Molecular marker related to perineal fat deposition character of Hu sheep and application of molecular marker in breeding
By amplifying the H17 gene of Hu sheep DNA and detecting the polymorphism at the 169bp site, Hu sheep carrying the TT genotype were screened, which solved the problem of excessive perirenal fat deposition in Hu sheep, and achieved an increase in lean meat percentage and economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-03-13
AI Technical Summary
Excessive perirenal fat deposition in Hu sheep affects lean meat percentage and market competitiveness, and current technologies have failed to effectively control this trait.
By amplifying the H17 gene of Hu sheep DNA and detecting the polymorphism at the 169bp site, Hu sheep carrying the TT genotype were screened out and bred as a low perirenal fat type. Genotype identification was performed using PCR primer pairs and KASPAR primer pairs, and a molecular marker detection method was established.
It effectively reduces perirenal fat deposition in Hu sheep, increases lean meat percentage, improves the quality and economic benefits of Hu sheep, and achieves efficient resource utilization.
Smart Images

Figure FT_1 
Figure FT_2 
Figure SMS_1
Abstract
Description
Technical Field
[0001] This invention belongs to the technical field of molecular markers, specifically relating to DNAH17 Gene fragments as molecular markers influencing perirenal fat deposition traits in Hu sheep and their application in Hu sheep breeding. Background Technology
[0002] The Hu sheep is a renowned and superior local breed in the Taihu Lake basin, holding an important position in animal husbandry due to its early sexual maturity, high reproductive capacity, and tolerance to roughage. However, with the increasing market demands for lean meat percentage and carcass quality, excessive fat deposition in Hu sheep, particularly the excessive deposition of perirenal fat, has become a prominent problem restricting the development of its industry. Excessive perirenal fat production means that a large amount of valuable dietary energy is converted into low-value byproducts instead of being used for muscle growth. This not only directly reduces feed conversion ratio and slaughter rate but also affects market competitiveness because it does not conform to modern consumers' preferences for healthy, lean mutton. Therefore, exploring effective strategies to regulate and appropriately reduce perirenal fat deposition in Hu sheep is an urgent need for achieving efficient resource utilization and sustainable industrial development.
[0003] Research reports the discovery of new genes associated with human adipogenesis and fat storage, among which... DNAH17 The axonal dynamin transcript is significantly expressed in (pre)adipocytes (J. Söhle, N. Machuy, E. Smailbegovic, U. Holtzmann, E. Grönniger, H. Wenck, F. Stäb, M. Winnefeld, Identification of new genes involved in human adipogenesis and fat storage, PloS one, 7 (2012)e31193). However, functional studies of this gene in Hu sheep remain lacking, particularly regarding its association with perirenal fat deposition. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a molecular marker associated with perirenal fat deposition traits in Hu sheep and its application.
[0005] The molecular markers of this invention are derived from lake sheep. DNAH17 The gene was amplified, and its specific nucleotide sequence is shown in SEQ ID NO. 1. This was achieved by amplifying the gene from the Hu sheep. DNAH17 The DNA sequence of the gene is sequenced and used to search for... DNAH17By analyzing the polymorphic sites of genes and the correlation between different genotypes and perirenal fat deposition traits in Hu sheep, a detection method for molecular markers containing polymorphic sites was established, and these molecular markers can be applied to the breeding of Hu sheep breeds with low perirenal fat.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: The application of a reagent for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep in breeding, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the Y at position 169 bp represents C or T, and due to an A / T mutation at position 169 of the above sequence, this leads to the Hu sheep... DNAH17 The A / T polymorphism of the gene at this locus; the perirenal fat weight of Hu sheep carrying the TT genotype is significantly lower than that of Hu sheep carrying the TC genotype, and lower than that of Hu sheep carrying the CC genotype. The purpose of breeding is to screen for Hu sheep with low perirenal fat.
[0007] The primer pair used to detect the molecular markers associated with perirenal fat deposition traits in Hu sheep is used in Hu sheep breeding. The primer pair includes a forward primer F and a reverse primer R, and the nucleotide sequences of the forward primer F and the reverse primer R are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0008] The application of KASPAR primer pairs for detecting the molecular markers associated with perirenal fat deposition traits in Hu sheep in Hu sheep breeding, wherein the KASPAR primer pairs include primers with nucleotide sequences as shown in SEQ ID NO.4-6.
[0009] The application of a kit for detecting the molecular markers associated with perirenal fat deposition traits in Hu sheep breeding, wherein the kit contains PCR primer pairs or KASPAR primer pairs for detecting the aforementioned molecular markers.
