Non-human animal integrated with double-derived VH subclass fusion gene as well as construction method and application of non-human animal

Abstract

The invention discloses a non-human animal integrated with a double-derived VH subclass fusion gene as well as a construction method and application of the non-human animal. The method comprises the following steps: firstly, constructing a gene construct containing human IGHV1-69 and IGHV3-23 fragments, a specific spacer region, a functional element and a rat heavy chain 3'enhancer, and microinjecting the gene construct into a C57BL / 6J fertilized egg with an endogenous heavy chain and a kappa light chain knocked out to obtain a transgenic mouse; through identification, after a mouse endogenous antibody is inactivated, a human gene is stably integrated, a human IgM antibody is expressed and H5N1 HA immunization is carried out, the use frequency of IGHV1-69 is remarkably increased, the mouse produces a high-titer specific antibody, and serum has neutralizing activity. The mouse can generate a target bnAbs aiming at the HA stem and the RBS in parallel, so that the antibody screening efficiency is improved, and an in-vivo screening and evaluation platform for simulating human body fluid response is provided for research and development of influenza antibodies and vaccines.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a non-human animal integrating dual human VH subclass fusion genes, its construction method, and its application. Background Technology

[0002] With the high variability of influenza A virus leading to frequent seasonal and pandemic influenza outbreaks, causing tens to hundreds of millions of infections and hundreds of thousands of deaths globally each year, it places a heavy burden on public health and the economy. Broadly neutralizing antibodies (bnAbs) primarily target the stem and receptor-binding site (RBS) of hemagglutinin (HA), and are considered key targets for the development of universal influenza vaccines and antibody drugs. The CDRH2 region encoded by the antibody subclass gene IGHV1-69 is rich in hydrophobic residues, enabling it to naturally recognize and bind to conserved epitopes in the HA stem, providing the molecular basis for the rapid induction of stem bnAbs. It is a core subclass gene for the production of public antibodies against influenza in humans. Sangesland et al. used CRISPR / Cas9 to precisely knock human IGHV1-69 into the mouse IgH gene locus, and simultaneously constructed a humanized CDRH3 diversity library, demonstrating that a single recombinant HA immunization can efficiently induce the production of Group 1 influenza stem bnAbs. Further research revealed that the IGHV1-69 F54 allele can support the amplification of the allotype bnAb, while the L54 allele is cleared by tolerance mechanisms due to its self-reactivity, significantly affecting the vaccine response.

[0003] The IGHV3-23 gene is highly abundant in the human B cell repertoire and participates in common antibody responses to various viruses (such as dengue fever, Zika, and influenza), indicating its broad-spectrum recognition potential. Recent studies have reported a class of transsubtype bnAbs that utilize IGHV3-23 to bind to the RBS region of HA, overcoming stereobarriers through a specific CDRH1 / CDRH2 conformation to achieve cross-group neutralizing activity. However, existing humanized mouse models are mostly limited to a single VH gene or multiple VHs (such as the whole human VH genome), and there is no dual-gene platform that simultaneously integrates IGHV1-69 and IGHV3-23. Existing single-VH gene humanized mouse models can only produce antibodies against a single epitope, making it impossible to simultaneously measure the interactions and synergistic effects of different VH genes in antibody development pathways. Furthermore, the excessive number of genes in whole human VH transgenic mice leads to a "dispersed" immune response, making it difficult to produce high-abundance, specific neutralizing antibodies. Studies by Professor Frederick W. Alt and others have shown that combinations of single or small amounts of VH genes have significant advantages in generating specific antibodies, focusing the immune response on key conserved epitopes and avoiding excessive dilution of diversity. Therefore, this invention is the first to achieve a transgenic non-human animal model integrating human IGHV1-69 and IGHV3-23 dual genes. By preserving human CDRH3 diversity and combining high-throughput single-cell sequencing and functional screening, the induction efficiency and affinity maturation of the stem and RBS target bnAbs are evaluated in parallel within the same animal model, significantly improving the efficiency of influenza antibody screening and optimization. This invention aims to overcome the limitations of existing models with single or excessive genes, providing a highly efficient and reproducible platform, and offering a solid in vivo evaluation basis for influenza and other respiratory viruses (such as coronaviruses) antibody screening and vaccine design. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide the art with a transgenic non-human animal model integrating human IGHV1-69 and IGHV3-23 dual genes and a method for constructing the same.

[0005] The present invention achieves the above-mentioned objectives by adopting the following technical solution: A first aspect of the present invention provides a gene construct for constructing a non-human animal that integrates a dual human VH subclass fusion gene.

[0006] Furthermore, the gene construct contains the following DNA fragments in a 5' to 3' sequence: Human IGHV1-69 fragment: nucleotide sequence as shown in SEQ ID NO:1; Human IGHV3-23 fragment: nucleotide sequence as shown in SEQ ID NO:2; First spacer segment: containing IGHD6-13 and IGHD1-14 elements, the nucleotide sequence of which is shown in SEQ ID NO:3; The second spacer segment contains the IGHD2-15 element, and its nucleotide sequence is shown in SEQ ID NO:4. Functional element fragment: Contains IGHJ1 to IGHJ6 elements, intron enhancer (iEμ), class switching region switch (Sμ) region and IGC mu constant region, nucleotide sequence as shown in SEQ ID NO:5; 3' enhancer fragment: nucleotide sequence as shown in SEQ ID NO:6; Each of the DNA fragments was assembled by homologous recombination.

[0007] A second aspect of the invention provides a combination of sgRNAs for constructing non-human animals that integrate dual human VH subclass fusion genes.

[0008] Furthermore, the sgRNA combination includes sgRNA pairs targeting the JH region of the non-human animal heavy chain IgH and sgRNA pairs targeting the JK and CK regions of the non-human animal light chain IgK. Of the sgRNA pair targeting the JH region of non-human heavy chain IgH, the nucleotide sequence of sgRNA1 is shown in SEQ ID NO:7, and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO:8. Of the sgRNA pairs targeting the JK and CK regions of the non-human animal light chain IgK, the nucleotide sequence of sgRNA1 is shown in SEQ ID NO:9, and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO:10. Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep.

[0009] A third aspect of the invention provides a primer combination for identifying endogenous heavy chains and kappa light chains in non-human animals.

