Breeding method of sterile grass carp strain

By designing a gene targeting the dnd gene in grass carp and using the CRISPR/Cas9 system for gene editing, a sterile grass carp strain was successfully bred, solving the problem of fertility control in grass carp and improving the efficiency and ecological sustainability of grass carp farming.

CN121653192APending Publication Date: 2026-03-13SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-16
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Currently, there are no reports of using the dnd gene to develop sterile strains in grass carp, making it difficult to control fertility in grass carp through gene editing technology.

Method used

We designed a target site for the grass carp dnd gene and synthesized the corresponding gRNA. We used the CRISPR/Cas9 system to edit the grass carp embryos and injected a mixture of Cas9 protein and gRNA to knock out the dnd gene, thus cultivating a sterile grass carp strain.

Benefits of technology

The dnd gene of grass carp was efficiently edited, with an efficiency of 80%, resulting in a sterile grass carp strain with controlled gonadal development, faster growth rate, larger size, and better meat quality, thus reducing the risk of uncontrolled population density during the aquaculture process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121653192A_ABST
    Figure CN121653192A_ABST
Patent Text Reader

Abstract

The invention discloses a breeding method of a sterile grass carp strain. The breeding method comprises the following steps: (1) designing a target site for knocking out a grass carp dnd gene and synthesizing gRNA corresponding to the target site; (2) mixing Cas9 protein and gRNA to obtain a mixed solution, and injecting the mixed solution into a grass carp embryo; and then, culturing grass carp embryos, and feeding the hatched grass carps to obtain the sterile grass carp strain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of aquatic animal genetic breeding and functional gene utilization technology, specifically relating to a breeding method for a sterile grass carp strain. Background Technology

[0002] Aquatic products are an important source of animal protein for humans. Grass carp ( Ctenopharyngodon Idella Grass carp is the most produced aquaculture fish in my country. Grass carp farming has spurred a vast industrial chain, encompassing seedling breeding, feed production, animal health products, aquaculture facilities, processing, distribution, and catering.

[0003] Seed industry is the "source" of aquaculture development. Strengthening research on grass carp genetic breeding is a core task in promoting the healthy, green, and high-quality development of grass carp farming. Developing fertility-controllable aquaculture species is an important research direction in aquaculture. Sterile fish can redirect energy from gonadal development to individual growth, typically exhibiting faster growth rates, larger individuals, and superior meat quality, thus improving overall aquaculture efficiency. Simultaneously, there is no need to worry about uncontrolled population density caused by reproduction during the farming process, reducing the risk of damage to the aquatic ecosystem.

[0004] CRISPR / Cas9 gene editing technology uses targeted guide RNA (gRNA) to guide the Cas9 protease to specifically cleave target DNA sequences, leading to alterations in gene function and trait improvement. This technology is simple to operate and has been successfully applied in various fish species, including grass carp. Dead end (dnd) proteins are crucial for the migration, survival, and maintenance of primordial germ cells in fish. However, currently, there is limited information regarding the utilization of dead end proteins in grass carp. dnd There have been no reports of genetically engineered sterile strains. Summary of the Invention

[0005] The purpose of this invention is to provide a breeding method for a sterile grass carp strain. This method uses grass carp... dnd Based on gene and gene editing technologies, new genetically improved strains of grass carp can be provided for aquaculture.

[0006] The above-mentioned objective of this invention can be achieved through the following technical solution: a breeding method for a sterile grass carp strain, comprising the following steps:

[0007] (1) Design to knock down grass carp dnd The target site of the gene, and the gRNA corresponding to the target site;

[0008] (2) Mix Cas9 protein and gRNA to obtain a mixture, and inject it into grass carp embryos; then, cultivate grass carp embryos and raise the hatched grass carp to obtain a sterile grass carp strain.

[0009] The grass carpdnd The nucleotide sequence of the gene's target site is shown in SEQ ID NO:1, specifically GATCCCACGTGATGTCTACG.

[0010] Specifically, in step (1), the gRNA corresponding to the target site is synthesized using conventional chemical synthesis methods. More specifically, the target site sequence is combined with the Scaffold sequence common to gRNAs in the CRISPR system to synthesize the gRNA.

[0011] Preferably, in the mixture, the final concentration of Cas9 protein is 500 ng / uL Cas9, and the final concentration of gRNA is 200 ng / uL.

[0012] Preferably, after mixing Cas9 protein and gRNA, the mixture is left to stand at room temperature for 15 minutes to allow RNP formation, and then injected into grass carp embryos.