[0010] The application of methods for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep in breeding, specifically including the following steps: S1. Amplify the genomic DNA of Hu sheep using PCR primer pairs with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3, KASPAR primer pairs with nucleotide sequences as shown in SEQ ID NO.4-6, or kits containing the above primer pairs; S2. The polymorphic site at position 169 of the amplification product obtained in step S1 was identified. The perirenal fat weight of the Hu sheep carrying the TT genotype was significantly lower than that of the Hu sheep carrying the TC genotype, and lower than that of the Hu sheep carrying the CC genotype. The purpose of the breeding was to screen for Hu sheep with low perirenal fat.
[0011] In step S2, the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, fluorescent probe, gene chip, and high-resolution melting curve methods.
[0012] The method for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep using the above primer pairs includes the following steps: a) Genomic DNA was extracted from the blood of Hu sheep and amplified using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; b) After amplification, fluorescence signals were detected and genotyping results were viewed using a BMG PHERAstarCycler instrument.
[0013] The above-described detection method is applied to the breeding of Hu sheep, where the breeding aims to select Hu sheep breeds with low perirenal fat deposition. If the genotype of the sample to be tested is TT, then sheep with this genotype are of the low perirenal fat deposition type. Hu sheep carrying the TC genotype have significantly higher perirenal fat weight than Hu sheep carrying the TT genotype, and sheep with the TC genotype can be excluded during breeding.
[0014] The above-described reagents, primer pairs, kits, or methods for detecting molecular markers associated with perirenal fat deposition in Hu sheep can be used in the screening of Hu sheep with low perirenal fat deposition. By detecting the molecular markers of the present invention in the genomic DNA of the Hu sheep to be tested and analyzing the types of polymorphic sites, the level of perirenal fat in Hu sheep can be determined. Hu sheep carrying the TT genotype have significantly lower perirenal fat weight than Hu sheep carrying the TC genotype, and lower than Hu sheep carrying the CC genotype. Hu sheep carrying the TT genotype are Hu sheep with low perirenal fat deposition.
[0015] This invention, through PCR amplification and sequencing of the H17 DNA gene of Hu sheep, discovered a C / T polymorphism site at position 169 of the amplified fragment shown in SEQ ID NO. 1. By detecting polymorphisms in 304 Hu sheep and establishing a least-squares model, a molecular marker associated with perirenal fat deposition traits in Hu sheep was identified. This molecular marker can be used for screening and breeding Hu sheep with low tail fat deposition traits, providing an effective genetic engineering method for the genetic improvement of perirenal fat deposition traits in Hu sheep, and has significant practical application value.
[0016] The beneficial effects of this invention are as follows: This invention provides the application of molecular markers related to perirenal fat deposition traits in Hu sheep breeding. The nucleotide sequence of the molecular markers is shown in SEQ ID NO.1, where Y at position 169 bp represents C or T. Hu sheep carrying the TT genotype have significantly lower perirenal fat weight than those carrying the TC genotype. Hu sheep carrying the TT genotype are low perirenal fat, and homozygous TT genotype Hu sheep can be selected as breeding stock. This reduces perirenal fat deposition, improves the quality of Hu sheep, and helps improve the economic benefits of the sheep farming industry.
[0017] This invention also establishes a detection method for molecular markers associated with perirenal fat deposition traits in Hu sheep. By detecting the genotype of polymorphic sites, it can effectively identify whether a Hu sheep has low perirenal fat deposition, providing an effective detection method for screening Hu sheep with low perirenal fat deposition. Attached Figure Description
[0018] Figure 1 The lake sheep in Example 1 DNAH17 Sequencing results of the C>T mutation site in gene g. 9494469.
[0019] Figure 2 For the lake sheep in Example 2 DNAH17 KASPar SNP typing results for the gene g. 9494469 C > T mutation site. Detailed Implementation
[0020] This invention analyzes the Hu sheep DNAH17 The relationship between single nucleotide polymorphisms (SNPs) of genes and perirenal fat deposition traits was investigated. Furthermore, [the study also examined...] DNAH17 The expression levels of the gene in different genotypes of Hu sheep. This invention provides a molecular marker with practical application value for screening for low perirenal fat deposition in Hu sheep breeding.
[0021] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.
[0022] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this invention are of analytical grade or higher and can be commercially available products. Example 1: Amplification of the DNAH17 gene
[0023] Lake sheep DNAH17 Using the genetic DNA (GenBank accession number: NC_056064.1) as a template, a pair of primers was designed using Oligo 7.0 software: The primer pair sequences are as follows: Forward primer F (SEQ ID NO.2): 5'-CGTTCAGGTCTCCTTTGGCAT-3' Reverse primer R (SEQ ID NO.3): 5'-ATCGAGTTCAAGTGCATCCTC-3' (2) DNAH17 Gene amplification and sequencing Blood was collected from Hu sheep for genomic DNA extraction using a genomic DNA extraction kit. The extracted DNA was then used as a template for PCR amplification. The total PCR reaction volume was 25 μL, including 1 μL of DNA template, 12.4 μL of 2×PCR Master Mix, 0.8 μL of forward primer F (10 μmol / L), 0.8 μL of reverse primer R (10 μmol / L), and 10 μL of ddH2O. The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 54.5℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles, followed by a final extension at 72℃ for 10 min.
