figure 3 This is provided by the embodiments of the present invention. StWOX5 Diagram of gene expression vector.

[0020] Figure 4 yes StWOX5 Image showing the identification results of genetically modified potato plants.

[0021] Figure 5 This is provided by the embodiments of the present invention. StWOX5 Phenotypic diagram of salt tolerance test of genetically modified potatoes.

[0022] Figure 6 This is provided by the embodiments of the present invention. StWOX5 Results of salt tolerance mechanism test in genetically modified potatoes. Detailed Implementation

[0023] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the following embodiments.

[0024] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings. However, the embodiments described are not intended to limit the present invention.

[0025] Unless otherwise specified, the experimental and detection methods described in the following embodiments are conventional methods; unless otherwise specified, the reagents and materials are commercially available.

[0026] Example 1 This example is a cloning. StWOX5 Gene.

[0027] Total RNA was extracted from potato roots and stems using conventional methods, and cDNA was obtained through reverse transcription. RNA reverse transcription was performed using a full-gold reagent kit, and the steps are as follows: (1) First add the reagents in the following proportions: Total RNA (4 μg); Anchored Oligo (dT) 18Primer (μg / μL) (1μL); RNase-free water (add to 8 μL); (2) After mixing, incubate at 65°C for 5 min using a PCR instrument, then place on ice for 2 min. Then, add the following reaction components: 2×ES Reaction Mix (10μL); RT / RI Enzyme Mix (1μL); gDNA Remover (1 μL); (3) Extend at 42℃ for 30 min, then heat at 85℃ for 30 s to inactivate the enzyme and obtain cDNA.

[0028] Gene cloning: Take the cDNA obtained from the above reverse transcription, and use it to... StWOX5 -F and StWOX5 -R is a primer for amplification, the StWOX5 The -F sequence is shown in SEQ ID No:3. StWOX5 The sequence of -R is shown in SEQ ID No:4. StWOX5 -F andStWOX5 The specific sequence for -R is as follows: StWOX5 -F:AACACGGGGGACTTTGCAACATGGCTGAAGATACTAATATGGGAACTAAGTGTG; StWOX5 -R:TCCTCGCCCTTCACGATACAAGAAAAGAAAGAAAGTCTAAGATCAAGAGTAGGATGATC.

[0029] The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 50℃ annealing for 45 s, 72℃ extension for 29 s, 30 cycles; 72℃ final extension for 10 min, incubation at 12℃, to obtain... StWOX5 Gene PCR products.

[0030] right StWOX5 The gene PCR products were detected by electrophoresis, and the electrophoresis results are as follows: Figure 1 As shown, lane M is the marker, and lanes 1-4 are all markers. StWOX5 Gene fragment, target band size and expected StWOX5 The gene size is consistent. StWOX5 The gene fragment was subjected to Sanger sequencing, which confirmed that the PCR product had the nucleotide sequence shown in SEQ ID No:1.

[0031] Example 2 This example is StWOX5 Gene salt tolerance function test.

[0032] The culture medium was prepared by adding different concentrations of NaCl to uracil-deficient galactose synthesis basal medium (SG-U) to prepare MSG-U media with NaCl concentrations of 0, 0.5M, 1.0M, 1.3M, 1.5M, and 2.0M, as detailed below: SG-U+0M NaCl: The concentration of NaCl in SG-U medium is 0; SG-U + 0.5M NaCl: The concentration of NaCl in SG-U medium is 0.5M; SG-U + 1.0M NaCl: The concentration of NaCl in SG-U medium is 1.0M; SG-U + 1.3M NaCl: The concentration of NaCl in SG-U medium is 1.3M; SG-U + 1.5M NaCl: The concentration of NaCl in SG-U medium is 1.5M; SG-U + 2.0M NaCl: The concentration of NaCl in SG-U medium is 2.0M. target gene StWOX5 The pYES2-NTB vector was constructed and transformed into yeast strain INVSC1 to obtain the experimental group of yeast strains, namely yeast strains containing pYES2-NTB-StWOX5.

[0033] The pYES2-NTB vector was transformed into yeast strain INVSC1 to obtain the control group yeast strain, which is a yeast strain containing only the pYES2-NTB vector.

[0034] The clones of the yeast strains in the experimental group and the control group were resuspended in 2 mL of sterile water and diluted (10). 0 10 -1 10 -2 Plates were incubated on SG-U medium with NaCl concentrations of 0, 0.5 M, 1.0 M, 1.3 M, 1.5 M, and 2.0 M at 30°C for 7 days. The plates were then observed and photographed for further analysis. StWOX5 Salt tolerance gene testing.