[0010] Furthermore, the primer set includes the non-human animal heavy chain JH deletion primer set and the non-human animal kappa light chain JK / CK deletion primer set; The non-human animal heavy chain JH deletion primer set includes: Mouse Igh-F: Nucleotide sequence is shown in SEQ ID NO:11; Mouse Igh-R: Nucleotide sequence as shown in SEQ ID NO:12; Mouse Igh-He / Wt-F: Nucleotide sequence is shown in SEQ ID NO:13; The non-human animal kappa light chain JK / CK deletion primer set includes: Mouse Igk-F: Nucleotide sequence is shown in SEQ ID NO:14; Mouse Igk-R: Nucleotide sequence is shown in SEQ ID NO:15; Mouse Igk-He / Wt-F: Nucleotide sequence is shown in SEQ ID NO:16; Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep.

[0011] A fourth aspect of the present invention provides a primer combination for identifying transgenic nonhuman animals containing human IGHV1-69 and IGHV3-23.

[0012] Furthermore, the primer combination includes a front-end identification primer pair and a back-end identification primer pair; The front-end identification primer pair includes: Transgene PCR primer F1: Nucleotide sequence as shown in SEQ ID NO:19; Transgene PCR primer R1: Nucleotide sequence as shown in SEQ ID NO:20; The subsequent identification primer pair includes: Transgene PCR primer F2: Nucleotide sequence as shown in SEQ ID NO:21; Transgene PCR primer R2: Nucleotide sequence as shown in SEQ ID NO:22; Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep.

[0013] The fifth aspect of the invention provides a nonhuman animal with endogenous heavy chain and kappa light chain knockout.

[0014] Furthermore, the non-human animal was obtained by deleting the JH region of the endogenous heavy chain IgH and the JK and CK regions of the light chain IgK using CRISPR / Cas9 technology; The deleted sequence of the JH region of the non-human animal heavy chain IgH is shown in SEQ ID NO:17, and the deleted sequence of the JK and CK regions of the light chain IgK is shown in SEQ ID NO:18. Optionally, by PCR identification using the primer combination described in the third aspect of the present invention, the non-human animal is confirmed to have homozygous knockout of the heavy chain and homozygous knockout of the kappa light chain, and no endogenous antibody expression. Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep; Optionally, the non-human animal is a C57BL / 6J mouse.

[0015] The sixth aspect of the present invention provides a non-human animal integrating a dual human VH subclass fusion gene.

[0016] Furthermore, the non-human animal is a transgenic non-human animal with both IGHV1-69 and IGHV3-23 genes; Furthermore, the non-human animal is obtained by injecting the gene construct described in the first aspect of the present invention into the fertilized egg of a non-human animal with endogenous heavy chain and kappa light chain knockout as described in the fifth aspect of the present invention via embryo microinjection. Using the primer combination PCR identification described in the fourth aspect of this invention, the human IGHV1-69 and IGHV3-23 genes were successfully integrated into the genome of a non-human animal. Optionally, the non-human animal can express human IgM antibodies, and after immunization with H5N1 HA, the frequency of IgHV1-69 in B cells BCR increases significantly, and high-titer antigen-specific human IgM antibodies can be produced, and the serum has H5N1 pseudovirus neutralizing activity. Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep; Optionally, the non-human animal is a C57BL / 6J mouse.

[0017] The seventh aspect of the present invention provides a method for constructing a non-human animal integrating a dual human VH subclass fusion gene.

[0018] Furthermore, the non-human animal is a transgenic non-human animal with both IGHV1-69 and IGHV3-23 genes; Furthermore, the method includes the following steps: S1: Construct the gene construct described in the first aspect of the present invention; S2: Using the sgRNA combination described in the second aspect of the present invention, non-human animals with endogenous heavy chain and kappa light chain knockout as described in the fifth aspect of the present invention were prepared by CRISPR / Cas9 technology; S3: The gene construct constructed in step S1 is injected into the fertilized eggs of non-human animals with endogenous heavy chain and kappa light chain knockout obtained in step S2 via embryo microinjection. After culturing, the construct is transplanted into the oviduct dilatation of pseudopregnant ICR non-human animals. After birth, PCR identification is performed using the primer combination described in the fourth aspect of the present invention to screen for positive transgenic non-human animals, namely transgenic non-human animals with IGHV1-69 and IGHV3-23 dual genes. Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep; Optionally, the non-human animal is a C57BL / 6J mouse.

[0019] Furthermore, the specific process for preparing C57BL / 6J mice with knockout of endogenous heavy chain and kappa light chain in step S2 includes: S21: Select 3-4 week old C57 / 6J female mice, inject 5 IU / mouse PMSG intraperitoneally, and inject HCG 48 h later. The next day, the oviducts of the mice with plugs were removed, and fertilized eggs were obtained in hyaluronidase. They were cultured in M16 medium containing paraffin oil at 37℃ and 5% CO2. S22: Mix sgRNA with Cas9 protein to prepare RNP complex, centrifuge to remove impurities, dissolve in buffer and place on ice; S23: Inject the RNP complex into the pronucleus of the fertilized egg. The pronucleus expands, indicating successful injection. The embryo is then cultured for another half hour before being transferred. S24: The successfully injected embryos are transferred to the oviduct dilatation of pseudopregnant ICR mice. After the mice are born, PCR identification and Sanger sequencing are performed using the primer combination described in the third aspect of this invention to screen mice with homozygous knockout of heavy chain and kappa light chain.

[0020] Furthermore, after embryo microinjection in step S3, a verification step for positive transgenic mice is also included: blood is collected from the tail vein, and the expression of human IgM in the serum is detected by a human IgM detection kit; the mice are immunized with H5N1 HA, and the frequency of VH, DH, JH and CDRH3 abundance are analyzed by BulkBCR sequencing; the serum antibody titer is detected by ELISA; and the serum neutralizing activity is detected by a pseudovirus neutralization experiment.

[0021] The eighth aspect of the present invention provides for any of the following applications: (1) The application of the non-human animals integrating dual human VH subclass fusion genes described in the sixth aspect of the present invention in the screening of influenza virus broad-spectrum neutralizing antibodies (bnAbs), in vivo evaluation of influenza vaccines, or development of influenza antibody drugs; (2) The application of the non-human animals integrating dual human VH subclass fusion genes as described in the sixth aspect of the present invention in screening for broad-spectrum neutralizing antibodies against coronaviruses or other respiratory viruses, in vivo evaluation of vaccines, or development of antibody drugs; Optionally, the coronavirus includes MERS, SARS-CoV, or SARS-CoV-2; Optionally, the other respiratory viruses include respiratory syncytial virus, measles virus, mumps virus, human metapneumovirus, or bocavirus; Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep; Optionally, the non-human animal is a C57BL / 6J mouse.