[0024] The amplified PCR fragment was sequenced, and the sequencing results showed a 169 bp amplified fragment with the nucleotide sequence shown in SEQ ID NO.1. This fragment contains a polymorphic site, specifically at the 169 bp position where Y is either C or T, indicating that the amplified PCR fragment is a PCR fragment. DNAH17 The gene fragment (SEQ ID NO.1) exhibits a C / T polymorphism at position 169 bp (see [link]). Figure 1 ).
[0025] Among them, SEQ ID NO.1: CGTTCAGGTCTCCTTTGGCATATGGAACCGAGGGAATGTCTCTTAAATGTGAGACAGAGCAATGGAAAGGGCGGGCACCAGATTGGCCCTTACCTTGGGGTTGGCCTCCAGGTAGTTGTAGAGCACG TTGATGGAGATGGTGAGGTCCCCGTTGTTGAAGGGGGTACGAYCGGTTCCAGCCCTGGGCCCCGAACTTGCGCCTCTCGGCCACCACGGCGTGGAAGTAGCACAGGGCGAAGAGGATGCACTTGAACTCGAT.
[0026] DNA sequence homology retrieval and identification: The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained was similar to that of the Hu sheep. DNAH17 The partial sequence homology of the gene DNA (GenBank accession number: NC_056064.1) reached 99%. Example 2: Establishment of a Genotyping Detection Method
[0027] 1. Primer sequence design KASPar primer pairs were designed to target the C / T polymorphic site in the amplified fragment shown in SEQ ID NO.1 of Example 1 for the specific detection of this polymorphic site. The nucleotide sequence of the optimized KASPar primer pairs is as follows: Forward primer A1 used to detect AlleleT is as follows: SEQ ID NO.4: GAAGGTGACCAAGTTCATGCTCCGTTGTTGAAGGGGTACGAT; Forward primer A2 used to detect AlleleC is as follows: SEQ ID NO.5: GAAGGTCGGAGTCAACGGATTCCGTTGTTGAAGGGGTACGAC; The universal reverse primer C is shown in SEQ ID NO.6: GAGTTCAAGTGCATCCTCTTCGC.
[0028] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd., and each primer pair in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 for forward primer A1: forward primer A2: universal reverse primer C.
[0029] 2. Quality control of extracted genomic DNA. Genomic DNA was extracted from whole blood of Hu sheep using a DNA extraction kit. The extracted genomic DNA was then tested for quality using 1% agarose gel electrophoresis and Nanodrop 2100. The acceptable DNA requirements were: (1) Agarose gel electrophoresis showed a single DNA band without significant diffusion; (2) Nanodrop 2100 showed A260 / 280 between 1.8 and 2.0, A260 / 230 between 1.8 and 2.0, and no significant light absorption at 270 nm. Unacceptable DNA required re-extraction and testing. Based on the KASPar detection technology from LGC (UK) and the conversion of genome size, the required DNA volume was calculated to be 10-20 ng / sample. The extracted genomic DNA was diluted to a concentration of 10-20 ng / μL as a DNA template.
[0030] 3. Perform genotyping testing First, using a K-pette dispensing workstation, 1.5 μL of diluted DNA template (10-20 ng / μL) and a blank control (No template control, NTC, sterile water) were added to 384-well reaction plates, respectively. The plates were then dried at 60°C for 30 min (drying oven, LGC). The DNA was then dried into powder for later use. Each primer in the above KASPar primer pair was diluted to 10 μmol / L and mixed with a volume ratio of forward primer A1: forward primer A2: universal reverse primer C of 12:12:30 to prepare the primer mixture for later use.
[0031] Then, using the Meridian loading station under the Kraken operating system, 1×Master mix (1536 microplate, Part No. KBS-1016-011) and primer mixture were added to each reaction well. After mixing, the microplates were immediately sealed using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using the Hydrocycler high-throughput water bath system. The specific procedure was as follows: Pre-denaturation at 94℃ for 10 min; 94℃, 20s (denaturation) — 61℃-55℃, 1min (annealing & extension), amplified in touch-down sequence for 10 cycles, decreasing the temperature by 0.6℃ per cycle; 94℃, 20s (denaturation) — 55℃, 60s, continue amplification for 26 cycles.