[0035] StWOX5 Results of the gene salt tolerance test are as follows Figure 2 As shown, the experimental group pYES2-NTB-StWOX5 was able to grow on SG-U+1.0M NaCl plates, while the negative control pYES2-NTB could not grow on SG-U+1.0M NaCl plates. The results indicate that... StWOX5 The gene has salt tolerance.

[0036] Example 3 This embodiment is for construction. StWOX5 Gene overexpression vector.

[0037] Will StWOX5 The gene was recombinated and ligated with the pBWA(V)KS vector carrying a gfp tag.

[0038] (1) The enzyme digestion system was 20 μL: Nuclease-free Water (13 μL); 10× Buffer (2 μL); Bsa I / Eco31 I (1 μL); pBWA(V)KS-ccdb-osgfp (4 μL). The reaction conditions were: 37℃ for 1 h.

[0039] (2) Recombinant ligation: The vector digests were purified using a PCR purification kit (the purified product was labeled as pBWA(V)KS-ccdb-osgfp(D)) and used for the next recombination reaction. The recombination reaction system consisted of 20 μL: 2×EasyClone Mix (10 μL); StWOX5 (5 μL); pBWA(V)KS-ccdb-osgfp(D) (5 μL). The reaction conditions were: 37℃ for 30 h.

[0040] (3) Transformation of competent Escherichia coli cells: Transform 5-10 μL of the ligation product into competent Escherichia coli cells, transform them into (kanamycin) resistant plates, incubate at 37℃ for 12 h, and perform plaque PCR identification.

[0041] (4) Plaque PCR identification: Ten plaques were picked and simultaneously inoculated into 1.5 mL EP tubes for PCR identification. 100 μL of the bacterial solution corresponding to three positive bands was sent for sequencing, and the remaining 400 μL of bacterial solution was inoculated into 5-10 mL of LB liquid medium containing kanamycin resistance. The tubes were shaken until the sequencing results were correct, indicating that... StWOX5 The overexpression vector pBWA(V)KS-StWOX5-gfp was successfully constructed. [[ID=]]StWOX5 Overexpression vector map as follows Figure 3 As shown. Extract the pBWA(V)KS-StWOX5-gfp plasmid for later use.

[0042] Example 4 This embodiment is for construction. StWOX5 Genetically modified potato varieties.

[0043] 1 μL of the recombinant plasmid pBWA(V)KS-StWOX5-gfp prepared in Example 3 was added to 50 μL of Agrobacterium GV3101 competent cells. After thorough mixing, the mixture was transferred to an electroporation cuvette for electroporation. After electroporation, 1 mL of LB liquid medium was added, and the mixture was thoroughly mixed and transferred to a 1.5 mL centrifuge tube. The cells were then activated by shaking at 30°C and 180 rpm for 30 min. 50 μL of the activated Agrobacterium culture was inoculated onto LB solid medium and incubated in the dark at 30°C for 48 h. Agrobacterium was then picked from the infection medium to prepare OD. 600 =0.2-0.5 Agrobacterium suspension.

[0044] Using the potato variety 'Atlantic' as the recipient material, test-tube seedlings that have grown for 3-4 weeks were selected, and stem segments of 0.2-0.5 cm were cut with a scalpel as explant material. The explant material was inoculated in pre-medium (MS + 0.5 mg / L 6-BA + 0.1 mg / L NAA) and cultured in the dark at 23°C for 2-3 days.

[0045] Pre-cultured explants were inoculated into Agrobacterium suspension for 10 min, and then the inoculated explants were dried on sterile filter paper. The dried explants were then inoculated into co-culture medium (pre-culture medium + 100 μM acetylsyl syringone) and incubated in the dark at 23°C for 48-72 h.

[0046] After co-culture, the explants were transferred to selection medium and cultured at 25°C under 16 / 8 light for 14 days. Subsequently, the explants were transferred to selection / differentiation medium, 30 explants per dish, and cultured at 25°C under 16 / 8 light, with the medium changed every 20 days. Differentiated shoots were inoculated onto rooting medium and cultured at 25°C under 16 / 8 light until rooting occurred, yielding... StWOX5 Genetically modified potato varieties.

[0047] Example 5 This embodiment is for identification. StWOX5 Positive genetically modified potato plants.

[0048] The sample obtained in Example 4 was subjected to qRT-PCR. StWOX5 The genetically modified potato plants were identified.

[0049] The primer information for qRT-PCR is as follows: StWOX5 -F (SEQ ID No:5):TGCTGAAACTGAAAAGCTTAGACT3; StWOX5 -R (SEQ ID No: 6):GGATGATCCATCTCAGCTCCA3.