[0022] In some implementations, the engineered mice (i.e., the non-human animals integrating dual human VH subtype fusion genes as described in the sixth aspect of this invention) serve as a highly efficient in vivo platform for screening bnAbs targeting key conserved epitopes of influenza viruses. The core application logic is based on the precise matching of their gene design and immune response characteristics. Specifically, simultaneous screening of multi-target bnAbs: the mice simultaneously integrate the IGHV1-69 gene, which targets the conserved epitope of the HA stem, and the IGHV3-23 gene, which binds to the HA receptor-binding site (RBS), while preserving human CDRH3 diversity (CDRH3 abundance was confirmed unaffected by Bulk BCR sequencing). When the mice are immunized with HA antigens from different subtypes of influenza viruses (such as H5N1, H1N1, and H3N2), their B cells can simultaneously initiate antibody responses against the stem and RBS. This eliminates the need to construct multiple single VH gene mouse models, allowing for the simultaneous screening of bnAbs targeting both types of targets, significantly improving screening efficiency. For example, after immunization with H5N1 HA, mice not only produce high-titer human IgM antibodies against the HA stem (with a significant increase in the frequency of IGHV1-69 use), but also induce specific antibodies against RBS, providing a sufficient source of B cells for subsequent isolation of cross-subtype neutralizing bnAbs (such as antibodies that simultaneously neutralize H5N1 and H1N1). Precise capture of highly functional bnAbs: Because the mouse's endogenous heavy chain and kappa light chain have been knocked out (ELISA confirms no endogenous antibody expression), only human IGHV1-69 / IGHV3-23-mediated antibodies are expressed, avoiding interference from endogenous mouse antibodies in the screening process. Through high-throughput single-cell BCR sequencing combined with functional verification (such as pseudovirus neutralization experiments), B cells secreting human bnAbs can be directly isolated from the spleen or lymph nodes of immunized mice, and their antibody genes can be cloned. Because these antibodies mimic the diversity and binding patterns of natural antibodies in the human body, they possess neutralizing activity and specificity that are closer to the physiological state of the human body, reducing the difficulty of subsequent humanization (such as not needing to replace the frame region of mouse antibodies), and the selected bnAbs are more likely to advance to the clinical research stage.

[0023] In some implementations, the engineered mice can serve as a key model for evaluating the in vivo safety and efficacy of influenza vaccines (especially universal influenza vaccines), overcoming the shortcomings of traditional animal models (such as ordinary mice) in "simulating human antibody responses." Specifically, this involves assessing vaccine-induced multi-epitope antibody responses: current influenza vaccine evaluations largely rely on serum neutralizing titer detection, but it is difficult to distinguish whether the vaccine activates non-neutralizing antibodies targeting the HA variable region or bnAbs targeting the stem / RBS conserved region. This engineered mouse can be analyzed using Bulk BCR sequencing to determine the frequency of VH (IGHV1-69 / IGHV3-23), DH, and JH after vaccine immunization, combined with ELISA detection of antigen-specific human IgM antibody titers, to accurately determine whether the vaccine simultaneously activates antibody responses targeting both the stem domain and RBS. For example, if a universal influenza vaccine significantly increases the frequency of use of IGHV1-69 and IGHV3-23 in mice after immunization, and the serum shows neutralizing activity against multiple subtypes of influenza pseudoviruses (such as H5N1 and H3N2), it demonstrates the vaccine's potential to induce a broad-spectrum antibody response, providing direct evidence for assessing the vaccine's protective range. Early validation of vaccine immunogenicity and safety: Due to the stable genetic background of the mice (based on the C57BL / 6J strain) and controllable human antibody expression, it can be used to assess the immunogenicity of the vaccine (e.g., the titer and duration of antibodies induced by different doses of the vaccine). Simultaneously, by monitoring changes in mouse body weight, organ pathological sections, and cytokine levels (e.g., IL-6 and IFN-γ) after immunization, early detection of immune-related adverse reactions (e.g., excessive inflammatory responses) can be achieved. Compared to large animals like ferrets, this mouse model is lower in cost and has a shorter breeding cycle, allowing for rapid preliminary screening and optimization of vaccine candidate strains (e.g., adjusting the type of vaccine adjuvant and antigen dosage), accelerating the vaccine development process.

[0024] In some implementation schemes, the engineered mice provide full-chain support for the early-stage development of influenza antibody drugs (such as antibody candidate molecule screening and in vivo efficacy verification), from "antibody production" to "functional evaluation." Specifically, this includes the efficient acquisition of antibody drug candidate molecules: In the early stages of antibody drug development, a large number of specific antibody molecules against influenza viruses need to be obtained. By infecting the engineered mice with influenza virus or immunizing them with HA antigen, a human anti-influenza antibody library can be rapidly constructed using hybridoma technology or single-cell antibody cloning technology. The antibodies in the library are all based on the IGHV1-69 / IGHV3-23 framework and contain diverse CDRH3, from which candidate molecules with high affinity and high neutralizing activity can be screened. For example, in the development of antibody drugs against H5N1 influenza virus, anti-HA stem antibodies isolated from immunized engineered mice were verified by in vitro pseudovirus neutralization experiments to have an IC50 value. 50Low concentrations (e.g., <1 μg / mL) can be directly used as candidate molecules for subsequent humanization optimization and production process development. In vivo efficacy and mechanism of action studies for antibody drugs: After obtaining candidate antibody molecules, it is necessary to verify their antiviral effects and mechanisms of action in vivo. Candidate antibodies are injected intraperitoneally or via tail vein into engineered mice, followed by challenge with a lethal dose of influenza virus (e.g., H5N1). Monitoring the survival rate, weight changes, viral load in the lungs, and the degree of pathological damage in the lungs allows for a direct assessment of the antibody's in vivo protective effect. Simultaneously, combining B cell depletion experiments (e.g., injection of anti-CD20 antibodies to clear B cells) or antibody blocking experiments (e.g., competitive binding of HA with antibodies targeting known targets) can further clarify whether the candidate antibody exerts its effect by neutralizing viral infection, activating antibody-dependent cytotoxicity (ADCC), or regulating the body's immune response, providing crucial data for elucidating the mechanism of action of antibody drugs and selecting clinical indications.

[0025] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows: (1) Breaking through the limitations of a single gene and realizing parallel evaluation of multiple targets: Existing humanized mouse models are mostly limited to a single VH gene (such as containing only IGHV1-69), which can only be used to evaluate antibody induction against a single epitope of influenza virus HA (such as the stem), and cannot simultaneously explore the interaction of different VH genes in the antibody development pathway. This invention innovatively constructs a dual-gene humanized transgenic mouse that is simultaneously transformed with human IGHV1-69 and IGHV3-23. IGHV1-69 can target the conserved epitope of HA stem, and IGHV3-23 can bind to the HA receptor binding site (RBS). The induction efficiency and affinity maturation of broad-spectrum neutralizing antibodies (bnAbs) targeting the stem and RBS can be evaluated in parallel in the same animal model, filling the technical gap that a single VH model cannot simultaneously study antibody responses mediated by multiple VH genes.