[0013] Preferably, in step (2), each grass carp embryo is injected with 2 nL of the mixture; that is, each grass carp embryo is injected with 1000 pg Cas9 protein and 400 pg gRNA.

[0014] Compared with the prior art, the present invention has the following advantages:

[0015] (1) This invention is the first to be used in grass carp. dnd Gene editing efficiency reached 80%, resulting in grass carp embryos with high gene editing efficiency;

[0016] (2) This invention involves editing functional genes. dnd This effectively controls the gonadal development of grass carp, resulting in sterile grass carp strains. Attached Figure Description

[0017] Figure 1 Grass carp in Example 1 dnd Location of gene editing;

[0018] Figure 2 Sanger sequencing of sequences near the target site in Example 1; the target site sequence is marked with a blue box;

[0019] Figure 3 Sequencing results of unedited grass carp embryos and dnd Sequencing results of gene-edited grass carp embryos;

[0020] Figure 4 For those who did not undergo gene editing and dnd Histological section of the gonads of a 6-month-old grass carp after gene knockout. Detailed Implementation

[0021] The technical solution of the present invention will be described in detail below with reference to specific embodiments, so that those skilled in the art can better understand and implement the technical solution of the present invention. Unless otherwise specified, the reagents or materials used in the embodiments are all from commercial sources. The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0022] Example 1

[0023] The method for preparing sterile grass carp in this embodiment includes the following steps:

[0024] (1) Analysis of grass carp dnd Genetic design and CRISPR-based knockout of grass carp dnd Gene target sites

[0025] Grass carp was obtained through a search on NCBI. dnd The gene (Gene ID: 127494684), 6990 bp in length, contains 4 exons and 3 introns, translating into the 376-amino acid Dnd protein. Analysis of the conserved domains of the Dnd protein sequence using the NCBI tool CD-Search revealed three conserved domains: the two main domains, PRM1 and hn→RNP-RQ, located at amino acid positions 54-130 and 17-211, respectively.

[0026] Based on the above results, target sites were designed on genomic sequences near the N-terminus of the major domain of the Dnd protein, and ultimately... dnd A target site was designed on the third exon of the gene, with the nucleotide sequence shown in SEQ ID NO:1: GATCCCACGTGATGTCTACG, and the PAM region sequence is AGG. The cleavage site targeted by this gRNA is located at tyrosine residue 66 of the Dnd protein (e.g., ...). Figure 1 (As shown).

[0027] (2) PCR was used to verify the sequence conservation near the target site in the grass carp genome.

[0028] PCR primers were designed approximately 200 bp upstream and downstream of the target site. DNA was extracted from the fins of all grass carp broodstock used in the experiment. After PCR amplification using the primers below, Sanger sequencing was performed to check the sequence conservation (i.e., integrity) near the target site.

[0029] Verification of the grass carp genome dnd The PCR primers used for gene conservation include:

[0030] dnd-Conservative validation-F is shown in SEQ ID NO:2: CTGCGAACCGTCAGACAAAC;

[0031] The dnd-Conservative validation-R is shown in SEQ ID NO:3: AGGATTGATGCATAACCTTGGG.

[0032] The PCR annealing temperature was set to 59.7℃, and the PCR amplification product was 427 bp in length.

[0033] Sanger sequencing was performed using dnd-Conservative validation-R primers to verify the conservation of sequences near the target site. The sequencing results are as follows: Figure 2 The target site sequence is marked with a blue box, and the nearby sequencing peaks are all single, indicating good conservation.

[0034] (3) Preparation of knockout grass carp dnd gRNA of genes

[0035] The above design will eliminate grass carp dnd The target site sequence of the gene and the 80 nt Scaffold sequence commonly used in CRISPR system gRNA (its sequence is shown in SEQ ID NO:4, GTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT) were submitted to Nanjing Genscript Biotech Co., Ltd. for chemical synthesis of gRNA. Specifically, the target site sequence was located at the 5' end, and the 80 nt Scaffold sequence was appended to the 3' end of the target site sequence (as shown in SEQ ID NO:5). Thio and methoxy modifications were added at 3 bases at both the 5' and 3' ends of the sequence (using conventional modification methods). The final synthesized gRNA sequence is as follows:

[0036] mG*mA*mU*rCrCrCrArCrGrUrGrArUrGrUrCrUrArCrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArU rArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU.