[0032] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Results for some samples are shown below. Figure 2As shown in the figure, each dot represents a sample to be tested. Orange circles indicate that the locus is homozygous genotype TT; green triangles in the middle indicate that the locus is heterozygous genotype TC; and blue squares indicate that the locus is homozygous genotype CC.
[0033] 4. Application of the molecular markers of the present invention in the association analysis of perirenal fat deposition traits in Hu sheep The experiment examined the polymorphism of 304 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and perirenal fat deposition traits.
[0034] Y ijk =μ+ Genotype i + P j +S k +ε ijk Among them, Y ijk These are observed values for perirenal fat deposition traits, where μ is the population mean and Genotype. i For genotype effect, P j Due to the batch effect, S k Due to seasonal effects, ε ijk Assuming random error, let ε ijk They are independent of each other and follow an N(0, σ2) distribution.
[0035] Genotyping results showed that among the 304 individuals, 75 had the CC genotype, 194 had the TC genotype, and 35 had the TT genotype. The results of the genotype-trait association analysis are shown in Table 1, where relative perirenal fat weight represents the ratio of perirenal fat weight to carcass weight.
[0036] Table 1. Hu sheep DNAH17 Association analysis between gene polymorphism and perirenal fat deposition trait
[0037] Note: All data in the table are mean ± standard error. Different superscript letters between data in the same column indicate significant differences. P < 0.05), with the same letter indicating no significant difference ( P > 0.05) The results showed that DNAH17 The C>T mutation site in gene g. 9494469, located at position 169 bp as shown in SEQ ID NO. 1, is significantly associated with perirenal fat deposition in Hu sheep; the perirenal fat weight of Hu sheep carrying the TT genotype is significantly lower than that of Hu sheep carrying the TC genotype. P<0.05), lower than that of Hu sheep carrying the CC genotype. Perirenal fat deposition requires higher energy and feed costs. Therefore, during breeding, Hu sheep with the TT genotype can be retained to reduce perirenal fat deposition during growth, resulting in a superior flock with less perirenal fat deposition, thereby saving economic costs and improving the economic benefits of breeding.
Claims
1. The application of a reagent for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep in breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where the Y at position 169 bp represents C or T. Because there is an A / T mutation at position 169 of the above sequence, it leads to the presence of the Hu sheep. DNAH17 The A / T polymorphism of the gene at this locus; the perirenal fat weight of Hu sheep carrying the TT genotype is significantly lower than that of Hu sheep carrying the TC genotype, and lower than that of Hu sheep carrying the CC genotype. The purpose of breeding is to screen for Hu sheep with low perirenal fat.
2. The application of primer pairs for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep breeding, characterized in that, The primer pair includes a forward primer F and a reverse primer R, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.
3.
3. The application of KASPAR primer pairs for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep breeding, characterized in that, The KASPAR primer pair includes primers with nucleotide sequences as shown in SEQ ID NO.4-6.
4. The application of a method for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep in breeding, characterized in that... The detection kit contains PCR primer pairs or KASPAR primer pairs, wherein the nucleotide sequences of the PCR primer pairs are shown in SEQ ID NO. 2-3; The nucleotide sequences of the KASPAR primer pairs are shown in SEQ ID NO.4-6.
5. The application of a method for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep in breeding, characterized in that... The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where the Y at position 169 bp represents C or T. The detection method includes the following steps: S1. Amplify the genomic DNA of Hu sheep using PCR primer pairs as shown in SEQ ID NO.2 and SEQ ID NO.3 or KASPAR primer pairs as shown in SEQ ID NO.4-6; S2. The polymorphic site at position 169 of the amplification product obtained in step S1 was identified. The perirenal fat weight of the Hu sheep carrying the TT genotype was significantly lower than that of the Hu sheep carrying the TC genotype, and lower than that of the Hu sheep carrying the CC genotype. The purpose of the breeding was to screen for Hu sheep with low perirenal fat.
6. The application according to claim 5, characterized in that, The typing identification method in step S2 is sequencing, gene chip, fluorescent probe or high-resolution melting curve.
7. The application according to claim 5, characterized in that, When performing PCR amplification using KASPAR primer pairs, after the amplification is complete, the fluorescence signal is detected and the genotyping results are viewed using a BMG PHERAstarCycler instrument.
8. The application of reagents, primer pairs, kits, or methods for detecting molecular markers associated with perirenal fat deposition traits in Hu sheep in the screening of Hu sheep with low perirenal fat deposition, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where the Y at position 169 bp represents C or T. Because there is an A / T mutation at position 169 of the above sequence, it leads to the presence of the Hu sheep. DNAH17 The A / T polymorphism of the gene at this locus; the perirenal fat weight of Hu sheep carrying the TT genotype was significantly lower than that of Hu sheep carrying the TC genotype, and lower than that of Hu sheep carrying the CC genotype.