[0026] (2) Preserving human CDRH3 diversity to ensure antibody screening quality: Some existing models may affect the diversity of antibody variable regions during humanization, resulting in limited affinity or specificity of the screened antibodies. In the gene structure design of this invention, the regulatory sequences of IGHV1-69 and IGHV3-23 (such as the 2 kb upstream and 500 bp downstream fragments of ATG) are precisely selected, and key fragments containing IGHD (6-13, 1-14, 2-15), IGHJ1-6 elements, and intron enhancers (iEμ) are integrated, while preserving human CDRH3 diversity. Bulk BCR sequencing results confirm that the richness of BCR CDRH3 in transgenic mouse B cells is not affected, which can simulate the natural antibody diversity in the human body, ensuring that the screened bnAbs have binding capacity and functional activity that are closer to the physiological state of the human body, thus improving the quality and reliability of antibody screening.

[0027] (3) Improving the efficiency of influenza antibody screening and vaccine design: Existing technologies require the use of different single VH gene models to conduct experiments separately, which not only increases the cost and cycle of animal husbandry and experimental operations, but also makes it difficult to compare the induction effects of antibodies against different epitopes. This invention, through dual-gene integration design, combined with high-throughput single-cell sequencing and functional screening technology, can complete the simultaneous screening and evaluation of multi-target antibodies in the same model, significantly reducing the number of experimental models and operation steps. At the same time, experimental verification after H5N1 HA immunization shows that this model can efficiently induce antigen-specific human IgM antibodies, and the serum has pseudovirus neutralizing activity, which can quickly provide in vivo evaluation data for influenza vaccine design (such as evaluating the activation effect of vaccines on multiple epitopes) and antibody drug development, greatly shortening the research and development cycle and reducing research and development costs.

[0028] (4) Scientific gene structure design, strong model stability and reproducibility: Some existing models may suffer from low expression efficiency and poor stability of human genes due to the absence of regulatory sequences or improper integration sites during gene insertion. This invention is based on the transcriptional regulation rules of eukaryotic genomes (such as the concentration of transcription factor binding sites within 2000 bp upstream of the TSS), precisely designing gene fragment length and flanking sequences, and introducing rat 3' end enhancers to improve expression efficiency; the constructed gene fragments are introduced into C57BL / 6J fertilized eggs with endogenous heavy chain and kappa light chain knockout through embryo microinjection, and the accuracy and stability of model construction are ensured by genotyping (PCR and Sanger sequencing), endogenous antibody detection (ELISA confirming no endogenous antibody expression), and human antibody expression verification (positive detection of human IgM in serum). Experimental results show that the frequency of IGHV1-69 use in mice increased significantly after immunization, and high-titer neutralizing antibodies were produced, proving that the model can stably reproduce the antibody induction process, providing a reliable and reproducible research platform for subsequent experiments.

[0029] (5) Expanding the application scenarios of antibody research to help develop broad-spectrum prevention and control strategies: Existing single VH gene models can only support antibody research on specific epitopes, which is difficult to meet the needs of broad-spectrum prevention and control under the high variability of influenza viruses. In this invention, IGHV1-69 can mediate the induction of group 1 influenza stem bnAbs, and IGHV3-23 has the potential to bind HA RBS across subtypes. The combination of the two enables the model to cover key conserved epitopes of influenza virus HA. It can not only be used to screen broad-spectrum neutralizing antibodies (bnAbs) against current circulating strains, but also provide research tools for antibody reserves and broad-spectrum vaccine design for potential new variant strains, helping to develop more universal influenza prevention and control strategies to address the public health challenges of seasonal and pandemic influenza. Attached Figure Description

[0030] Figure 1 Schematic diagram of the gene structures of IGHV1-69 and IGHV3-23; Figure 2 Schematic diagram of the knockout regions of endogenous heavy chain and kappa light chain and primer identification; Figure 3 PCR analysis using rat tails confirmed that the JH and CK regions of heavy chain IgH and light chain IgK in transgenic mice were successfully deleted at the DNA level. Figure 4 Sanger sequencing showed that the target sequence was successfully deleted; Figure 5 Identification of serum antibody subtypes in heavy chain and kappa light chain knockout mice; Figure 6 : Detection of positive mice in miniIgH transgenic mice using rat tail PCR method; Figure 7 Expression of human antibodies in the serum of IGHV1-69 and IGHV3-23 transgenic mice; Figure 8 VH usage frequency distribution; Figure 9 :DH uses frequency distribution; Figure 10 JH usage frequency distribution; Figure 11 CDRH3 richness; Figure 12 Serum titer of transgenic mice immunized with the H5N1 HA antigen; Figure 13 The effect of HA-immunized mouse serum on pseudovirus neutralization. Detailed Implementation

[0031] The present invention will be further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the invention. Those skilled in the art will understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention. The scope of the invention is defined by the claims and their equivalents. The experimental consumables, reagents, and raw materials used in this invention are readily available to those skilled in the art and, unless otherwise specified, can be obtained commercially. Experimental methods not specifying specific conditions are generally performed under conventional conditions or according to the manufacturer's recommendations. In particular, the following embodiments are for illustrative purposes only and should not limit the scope of the invention in any way. It should be noted that the experimental conditions and results described in the following embodiments are for illustrative purposes only and should not, and will not, limit the invention as described in detail in the claims.