[0037] The amount of gRNA synthesized was 48 μg, delivered as a dry powder. Upon receipt, the dry powder was centrifuged at 12000 rpm for 1 minute, and then 120 μL of nuclease-free water was added to dilute the gRNA to a concentration of 400 ng / μL. After adding the nuclease-free water, the mixture was allowed to stand for 3 minutes, during which time the tube was vortexed for 10 seconds every 30 seconds to ensure complete dissolution of the gRNA. Subsequently, the gRNA was aliquoted into PCR tubes, with 5 μL in each tube for subsequent use.

[0038] (4) Artificial breeding of grass carp

[0039] For selectively mature male and female grass carp broodstock, the female was first injected with luteinizing hormone-releasing hormone analogue (LRH-A) at a dose of 10-20 μg / kg. Twelve hours later, the male and female were injected with LRH-A and domperidone (DOM) at doses of 10-20 μg / kg and 3-5 mg / kg, respectively. Six to eight hours after the second injection, artificial insemination and egg extraction began, with sperm and eggs mixed at a ratio of 1 mL of sperm to 100 mL of eggs for artificial insemination.

[0040] (5) Microinjection of grass carp embryos dnd Gene knockout

[0041] 1000 ng / μL of Cas9 protein (Invitrogen TrueCut Cas9 Protein v2) and the above-prepared 400 ng / μL gRNA were mixed at a volume ratio of 1:1 to make the final concentration of the mixture 500 ng / μL Cas9:200 ng / μL gRNA. After mixing, the mixture was left to stand at room temperature for 15 minutes to allow RNP formation. Then, grass carp embryos were injected with 2 nL of Cas9 per embryo and 1000 pg Cas9 + 400 pg gRNA per embryo.

[0042] (6) Verify the efficiency of target editing and successful screening. dnd Gene knockout grass carp

[0043] Two days after injection, grass carp embryos hatched. Ten uninjected wild-type juveniles and ten juveniles injected with Cas9 protein + gRNA were used for DNA extraction. DNA was then designed near the target site. dnd Primers for gene editing efficiency were used to amplify the extracted DNA by PCR, and Sanger sequencing was used to verify the effectiveness of target gene editing.

[0044] dnd Primers for gene editing efficiency testing include:

[0045] dnd-seq-F is shown in SEQ ID NO:6: ACCTCTCTCCCTTTAGGCCC

[0046] dnd-seq-R is shown in SEQ ID NO:7: CCCTATTCACTTTTGTTTTTGCAGC

[0047] Annealing temperature was 60℃, amplification length was 471 bp, and Sanger sequencing was performed using dnd-seq-F primers to analyze gene editing efficiency. Figure 3 As can be seen, juvenile fish injected with Cas9 protein and gRNA produced indels (deletions), and the levels were measured. dnd The gene editing efficiency reached 80%, proving the effectiveness of the target site.

[0048] (7) Analysis of grass carp gonadal development

[0049] Grass carp juveniles were reared after injection. After 6 months of rearing, gonadal tissue was isolated, fixed in Born's solution for 24 hours, dehydrated in 70%, 80%, 90%, and 100% alcohol, cleared in xylene, and embedded in paraffin. The gonadal development of grass carp was observed under a light microscope by histological sections and hematoxylin-eosin staining.

[0050] Select 6 tails dnd Genetically edited grass carp gonads were observed, and two of them lacked germ cells (e.g., Figure 4 As shown), this invention relates to... dnd Gene editing can produce sterile grass carp.

[0051] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.

Claims

1. A breeding method for a sterile grass carp strain, characterized in that, Includes the following steps: (1) Design to knock down grass carp dnd The target site of the gene, and the gRNA corresponding to the target site; (2) Mix Cas9 protein and gRNA to obtain a mixture, and inject it into grass carp embryos; then, cultivate grass carp embryos and raise the hatched grass carp to obtain a sterile grass carp strain.

2. The breeding method for the sterile grass carp strain according to claim 1, characterized in that, The grass carp dnd The nucleotide sequence of the gene's target site is shown in SEQ ID NO:

1.

3. The breeding method for the sterile grass carp strain according to claim 2, characterized in that, In the mixture, the final concentration of Cas9 protein was 500 ng / uL and the final concentration of gRNA was 200 ng / uL.

4. The breeding method for sterile grass carp strains according to claim 3, characterized in that, After mixing Cas9 protein and gRNA, the mixture was left to stand at room temperature for 15 minutes to allow RNP formation, and then injected into grass carp embryos.

5. The breeding method for the sterile grass carp strain according to claim 4, characterized in that, In step (2), each grass carp embryo is injected with 2 nL of the mixture.