[0050] StWOX5 The results of the identification of transgenic potato plants are as follows: Figure 4 As shown, the results are... StWOX5 Transgenic potato plants (OE-4 and OE-5) [[ID=7))StWOX5 Gene expression levels were significantly higher in the wild-type (WT) and water-type plants, indicating that... StWOX5 Both OE-4 and OE-5 transgenic potato plants were positive.

[0051] Example 6 This embodiment is StWOX5 Salt tolerance test of genetically modified potatoes.

[0052] The results obtained from the screening in Example 5 StWOX5 Transgenic potato positive plants (OE-4 and OE-5) and wild-type potato plants (WT) were inoculated into 3% MS medium containing 0 mM and 150 mM NaCl and cultured under light. Six plants of each line were inoculated, and three replicates were performed. Plant growth was observed after 20 days.

[0053] Depend on Figure 5 It can be seen that in a culture medium with 0 mM NaCl StWOX5 The rooting rates of transgenic potato positive plants (OE-4 and OE-5) were not significantly different from those of wild-type potato plants (WT), but the rooting rate of wild-type potato plants (WT) was lower in 150 mM NaCl medium. StWOX5 Rooting rate of transgenic potato positive plants (OE-4 and OE-5).

[0054] Wild-type potatoes (WT) and StWOX5 After hardening off, tissue culture seedlings of transgenic potatoes (OE-4 and OE-5) were transplanted into pots containing a mixed substrate (nutrient soil: vermiculite = 2:1). Watering was done every 2 days. When the plants reached approximately 20 cm in height, the treatment group was subjected to simulated salt stress with 120 mM NaCl solution, applied to the roots near the base of the plants between 9 and 10 am every 2 days. The control group (0 mM NaCl) received the same amount of water. After 20 days, plant growth was observed, and leaf samples were collected to determine MDA content.

[0055] Depend on Figure 6 From B, we can know that StWOX5 The transgenic plants (OE-4 and OE-5) grew better than the wild-type plants (WT), which exhibited leaf wilting.

[0056] Depend on Figure 6 As shown in C, the wild-type potatoes (WT) treated with the control group (0mM NaCl) and StWOX5 There was no significant difference in MDA content between transgenic potato plants (OE-4 and OE-5), but in the 120 mM NaCl treatment group, StWOX5 The MDA content decreased in transgenic potato lines (OE-4 and OE-5), while the MDA content increased in wild-type potato plants (WT), further indicating that... StWOX5 The gene can significantly improve the salt tolerance of potatoes and can be used to develop salt-tolerant plant varieties.

[0057] In summary, this invention utilizes gene recombination technology to construct... StWOX5 The expression vector was delivered into the recipient wild potato using Agrobacterium-mediated potato genetic transformation technology. StWOX5 Genetically modified potato plants, further... StWOX5 Salt tolerance tests were conducted on genetically modified potatoes, and it was found that... StWOX5 Compared with wild-type potato plants, transgenic potato plants showed significantly improved salt tolerance, indicating that... sStWOX5 Genes are used to improve the salt tolerance of plants and are applied in the breeding of salt-tolerant plant strains.

[0058] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of any of the following substances in improving plant salt tolerance: 1) StWOX5 Genes, the ones mentioned StWOX5 The nucleotide sequence of the gene is shown in SEQ ID No:1; 2) StWOX5 protein, wherein the StWOX5 protein is composed of the... StWOX5 Gene encoding obtained; 3) Contains StWOX5 Gene recombinant vectors, expression cassettes, transgenic cell lines, or recombinant bacteria.

2. The application according to claim 1, characterized in that: The amino acid sequence of the StWOX5 protein is shown in SEQ ID No:

2.

3. The application according to claim 1 or 2, characterized in that: The salt resistance mentioned refers to the property of resistance to NaCl.

4. The application according to claim 1, characterized in that: The plant in question is a potato.

5. A method for cultivating transgenic plants with enhanced salt tolerance, comprising the following steps: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] StWOX5 Genes are introduced into recipient plants to obtain transgenic plants; compared with recipient plants, transgenic plants have enhanced salt tolerance.

6. The method according to claim 5, characterized in that: The StWOX5 The gene was introduced via a recombinant expression vector.

7. The method according to claim 5, characterized in that, The StWOX5 The nucleotide sequence of the gene is expressed through Agrobacterium-mediated genetic transformation.

8. The method according to claim 5, characterized in that, Overexpression StWOX5 The nucleotide sequence of a gene enhances a plant's salt tolerance.

9. The method according to claim 5 or 6, characterized in that: The plant in question is a potato.

10. The method according to claim 5, characterized in that: The salt resistance mentioned refers to the property of resistance to NaCl.

Images