[0032] Example 1: Design of IGHV1-69 and IGHV3-23 gene structures In eukaryotic genomes, the vast majority of transcription factor binding sites (TFBS) and core promoter elements are concentrated within 2000 bp upstream of the transcription start site (TSS), decreasing rapidly with increasing distance from the TSS. The RSS sequence required for VDJ rearrangement is generally about 200 bp after VH. Therefore, the IGHV1-69 and IGHV3-23 fragments are selected approximately 2 kb upstream and 500 bp downstream of their ATG; a 900 bp fragment containing IGHD6-13 and IGHD1-14 elements is flanked by approximately 200 bp endogenous sequences at both ends, serving as a spacer region; a 900 bp fragment containing IGHD2-15 is flanked by approximately 200 bp and 500 bp endogenous sequences at both ends, respectively, serving as a spacer region; and a 19 kb fragment containing IGHJ1 to IGHJ6 elements, intron enhancers (iEμ), class switching region switches (Sμ), and IGC mu constant regions are also selected. The 3' end was ligated using a rat heavy chain 3' enhancer of approximately 750 bp. The DNA sequence selected above was sent to GenScript for synthesis. The complete fusion gene was constructed using homologous recombination with a yeast endogenous recombination system (Saccharomyces cerevisiae BY4741 strain) (method referred to Thermo Fisher: A13285 manual). Each DNA fragment was designed with a 40 bp overlapping arm at its end. Before transformation, the linearized vector (pRS416, 50 ng / μL) was mixed with an equimolar amount of fragment (total concentration 200 ng / μL, in the following order: IGHV1-69 → IGHV3-23 → first spacer region → second spacer region → functional element → 3' enhancer), and lithium transformation buffer (1 M LiAc, 50% PEG 3350, 0.1 M DTT) was added. The mixture was then transformed into competent yeast cells (OD600=0.5). After transformation, recombinant positive clones were grown by incubation at 30°C for 16 h on SD-Leu selection plates. Subsequently, the splicing sequence and absence of mutations were verified by multiplex PCR (primer pairs covering all adapters, annealing temperature 55°C, 35 cycles) and Sanger sequencing.

[0033] The constructed gene fragment was injected into the fertilized eggs of C57BL / 6J (Example 2) with endogenous heavy chain and kappa light chain knockout via embryo microinjection to construct transgenic IGHV1-69 and IGHV3-23 mice. For specific methods, please refer to Example 3.

[0034] The gene structure diagrams of IGHV1-69 and IGHV3-23 are shown below. Figure 1As shown in SEQ ID NO:1, the nucleotide sequence corresponding to the IGHV1-69 gene is shown in SEQ ID NO:2, the nucleotide sequence corresponding to the IGHV3-23 gene is shown in SEQ ID NO:3, the nucleotide sequence corresponding to the IGHD6-13 and IGHD1-14 is shown in SEQ ID NO:4, the nucleotide sequence corresponding to the IGHD2-15 is shown in SEQ ID NO:5, and the nucleotide sequence corresponding to the rat heavy chain 3' enhancer is shown in SEQ ID NO:6.

[0035] Example 2: Construction of C57BL / 6J mice with knockout of endogenous heavy chain and kappa light chain The production of endogenous antibodies in mice depends on an endogenous germline gene segment: the V(D)J rearrangement, which generates functional variable regions in both the heavy and light chains. Inactivation of endogenous mouse endogenous antibodies can be achieved by deleting the endogenous heavy chain JH and the light chain JK and CK regions. Based on this, we designed two pairs of sgRNAs and used CRISPR / Cas9 technology to target the JH and JK regions of the mouse heavy chain IgH and light chain IgK, respectively, to achieve endogenous antibody inactivation by deleting JH and JK (see [link to sgRNA]). Figure 2 (Illustrative diagram). The JH pair targeting IgH is: sgRNA1: TATACAGATCCGATGCATA (SEQ ID NO:7) and sgRNA2: AGTGTACTTGGGTGCCTATC (SEQ ID NO:8). The JK and IgKC pair targeting IgK is: sgRNA1: GAGTGAATGCCATGTACTTA (SEQ ID NO:9) and sgRNA2: AGGTTCACGAGTACTATTCA (SEQ ID NO:10).

[0036] (I) Preparation of C57BL / 6J mice with knockout of endogenous heavy chain and kappa light chain 1. Select 3-4 week old female C57BL / 6J mice and inject 5 IU / mouse of PMSG intraperitoneally. 48 h later, inject HCG. The morning after HCG injection, euthanize the mice by dislocation, remove the oviducts and place them in preheated M2 medium. Remove the fertilized eggs in hyaluronidase and preserve them in M16 medium covered with paraffin oil. Culture them at 37°C and 5% CO2 until the embryos are ready for microinjection.

[0037] 2. The synthesized sgRNA was mixed with commercially available Cas9 protein purchased from TAKARA at a ratio of Cas9: 30 ng / μL; sgRNA: 5 ng / μL. The RNP complex was prepared by mixing the sgRNA with nuclease-free aqueous buffer containing 0.1 mM EDTA. Impurities were removed by centrifugation, and 10 μL of the supernatant was collected and kept on ice for later use.

[0038] 3. Load the RNP complex into a microinjection tube and inject it into the pronucleus of the fertilized egg. Inject about 1-2 pL into each egg. Obvious swelling of the pronucleus indicates successful injection.

[0039] 4. After injection, the embryos are returned to the culture medium and kept in the incubator. They are ready for transfer after half an hour.

[0040] 5. Select suitable ligated male mice to mate with ICR pseudopregnant female mice and induce pseudopregnancy.

[0041] 6. Fertilized eggs in good condition after injection in the incubator were transferred to the oviduct dilatation of pseudopregnant mice.

[0042] 7. Wait for the transgenic mice to be born, then perform genotyping to confirm whether the JH region of IgH has been successfully knocked out.

[0043] (II) Identification of C57BL / 6J mice with knockout of endogenous heavy chain and kappa light chain Genome samples were extracted from the tails of transgenic mice using an animal tissue genome extraction kit (Tiangen Biotech (Beijing) Co., Ltd.). Preliminary identification of bands was performed using PCR. PCR products with correct bands were then recovered using a QIAGEN gel extraction kit and sent to Genewiz Biotechnology Co., Ltd. for Sanger sequencing to accurately determine the deleted sequence. Numbers 2, 3, 9, 11, 14, 16, 20, 39, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, and 36 represent the numbers of transgenic positive mice.

[0044] Mouse heavy chain JH deletion primers: Mouse Igh-F: 5'-AAACAAGACCTCAAACTGATTGACAAG-3' (SEQ ID NO: 11); Mouse Igh-R: 5'-CAAGCATCTATGCTCCCTAAGCACC-3' (SEQ ID NO: 12); Mouse Igh-He / Wt-F: 5'-CCATCTAAGACCTGTCCACAGTAACTCG-3' (SEQ ID NO: 13).

[0045] Mouse kappa light chain JK and CK deletion primers: Mouse Igk-F: 5'-CACCTGTCCTAACAACAGACCAATCC-3' (SEQ ID NO: 14); Mouse Igk-R: 5'-TGAAGTAGGTTGTGGGTAGTGCCC-3' (SEQ ID NO: 15); Mouse Igk-He / Wt-F: 5'-GTTTAGTTGCCCTGAAATCCACCAC-3' (SEQ ID NO: 16).

[0046] 1. Rat tail PCR identification procedure (1) Take a small amount of mouse tail tip sample (about 5~10 mg) into a 1.5 mL centrifuge tube, add 100 μL of tissue digestion solution, and ensure that the tissue sample is completely immersed in the tissue digestion solution. Treat at 65℃ for 30 min. During this period, gently tap the bottom of the tube every 10 min to improve digestion efficiency.

[0047] (2) After digestion, centrifuge briefly and treat at 95-100℃ for 5 min. PCR amplification reaction. Take 1 mL of supernatant for PCR reaction, refer to the PCR system and amplification program as follows: The 25 μL system is as follows:

[0048] The reaction conditions are as follows:

[0049] (3) Gel electrophoresis separation: 180 V, 30 min.

[0050] (4) Place the gel in a nucleic acid gel imaging instrument and take a picture for observation.

[0051] Experimental results are as follows Figure 3 As shown, the heavy chain knockout bands are as follows: homozygous band 746 bp; heterozygous bands 746 bp and 933 bp; wild-type band 933 bp. The kappa light chain knockout bands are as follows: homozygous band 679 bp; heterozygous bands 679 bp and 438 bp; wild-type band: 438 bp. The results show that mice numbered 2, 3, 9, 11, 14, 16, 20, 39, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, and 36 (knockout mouse numbers) are all homozygous knockout mice for both the heavy chain and kappa light chain.

[0052] 2. Purify DNA fragments and perform Sanger sequencing. 1) Sample preparation: Add 10 μL of 6× loading buffer to 50 μL of PCR sample, and inject the DNA Marker and sample into the wells of the agarose gel respectively.

[0053] 2) Gel electrophoresis separation: 180 V, 30~45 min.

[0054] 3) Place the gel in a nucleic acid gel imaging instrument and cut out the target gene fragment.

[0055] 4) The target fragment was recovered according to the instructions of the QIAGEN DNA Recovery Kit and sent to Genewiz Biotechnology Co., Ltd. for Sanger sequencing.

[0056] Sanger sequencing results as follows Figure 4 As shown in the results, the JH and CK sequences of the mouse heavy chain IgH and light chain IgK were successfully knocked out. The knockout sequence of the heavy chain is shown in SEQ ID NO:17, and the knockout sequence of the light chain is shown in SEQ ID NO:18.

[0057] 3. Endogenous antibody detection was performed on selected heavy chain and kappa light chain knockout mouse strains. This experiment used the Pierce Rapid ELISA Mouse mAb Isotyping Kit from Invitrogen to detect endogenous mouse antibodies. The specific method was described in the kit's instruction manual.

[0058] Experimental results: Compared with wild-type mice (WT), no endogenous antibodies were detected in either the heavy chain or the kappa light chain knockout mice (194, 195, 197, 200), indicating that the endogenous antibodies in these double knockout mice were successfully inactivated. Figure 5 ).

[0059] Example 3: Construction of transgenic mice containing human IGHV1-69 and IGHV3-23 The experimental methods followed the steps outlined above in "Preparation of C57BL / 6J Mice with Knockout of Endogenous Heavy Chain and Kappa Light Chain" and all procedures known in the art for handling mouse embryos. The difference was that the donor fertilized eggs were mouse heavy chain and kappa light chain knockout fertilized eggs. Human IGHV1-69 and IGHV3-23 transgenic mice were generated using a random transgenic method: microinjection, without the use of Cas9 protein and sgRNA.

[0060] 1. Embryo Microinjection Procedure: After purifying the constructed gene fragment, the concentration was adjusted to 2-5 ng / μL (in 10mM Tris-HCl, pH 7.4, 0.1 mM EDTA microinjection buffer). An Eppendorf microinjection system was used; the microinjection needle was a quartz needle with an inner diameter of 0.5 μm and an outer diameter of 5 μm. The needle pull parameters were: heating at 70°C, pressure at 100 psi, and medium pull speed. The injection volume for each fertilized egg was 2 pL, injected into the male pronucleus (expansion confirmed successful). After injection, the embryos were cultured in vitro at 37°C and 5% CO2 for 1 h in M16 medium (containing 0.4% BSA, without additional growth factors). Preparation of pseudopregnant ICR female mice: Select 8-10 week old ICR female mice and mate them with castrated male mice (vasectomized BALB / c male mice) at 5-7 pm. Check the vaginal plug the next morning to confirm successful mating. After vaginal plugging, the pseudopregnancy is 0.5 days. Embryos are transferred to the dilated part of the oviduct of pseudopregnant female mice at 2.5 days of pseudopregnancy (20-30 embryos are transferred to each female mouse).

[0061] 2. Identification of positive F0 generation transgenic mice of human IGHV1-69 and IGHV3-23 by rat tail PCR method The anterior and posterior regions of the IGHV1-69 and IGHV3-23 gene structures were selected for identification by rat tail PCR. The primers for the initial identification are as follows: Transgene PCR primer F1:TCAACCCCTGATTCCTACTGTCAATG (SEQ ID NO:19); Transgene PCR primer R1: TGTCTCTGACATTGAGCAGGCAC (SEQ ID NO: 20).

[0062] Target fragment: 294 bp.

[0063] The primers for the subsequent identification are as follows: Transgene PCR primer F2: CTCAGAGACAATGTCCAGGAGACAG (SEQ ID NO: 21); Transgene PCR primer R2: GTCTGTTGTTTAAGCCACGCAGTC (SEQ ID NO: 22).

[0064] Target fragment: 335 bp.

[0065] The experimental method followed the "Rat Tail PCR Identification" step in the above "Preparation of C57BL / 6J Mice with Knockout of Endogenous Heavy Chain and Kappa Light Chain".

[0066] Experimental results: PCR results showed that the gene structures of IGHV1-69 and IGHV3-23 were successfully integrated into the genome of C57BL / 6J mice with endogenous heavy chain and kappa light chain knockout. Figure 6 ).

[0067] 3. Detection of human antibodies in the serum of transgenic mice with human IGHV1-69 and IGHV3-23 genes Blood was collected from F0 generation transgenic mice via the tail vein, and the supernatant was obtained by centrifugation to obtain transgenic mouse serum. The expression level of human IgM was detected using a human IgM detection kit from Beijing Solarbio Science & Technology Co., Ltd. Specific methods were described in the Solarbio kit instructions.

[0068] Experimental results: ELISA was used to detect human IgM in the serum of F0 generation transgenic mice. Mice numbered 2, 3, 11, 30, 31, 33, and 39 expressed human IgM. Figure 7 ).

[0069] 4. BulkBCR sequencing analysis of VH, DH, and JH usage frequencies in IGHV1-69 and IGHV3-23 transgenic mice after immunization with H5N1 HA (Anhui, 2005) and without immunization. Among them, #48 mice were non-immunized mice; #35 mice were HA-immunized mice.

[0070] The specific method is as follows: (1) The peritoneum of mice was disinfected with alcohol, and the spleen was placed in a vial of penicillin containing pre-cooled PBS.

[0071] (2) Prepare a 10 cm dish, add 5 mL of PBS, and place a filter screen in it; place the spleen in the middle of a 300 mesh filter screen, and grind the filter screen with the back of a 5 mL syringe to make it into a single cell suspension; then rinse the filter screen with 5-10 mL of PBS to remove any remaining cells, and collect them together in a 15 mL centrifuge tube.

[0072] (3) Wipe the surface of the clean bench and all reagents and consumables with RNase-free water.

[0073] (4) After counting 15 mL of single-cell suspension from the spleen, take 3 × 10⁻⁶ cells. 6 Centrifuge the cell suspension at 2000 rpm for 5 min, carefully discard the supernatant, and aspirate any excess liquid.

[0074] (5) Transfer to a 1.5 mL EP tube without RNase. Add 1 mL of Trizol lysis buffer to the 1.5 mL EP tube and send it for Bulk BCR sequencing.

[0075] Experimental results: Bulk BCR sequencing showed that the BCRs of the transgenic mice were all limited to the use of IgHV1-69 and IgHV3-23 in the transgenic structures. After immunization with the HA antigen of H5N1 (Anhui, 2005) influenza virus, the frequency of IgHV1-69 use significantly increased, suggesting that the HA antigen of H5N1 can stimulate the use of IgHV1-69. Figure 8 Furthermore, the BCRs of the B cells in these transgenic mice were all specifically modified using the IgHD and IGHJ structures from our transgenic mice. Figure 9-10 Meanwhile, Bulk BCR sequencing results also showed that the BCR of this transgenic mouse was rich in CDRH3. Figure 11 Transgenic mice did not alter the diversity of CDRH3 in mouse B cells.

[0076] 5. Determination of serum antibody titer and serum neutralizing activity in IGHV1-69 and IGHV3-23 transgenic mice after immunization with H5N1 HA (Anhui, 2005) (1) The serum titer of the transgenic mice after immunization with the HA antigen of H5N1 was detected by ELISA. The specific method is as follows: Dilute the predetermined concentration of HA antigen (1 µg / mL) and add 100 µL to each well of a 96-well microplate. Place the plate at 4°C and coat overnight. Block the wells with blocking buffer (4% skim milk solution) to avoid nonspecific binding. Incubate at room temperature for 1 hour, then discard the liquid and gently wash three times (200 µL of washing buffer each time). Add 100 µL of mouse serum samples (eight gradients of 1:1000 and 1:2000, 2-fold dilution) to each well. Incubate at room temperature for 1 hour to allow the antibodies in the serum to bind to the coated antigen. After removing the serum samples, wash three times with PBS containing 0.05% Tween-20, 200 µL each time, to ensure the removal of nonspecific binders. Select a suitable secondary antibody (such as HRP-labeled anti-human IgM secondary antibody). Dilute the secondary antibody 1:3000 and add 100 µL to each well. Incubate at 37°C for 30 min. After removing the secondary antibody, wash three times with PBS containing 0.05% Tween-20, 200 µL each time. Add TMB substrate solution (100 µL / well) and incubate in the dark for 10–30 minutes until color development. Stop the reaction by terminating with 2 M sulfuric acid (100 µL / well). Read the absorbance (OD value) of each well at 450 nm using an ELISA reader.

[0077] Experimental results: The results showed that mice could produce high titers of antigen-specific human IgM antibodies ( Figure 12 ).

[0078] (2) Neutralization effect of pseudovirus in serum of HA-immunized mice The specific method is as follows: Mix 80 μL of serum-free DMEM medium with 20 μL of pseudovirus, add to a 96-well plate, and set up 3 replicates. Use pseudovirus at a dilution of 1:1000, and mouse serum at dilutions of 1:300 and 1:3000. After trypsin digestion of cells, terminate digestion with complete culture medium, count the number of cells, and adjust the cell concentration to 3 × 10⁻⁶. 5 The concentration was increased to 100 μL / well in a 96-well plate, resulting in 3 × 10⁶ cells / mL per well. 4100 cells, total volume 200 μL. Add 200 μL of sterile water for injection to the wells surrounding the cells for liquid sealing, and incubate the 96-well plate at 37°C for 36 to 48 hours. After incubation, remove the 96-well plate, discard 100 μL of liquid from each well, add 100 μL of luciferase substrate, and incubate in the dark for 3 minutes. Gently pipette 2 to 3 times, transfer 150 μL of the reaction mixture to a 96-well plate, and detect the fluorescence signal of the virus-infected target cells using a fluorescence microplate reader to obtain the relative fluorescence intensity (RLI).

[0079] Experimental results: The results showed that the serum of IGHV1-69 and IGHV3-23 transgenic mice immunized with the antigen contained antibodies with neutralizing activity against H5N1 pseudovirus. Figure 13 ).

Claims

1. A gene construct for constructing a non-human animal integrating a dual-human VH subclass fusion gene, characterized in that, The gene construct contains the following DNA fragments in 5' to 3' order: Human IGHV1-69 fragment: nucleotide sequence as shown in SEQ ID NO:1; Human IGHV3-23 fragment: nucleotide sequence as shown in SEQ ID NO:2; First spacer segment: containing IGHD6-13 and IGHD1-14 elements, the nucleotide sequence of which is shown in SEQ ID NO:3; The second spacer segment contains the IGHD2-15 element, and its nucleotide sequence is shown in SEQ ID NO:

4. Functional element fragment: Contains IGHJ1 to IGHJ6 elements, intron enhancer (iEμ), class switching region switch (Sμ) region and IGC mu constant region, nucleotide sequence as shown in SEQ ID NO:5; 3' enhancer fragment: nucleotide sequence as shown in SEQ ID NO:6; Each of the DNA fragments was assembled by homologous recombination.

2. A combination of sgRNAs for constructing non-human animals integrating dual human VH subclass fusion genes, characterized in that, The sgRNA pair includes sgRNA pairs that target the JH region of the non-human heavy chain IgH and sgRNA pairs that target the JK and CK regions of the non-human light chain IgK. Of the sgRNA pair targeting the JH region of non-human heavy chain IgH, the nucleotide sequence of sgRNA1 is shown in SEQ ID NO:7, and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO:

8. Of the sgRNA pairs targeting the JK and CK regions of the non-human animal light chain IgK, the nucleotide sequence of sgRNA1 is shown in SEQ ID NO:9, and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO:

10. Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep.

3. A primer combination for identifying endogenous heavy chain and kappa light chain knockout in non-human animals, characterized in that, The primer set includes the non-human animal heavy chain JH deletion primer set and the non-human animal kappa light chain JK / CK deletion primer set; The non-human animal heavy chain JH deletion primer set includes: Mouse Igh-F: Nucleotide sequence is shown in SEQ ID NO:11; Mouse Igh-R: Nucleotide sequence as shown in SEQ ID NO:12; Mouse Igh-He / Wt-F: Nucleotide sequence is shown in SEQ ID NO:13; The non-human animal kappa light chain JK / CK deletion primer set includes: Mouse Igk-F: Nucleotide sequence is shown in SEQ ID NO:14; Mouse Igk-R: Nucleotide sequence is shown in SEQ ID NO:15; Mouse Igk-He / Wt-F: Nucleotide sequence is shown in SEQ ID NO:16; Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep.

4. A primer combination for identifying transgenic non-human animals containing human IGHV1-69 and IGHV3-23, characterized in that, The primer combination includes a front-end identification primer pair and a back-end identification primer pair; The front-end identification primer pair includes: Transgene PCR primer F1: Nucleotide sequence as shown in SEQ ID NO:19; Transgene PCR primer R1: Nucleotide sequence as shown in SEQ ID NO:20; The subsequent identification primer pair includes: Transgene PCR primer F2: Nucleotide sequence as shown in SEQ ID NO:21; Transgene PCR primer R2: Nucleotide sequence as shown in SEQ ID NO:22; Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep.

5. A non-human animal with endogenous heavy chain and kappa light chain knockout, characterized in that, The non-human animals were obtained by deleting the JH region of the endogenous heavy chain IgH and the JK and CK regions of the light chain IgK using CRISPR / Cas9 technology. The deleted sequence of the JH region of the non-human animal heavy chain IgH is shown in SEQ ID NO:17, and the deleted sequence of the JK and CK regions of the light chain IgK is shown in SEQ ID NO:

18. Optionally, by PCR identification using the primer combination described in claim 3, the non-human animal is confirmed to have homozygous knockout of the heavy chain and homozygous knockout of the kappa light chain, and no endogenous antibody expression. Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep; Optionally, the non-human animal is a C57BL / 6J mouse.

6. A non-human animal integrating a dual-human VH subclass fusion gene, characterized in that, The non-human animals mentioned are transgenic non-human animals with both IGHV1-69 and IGHV3-23 genes; The non-human animal is obtained by injecting the gene construct of claim 1 into the fertilized egg of a non-human animal with endogenous heavy chain and kappa light chain knockout as described in claim 5 via embryo microinjection. PCR identification using the primer combination described in claim 4 confirmed that the human IGHV1-69 and IGHV3-23 genes were successfully integrated into the genome of the non-human animal. Optionally, the non-human animal can express human IgM antibodies, and after immunization with H5N1 HA, the frequency of IgHV1-69 in B cells BCR increases significantly, and high-titer antigen-specific human IgM antibodies can be produced, and the serum has H5N1 pseudovirus neutralizing activity. Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep; Optionally, the non-human animal is a C57BL / 6J mouse.

7. A method for constructing a non-human animal integrating a dual-human VH subclass fusion gene, characterized in that, The non-human animals mentioned are transgenic non-human animals with both IGHV1-69 and IGHV3-23 genes; The method includes the following steps: S1: Construct the gene construct according to claim 1; S2: Using the sgRNA combination described in claim 2, non-human animals with endogenous heavy chain and kappa light chain knockout as described in claim 5 were prepared by CRISPR / Cas9 technology; S3: The gene construct constructed in step S1 is injected into the fertilized eggs of non-human animals with endogenous heavy chain and kappa light chain knockout obtained in step S2 via embryo microinjection. After culturing, the construct is transplanted into the oviduct dilatation of pseudopregnant ICR non-human animals. After birth, PCR identification is performed using the primer combination described in claim 4 to screen for positive transgenic non-human animals, namely transgenic non-human animals with IGHV1-69 and IGHV3-23 dual genes. Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep; Optionally, the non-human animal is a C57BL / 6J mouse.

8. The construction method according to claim 7, characterized in that, The specific process for preparing C57BL / 6J mice with knockout of endogenous heavy chain and kappa light chain in step S2 includes: S21: Select C57 / 6J female mice, inject 5 IU / mouse PMSG intraperitoneally, and inject HCG 48 h later. The next day, the oviducts of the mice with plugs were removed, and fertilized eggs were obtained in hyaluronidase. They were cultured in M16 medium containing paraffin oil at 37℃ and 5% CO2. S22: Mix sgRNA with Cas9 protein to prepare RNP complex, centrifuge to remove impurities, dissolve in buffer and place on ice; S23: Inject the RNP complex into the pronucleus of the fertilized egg. The pronucleus expands, indicating successful injection. The embryo is then cultured for another half hour before being transferred. S24: The successfully injected embryos are transferred to the oviduct dilatation of pseudopregnant ICR mice. After the mice are born, PCR identification and Sanger sequencing are performed using the primer combination described in claim 3 to screen for mice with homozygous knockout of heavy chain and kappa light chain.

9. The construction method according to claim 7, characterized in that, Step S3, following embryo microinjection, also includes a verification step for positive transgenic mice: blood is collected from the tail vein, and the expression of human IgM in the serum is detected using a human IgM detection kit; mice are immunized with H5N1 HA, and the frequency of VH, DH, JH usage and CDRH3 abundance are analyzed by Bulk BCR sequencing; serum antibody titer is detected by ELISA; and serum neutralizing activity is detected by a pseudovirus neutralization experiment.

10. Applied to any of the following aspects: (1) The application of the non-human animals integrating the dual human VH subclass fusion gene as described in claim 6 in the screening of influenza virus broad-spectrum neutralizing antibodies (bnAbs), in vivo evaluation of influenza vaccines, or development of influenza antibody drugs; (2) The application of the non-human animals integrating the dual human VH subclass fusion gene as described in claim 6 in screening for broad-spectrum neutralizing antibodies against coronaviruses or other respiratory viruses, in vivo evaluation of vaccines, or antibody drug development; Optionally, the coronavirus includes MERS, SARS-CoV, or SARS-CoV-2; Optionally, the other respiratory viruses include respiratory syncytial virus, measles virus, mumps virus, human metapneumovirus, or bocavirus; Optionally, the non-human animal is a non-human mammal; Optionally, the non-human mammal is a mouse, rat, guinea pig, hamster, monkey, rabbit, cow, horse, pig, or sheep; Optionally, the non-human animal is a C57BL / 6J mouse.

Images